Содержание

Молекулярно-биологическое исследование слюны на вирус Эпштейна-Барра (Epstein

АНМО «Ставропольский краевой клинический консультативно-диагностический центр»:

355017, г. Ставрополь, ул. Ленина 304

(8652) 951-951, (8652) 35-61-49 (факс)

(8652) 951-951, (8652) 31-51-51 (справочная служба)

Посмотреть подробнее

Обособленное подразделение «Диагностический центр на Западном обходе»:

355029 г. Ставрополь, ул. Западный обход, 64

(8652) 951-951, (8652) 31-51-51 (контактный телефон)

(8652) 31-68-89 (факс)

Посмотреть подробнее

Клиника семейного врача:

355017 г. Ставрополь, пр. К. Маркса, 110 (за ЦУМом)

(8652) 951-951, (8652) 31-51-51 (контактный телефон)

(8652) 31-50-60 (регистратура)

Посмотреть подробнее

Невинномысский филиал:

357107, г. Невинномысск, ул. Низяева 1

(86554) 95-777, 8-962-400-57-10 (регистратура)

Посмотреть подробнее

Обособленное структурное подразделение в г. Черкесске :

369000, г. Черкесск, ул. Умара Алиева 31

8(8782) 26-48-02, +7-988-700-81-06 (контактные телефоны)

Посмотреть подробнее

Обособленное структурное подразделение в г. Элисте :

358000, г. Элиста, ул. Республиканская, 47

8(989) 735-42-07 (контактные телефоны)

Посмотреть подробнее

ЗАО «Краевой клинический диагностический центр»:

355017 г. Ставрополь, ул. Ленина 304

(8652) 951-951, (8652) 35-61-49 (факс)

(8652) 951-951, (8652) 31-51-51 (справочная служба)

Посмотреть подробнее

Обособленное структурное подразделение на ул. Савченко, 38 корп. 9:

355021, г. Ставрополь, ул. Савченко, 38, корп. 9

8 (8652) 316-847 (контактный телефон)

Посмотреть подробнее

Обособленное структурное подразделение на ул. Чехова, 77 :

355000, г. Ставрополь, ул. Чехова, 77

8(8652) 951-943 (контактный телефон)

Посмотреть подробнее

Обособленное структурное подразделение в г. Михайловске:

358000, г. Михайловск, ул. Ленина, 201 (в новом жилом районе «Акварель»).

8(988) 099-15-55 (контактный телефон)

Посмотреть подробнее

Анализы в KDL. ДНК вируса Эпштейна-Барр (Epstein-Barr virus)

Выберите требуемый вид биоматериала

Соскобы из урогенитального тракта не берутся в течение суток после местной терапии (свечи, мази, спринцевания), после полового контакта и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ должно пройти 48 часов. В случае наличия признаков острого воспаления необходимость взятия мазка определяется лечащим врачом. Если необходимо получить соскоб из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Взятие материала на исследование возможно только врачом соответствующей квалификации.

Мокроту можно собрать только при наличии кашля! Перед сбором мокроты рекомендуется почистить зубы и прополоскать рот кипяченой водой. Избегать попадания в мокроту слюны и носовой слизи. Мокрота по мере откашливания собирается в стерильный контейнер. Кашель можно вызвать с помощью нескольких глубоких вдохов.

Первая порция утренней мочи собирается после тщательного туалета наружных половых органов. Перед исследованием не применять местно антибактериальное мыло и антисептические средства.

Взятие материала на исследование возможно только врачом соответствующей квалификации.

Взятие материала на исследование возможно только врачом соответствующей квалификации.

Накануне исследования не применять местные лекарственные препараты и процедуры, исключить половой акт. При взятии соскоба из уретры не мочиться в течение 1,5-2 часов до процедуры. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Взятие материала на исследование возможно только врачом соответствующей квалификации.

Материал рекомендуется собирать до местного применения антибиотиков или антисептиков, до еды, (или не менее чем через 2 часа после еды), можно утром натощак (воду пить и чистить зубы можно).

Взятие материала на исследование возможно только врачом соответствующей квалификации.

Пациент собирает материал самостоятельно путем мастурбации в стерильный контейнер.

Смешанный соскоб урогенитального тракта не берется на фоне местной терапии (свечи, мази, спринцевания) и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ или полового контакта должно пройти 48 часов. Если есть необходимость взятия материала из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование возможно через 14-21 день после окончания приема антибиотиков.

Соскобы из урогенитального тракта не берутся в течение суток после местной терапии (свечи, мази, спринцевания), после полового контакта и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ должно пройти 48 часов. В случае наличия признаков острого воспаления необходимость взятия мазка определяется лечащим врачом. Если необходимо получить соскоб из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Взятие материала на исследование возможно только врачом соответствующей квалификации.

Накануне взятия материала не применять местные антибиотики и антисептики в виде спреев, полоскания, капель, мазей. Материал берется натощак или не ранее, чем через 2 часа после еды. Чистить зубы (пастой без антибактериальных компонентов) можно.

Материал для исследования можно взять утром натощак или в течение дня, не ранее чем через 2 часа после еды. Чистить зубы и пить воду можно. Накануне взятия материала не применять местно антибиотики или антисептики в виде полосканий, капель или спреев. Повторное исследование для контроля излеченности целесообразно не ранее, чем через 4 недели.

Материал для исследования можно взять утром натощак или в течение дня, не ранее чем через 2 часа после еды. Чистить зубы и пить воду можно. Накануне взятия материала не применять местно антибиотики или антисептики в виде полосканий, капель или спреев. Повторное исследование для контроля излеченности целесообразно не ранее, чем через 4 недели.

Материал для исследования можно взять утром натощак или в течение дня, не ранее чем через 2 часа после еды. Чистить зубы и пить воду можно. Накануне взятия материала не применять местно антибиотики или антисептики в виде полосканий, капель или спреев. Повторное исследование для контроля излеченности целесообразно не ранее, чем через 4 недели.

Материал берется до начала терапии. Накануне не использовать антисептики, в течение двух часов исключить любые местные процедуры (промывания, капли). В случае невозможности взятия материала в медицинском офисе, Вы можете получить бесплатно расходный материал и обратиться к Вашему врачу- офтальмологу.

Epstein Barr Virus, ДНК [реал-тайм ПЦР]

Молекулярно-генетическое исследование, позволяющее выявить в крови ДНК возбудителя инфекционного мононуклеоза – вируса Эпштейна – Барр.

Синонимы русские

Вирус инфекционного мононуклеоза, вирус Эпштейна – Барр.

Синонимы английские

EBV, DNA, Epstein-Barr virus, DNA.

Метод исследования

Полимеразная цепная реакция в режиме реального времени.

Какой биоматериал можно использовать для исследования?

Амниотическую жидкость, венозную, капиллярную кровь, ликвор, мазок из зева (ротоглотки), слюну.

Общая информация об исследовании

Вирус Эпштейна – Барр – это широко распространенный вирус семейства Herpesviridae, который размножается преимущественно в B-лимфоцитах, но также может инфицировать Т-лимфоциты и эпителиальные клетки. Путь передачи – воздушно-капельный. Пик заболеваемости – 15-25 лет. Первый контакт с вирусом Эпштейна – Барр происходит, как правило, в детском возрасте (до 10 лет), что вызывает развитие латентной бессимптомной или малосимптомной инфекции.

Инфицирование у взрослых людей приводит к инфекционному мононуклеозу, который у большинства заболевших сопровождается лихорадкой, интоксикацией, а также поражением лимфоузлов (лимфоаденопатией), небных и глоточных миндалин. Нередко увеличивается печень, селезенка, появляются петехии на слизистой верхнего неба. Иногда инфекционный мононуклеоз осложняется гепатитом, пневмонией, гемолитической анемией, тромбоцитопенией, апластической анемией, разрывом селезенки, а также кардиологическими (миокардит) и неврологическими нарушениями (синдром Гийена – Барре, энцефалит, менингит). В редких случаях развивается хроническая активная инфекция, при которой симптомы заболевания сохраняются на протяжении более чем 6 месяцев после первичного инфицирования вирусом Эпштейна – Барр, а также имеются гистологические признаки поражения внутренних органов (пневмонит, гепатит, гипоплазия костного мозга, увеит) и выявляются антигены или ДНК вируса Эпштейна – Барр в тканях. Кроме того, при этом состоянии часто бывают очень высокие титры вирус-специфических антител.

И напротив, при синдроме хронической усталости титр антител к вирусу Эпштейна – Барр или другим вирусам лишь немного повышен.

Вирус Эпштейна – Барр инфицирует свыше 90 % здоровой популяции и сохраняется в небольших количествах в В-клетках памяти. Соответственно, около 90  % взрослых людей являются вирусоносителями. Вирус сохраняется в В-лимфоцитах и клетках эпителия на протяжении всей жизни и при снижении иммунитета (например, при ВИЧ-инфекции или иммуносупрессивной терапии) может способствовать развитию лимфопролиферативных заболеваний, назофарингеальной карциномы или – наиболее часто – инфекционного мононуклеоза.

Для выявления возбудителя используется метод полимеразной цепной реакции, которая позволяет обнаружить ДНК вируса. Принцип метода основан на многократном увеличении числа копий специфичного для данного возбудителя участка ДНК.

Для чего используется исследование?

  • Для диагностики инфекционного мононуклеоза.
  • Для дифференциальной диагностики герпетических инфекций.
  • Для дифференциальной диагностики при ангинах и тонзиллитах.
  • Для выявления реактивации вируса Эпштейна – Барр при трансплантации органов и тканей.

Когда назначается исследование?

  • При клинических (гепатоспленомегалия, тонзиллофарингит, припухлость околочелюстных и шейных лимфатических узлов) и лабораторных (атипичные лимфоциты в периферической крови) признаках инфекционного мононуклеоза на ранних этапах заболевания (до нарастания титра антител).
  • При ВИЧ-инфекции.
  • При проведении иммуносупрессивной терапии после трансплантации органов или костного мозга.

Что означают результаты?

Референсные значения: отрицательно.

Причины положительного результата

  • Инфицирование вирусом Эпштейна – Барр или вирусоносительство.
  • Реактивация инфекции, вызванной вирусом Эпштейна – Барр.

Причины отрицательного результата

  • Отсутствие инфекции, вызванной вирусом Эпштейна – Барр.
  • Низкое содержание вируса Эпштейна – Барр в крови.

Что может влиять на результат?

  • Предшествующая противовирусная терапия.

Бесполезные анализы. ПЦР слюны на вирусы Эпштейн-Барр, герпеса человека 6 типа и цитомегаловирус

Автор: Доктор Никольский | 9 апреля 2016 г.

Мононуклеоз — модная тема. Все педиатры и смежные специалисты обожают его искать и находить везде, где он есть. Но нередко и там, где его нет.

Что значит модная тема? То, чем можно объяснить все проблемы — например, частые болезни у ребенка, что чаще всего, в раннем возрасте, является нормой.

Раньше у всех искали дисбактериоз и лямблии, теперь у всех подряд ищут антитела к герпесвирусам. Особенно в этом почему то преуспели ЛОРы (см. фокус-покус). Находя IgG к вирусу герпеса человека 6 типа (ВГЧ-6), цитомегаловирусу (ЦМВ) и вирусу Эпштейн-Барр (ВЭБ), они делают большие глаза, объявляют, что у ребенка мононуклеоз, и начинают его интенсивно «лечить». Хотя обнаружение IgG является вариантом нормы. IgG означает, что пациент уже перенес эту инфекцию. И это чаще всего протекает субклинически, незаметно.

Но еще дальше пошли некоторые инфекционисты. После перенесенного инфекционного мононуклеоза, эти ребята мало того, что запугивает народ россказнями про сниженный иммунитет, вред солнца и медотводы от прививок (см. монокомплекс), но и начинают интенсивно «наблюдать» пациента.

В принципе, нет ничего плохого в лишнем осмотре доктора и дополнительном клиническом анализе крови. Но некоторым специалистам этого мало и они раз за разом назначают ПЦР слюны на ВГЧ-6, ЦМВ и ВЭБ. И что интересно, вирусы то выявляются и тогда доктор назначает «лечение» — то есть разные иммуномодулятор с недоказанным действием. То не выявляются, и врач гордо объявляет, что он победил вирус, хотя это на самом деле не возможно.

Что же на самом деле означает обнаружение ВГЧ-6, ЦМВ и ВЭБ в слюне? Да собственно говоря, ничего.

Если человек сталкивался когда-либо в жизни с ВГЧ-6, ЦМВ и ВЭБ, что весьма вероятно, то эти вирусы остаются в организме, (в том числе, в слюне), навсегда. Их количество в слюне может колебаться: то увеличиваться и тогда выявляться с помощью ПЦР, то снижаться, до неопределяемого минимума. И все это совершенно не опасно. Человек живет в мире со своими микробами и различными вирусами, и они нисколько ему не мешают, если только у пациента не возникнет мощный иммунодефицит.

Поэтому ПЦР слюны может считаться подтверждением острой инфекции, только если в крови не выявляются IgG к искомому вирусу. (Исключение — новорожденные, у которых обнаружение с помощью ПЦР ВГЧ-6, ЦМВ не зависимо от IgG свидетельствует о текущей инфекции).

Если же ПЦР слюны положительная и в крови есть IgG, это говорит лишь о том, что пациент уже перенес инфекцию и сейчас не болеет.

Обнаружение вируса Эпштейн — Барра (ВПГ-IV) в биологическом материале методом ПЦР качественное

Вирус Эпштейна – Барр – это является наиболее часто распространенным вирусом семейства вируса герпеса 4 типа. Свое название он получил в честь открывателей Майкла Эпштейна и его аспирантки Ивонны Барр. Последние фундаментальные труды ученых заставляют относиться к этому вирусу более серьезно, чем это было принято годами ранее.

Вирус Эпштейна – Барр инфицирует свыше 90% здоровой популяции и сохраняется в небольших количествах в В-клетках памяти. Соответственно, около 90% взрослых людей являются вирусоносителями. Младенцы становятся восприимчивыми к ВЭБ, как только в их крови исчезают материнские антитела. Вирус содержится в биологических жидкостях организма, особенно высокая его концентрация обнаруживается в слюне. Вирус передается воздушно-капельным и контактным путем. Самый высокий риск заражения – во время поцелуя. По этой причине у заболевания, вызываемого ВЭБ, помимо научного названия есть еще и неофициальное имя – «Болезнь поцелуя».

В ротовой полости вирус поражает эпителиальные клетки, что вызывает воспаление глотки и миндалин – «инфекционный мононуклеоз». Клинические проявления болезни ничем не отличаются от обычной ангины, кроме вероятности увеличения селезенки. Также имеются особые лабораторные данные – появления атипичных мононуклеаров в крови, но обнаружить их можно только при детальной микроскопии мазка крови. Поэтому чаще всего на основании жалоб пациента и внешнего вида зева выставляется диагноз ангина или ОРВИ. Сам по себе мононуклеоз опасность для жизни человека представляет в единичных случаях, когда возможен разрыв селезенки. Опасаться стоит присоединения вторичной инфекции за счет снижения иммунитета и перехода болезни в хроническую форму.

Самой тяжелой формой инфицирования вирусом является лимфома – рак лимфатических узлов. В лимфатических узлах скапливаются В-лимфоциты, пораженные ВЭБ, и начинают бесконтрольно размножаться, что и приводит к развитию опухоли.

Но наиболее часто вирус Эпштейна-Барр вызывает болезнь, о возможности существования которой, многие люди и не подозревают – это синдром хронической усталости (СХУ): заболевание, включенное в список Международной Классификации Болезней (МКБ-10). Синдром характеризуется длительной усталостью, общей слабостью, которая не проходит даже после длительного отдыха. Это не субъективное состояние, придуманное, чтобы отлынивать от работы, а самостоятельная патология, сопровождающаяся нарушением баланса между нервной, эндокринной и иммунной системой человека. Клинические проявления варьируют от незначительного «недомогания», которое можно перебороть за счет индивидуальных волевых качеств, до тяжелой депрессии, приковывающей пациента к постели (10% случает заболевания). К сожалению, синдром хронической усталости очень тяжело диагностировать в виду того, что состояние маскируется под видом функциональных расстройств со стороны сердечной и нервной системы, желудочно-кишечного тракта, мочевого пузыря.

Путь передачи – воздушно-капельный. Пик заболеваемости – 15-25 лет. Первый контакт с вирусом Эпштейна – Барр происходит, как правило, в детском возрасте (до 10 лет), что вызывает развитие латентной бессимптомной или малосимптомной инфекции.

Для выявления возбудителя используется метод полимеразной цепной реакции, которая позволяет обнаружить ДНК вируса. Принцип метода основан на многократном увеличении числа копий специфичного для данного возбудителя участка ДНК.

Интермедикал | Вирус Эпштейна – Барра

Вирус Эпштейна-Барра относится к группе вирусов герпеса (4 тип) и является возбудителем инфекционного мононуклеоза. Однажды, попав в организм человека, он остается с ним навсегда. Заражение может происходить разными способами, так инфекция находится в крови человека, его слюне, выделениях, моче, грудном молоке и т.д. Вирус Эпштейна-Барра достаточно быстро погибает во внешней среде, поэтому можно с высокой долей вероятности утверждать, что он переносится при тесном контакте инфицированного человека со здоровым – при поцелуях, при половом контакте, при переливании крови, при родах.

При заражении инфекционным мононуклеозом, у человека проявляются симптомы обычной вирусной инфекции – повышается температура, появляются боли в горле, увеличиваются лимфатические узлы, наблюдается слабость и головные боли. Анализ крови показывает изменения в лимфоцитах. Примерно через пару недель, могут измениться «печеночные пробы» при биохимическом анализе крови, так как появляются симптомы гепатита – воспаления печени. Но, их может и не быть. Большую часть инфицированных людей, а их число составляет около 90% всего населения, не испытывают никаких недомоганий и вирусная инфекция долгие годы просто ждет своего часа, когда сможет активизироваться и начать развиваться. Как и большинство герпетических инфекций, вирус Эпштейна –Барра, поражает организм человека при ослаблении иммунитета, например, при заражении другими инфекционными заболеваниями, при переохлаждении или перегреве, при беременности, при стрессе и хронических заболеваниях и др.

Иммунноферментная диагностика основана на выявлении иммуноглобулинов к вирусу на разных этапах его развития в организме человека. Это позволяет врачу выявить степень поражения инфекцией и составить грамотную схему оптимального лечения пациента.

Специальная подготовка не требуется. Рекомендуется взятие крови не ранее чем через 4 часа после последнего приема пищи.

  • Всем, кто длительное время не может выявить причину своих недомоганий, например, хронической усталости
  • Всем женщинам, которые планируют беременность. Заражение инфекционным мононуклеозом во время беременности, чревато патологиями плода и беременности, а также послеродовыми осложнениями

Интерпретация результатов исследования содержит информацию для лечащего врача и не является диагнозом. Информацию из этого раздела нельзя использовать для самодиагностики и самолечения. Точный диагноз ставит врач, используя как результаты данного обследования, так и нужную информацию из других источников: анамнеза, результатов других обследований и т.д.

 

Формат выдачи результата: количественный.

Единицы измерения: Ед/мл.

Референсные значения:

  •   отрицательно;
  •   положительно.

Положительный результат:

  1. острая инфекция вирусом Эпштейна-Барр;
  2. инфекция в прошлом;
  3. реактивация.

Отрицательный результат:

  1. отсутствие инфицирования вирусом Эпштейна-Барр;
  2. ранняя острая инфекция (при клинических подозрениях повторить в динамике через 10 — 14 дней).

Анализ на вирус Эпштейна

Виррус Эпштейна — Барр (ВЭБ), или вирус герпеса человека 4 типа — вид вирусов из семейства герпесвирусов. Вирус Эпштейна-Барр распространён среди населения планеты.  Ему приписывают участие в образовании опухолевых клеток в человеческом организме. Многие люди, зараженные вирусом, переносят болезнь практически без симптомов. На начальной стадии вирус не представляет особой угрозы, потому что не поражает важных органов, системы кровообращения. Но при наступлении осложнений вирус способен разрушать клетки головного мозга.
Передается воздушно-капельным путем, преимущественно со слюной, в некоторых случаях контактно-бытовым, иногда при переливании крови, при трансплантации и является высококонтагиозным (легко заразиться). Максимально большое количество вирусных частиц находится в клетках эпителия около слюнных желез, и со слюной выделяется. Не удивительно, что инфекционный мононуклеоз — самое распространённое заболевание, вызываемое вирусом Эпштейна-Барр. Его называют ещё болезнью поцелуев. У многих людей, заражённых вирусом Эпштейна — Барр, болезнь проходит бессимптомно.
Важно то, что у 25% людей-  переносчиков вируса сами частицы обнаруживаются в слюне постоянно. Это значит, что на протяжении всей жизни даже при отсутствии каких-либо симптомов болезней они являются активными источниками инфекции.
Антитела  к вирусу Эпштейна-Барр обнаруживают у 60% детей первых двух лет жизни и у 80–100% взрослых.
    
Вирус Эпштейна-Барр состоит из двуспиральной ДНК. ДНК содержится внутри и играет роль носителя информации. Он способен размножаться  в В-лимфоцитах; в отличие от других вирусов герпеса он не вызывает гибели клеток, а напротив, активирует их пролиферацию. Вирионы включают специфические антигены: капсидный (VCA), ядерный (EBNA), ранний ЕА .Каждый из них образуется в определённой последовательности и индуцирует синтез соответствующих антител.
Диагностика инфекции, передаваемой вирусом Эпштейн-Барр:
Диагностика и подтверждение диагноза комплексное:

  •     общий анализ крови с выявлением лейкоцитоза, лимфоцитоза, моноцитоза и появлением  мононуклеаров.
  •     Специфическая серологическая диагностика – определение антител к антигенам вируса Эпштейн-Барр
  •     Выявление ДНК качественно и количественно  в соскобе  с задней стенки глотки, в крови и моче.


Антитела IgM к капсидному белку VCA —  способны появляться в теле больного, ещё до начала появления клинических симптомов. Эти антитела считаются показателями острой фазы течения заболевания. Антитела IgM VCA  проявляюся при повторной активации инфекции, свидетельствуя о реактивации процесса. Их нахождение в крови человека длительное время, свидетельствует о наличии хронической формы течения инфекции. Наличие в крови IgM к капсидному белку EBV при отсутствии IgG антител к ядерному антигену указывают на инфицирование впервые.
IgG к раннему АГ (ЕА) — наличие данных антител свидетельствует о первичном проникновении вируса Эпштейна-Барр, которое протекает в острой форме. IgG находятся в крови в острой фазе заболевания и с исчезновением клинических симптомов, исчезают. Циркулируют в крови не более 2 месяцев. Дальнейшее возникновение IgG свидетельствует о реактивации процесса и  клинических проявлений.
Антитела IgG к капсидному антигену  в небольшом количестве сохраняются в организме человека после перенесенного заболевания на протяжении всей жизни. При первичном инфицировании появляются через 1. 5-2 месяца после начала проявления симптомов болезни.
EBV-EBNA.  Антитела к нему определяются  только через месяц после заражения вирусом. Характеризуются высокими показателями и  остаются  в крови на протяжении всей жизни человека как показатель перенесенной инфекции.

Динамика выделения ВЭБ указывает на центральную роль эпителиальных клеток в усилении вирусного выброса

Abstract

Для разработки более детальных моделей персистенции ВЭБ мы изучили динамику выделения вируса у здоровых носителей. Мы демонстрируем, что выделение ВЭБ в слюну является непрерывным и быстрым, так что уровень вируса восстанавливается за ≤2 минуты, среднее время, за которое нормальный человек глотает. Таким образом, рот является не резервуаром вируса, а каналом, через который в слюне проходит непрерывный поток вируса.Следовательно, вирус выделяется с гораздо большей скоростью, чем считалось ранее, уровень слишком высок, чтобы его можно было объяснить репликацией в В-клетках только в кольце Вальдейера. Выделение вируса относительно стабильно в течение коротких периодов (часы-дни), но колеблется от 3,5 до 5,5 log в течение более длительных периодов, степень изменчивости, которая также не может быть объяснена исключительно репликацией в В-клетках. Эта изменчивость означает, вопреки тому, что обычно считается, что определение высокого и низкого шеддера является не столько функцией различий между людьми, сколько внутри отдельных людей с течением времени.Динамика выделения описывает процесс, управляющий продуцированием вируса, который происходит независимо ≤3 раза в каждый момент времени. Этот процесс экспоненциально растет, а затем случайным образом прекращается. Мы предполагаем, что эта динамика лучше всего объясняется моделью, в которой отдельные В-клетки спорадически выделяют вирус, который заражает от 1 до 5 эпителиальных клеток. Эта инфекция распространяется с постоянной экспоненциальной скоростью и прекращается случайным образом, в результате чего образуются инфицированные бляшки эпителиальных клеток размером от 1 до 10 5 клеток. В любой момент времени существует очень небольшое количество (≤3) бляшек. Мы предполагаем, что окончательный размер этих бляшек является функцией скорости распространения инфекции в лимфоэпителии, которая может регулироваться структурной сложностью ткани, но в конечном итоге ограничивается иммунным ответом.

Резюме автора

Вирус Эпштейна-Барр представляет собой человеческий патоген, связанный с несколькими видами рака человека, который, тем не менее, доброкачественно персистирует в виде латентной инфекции у большинства взрослых.Персистенция ВЭБ характеризуется наличием латентно инфицированных клеток в крови и выделением вируса в слюну. Мы представляем первый систематический количественный анализ выделения вируса. Мы показываем, вопреки тому, что считалось ранее, что выделение происходит непрерывно и на высоком уровне для всех испытуемых. Это постоянное присутствие инфекционного вируса может быть решающим фактором риска в развитии EBV-ассоциированной опухоли носоглоточной карциномы. В отличие от инфицированных клеток в крови, уровень которых поддерживается на очень стабильном уровне в течение многих лет, мы показываем, что выделение вируса сильно варьируется, так что в любое время у любого человека может быть относительно высокий или низкий уровень выделения.Мы проанализировали эту динамику математически и с помощью простой имитационной модели. Мы находим, что их можно объяснить простой экспоненциальной функцией, которая, как мы предполагаем, представляет собой расширение 1–3 бляшек эпителиальных клеток.

Образец цитирования: Хадиното В., Шапиро М., Сан К.С., Торли-Лоусон Д.А. (2009) Динамика выделения ВЭБ указывает на центральную роль эпителиальных клеток в усилении вирусного выброса. PLoS Патог 5(7): е1000496. https://doi.org/10.1371/journal.ppat.1000496

Редактор: Samuel H. Speck, Университет Эмори, Соединенные Штаты Америки

Получено: 11 февраля 2009 г. ; Принято: 3 июня 2009 г .; Опубликовано: 3 июля 2009 г.

Авторские права: © 2009 Hadinoto et al. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: Эта работа была поддержана исследовательскими грантами общественного здравоохранения CA65883, AI18757 и AI062989. MS был поддержан грантом на исследования в области общественного здравоохранения № 1K25AI79404-01. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Вирус Эпштейна-Барр представляет собой вирус герпеса человека, обладающий способностью трансформировать В-лимфоциты в культуре в непрерывно пролиферирующие лимфобласты [1],[2]. Однако он сохраняется in vivo в покоящихся В-клетках памяти, происходящих из зародышевого центра [2], [3], которые мы называем mB Lat [4]. Общепринятая модель персистенции вируса предполагает, что вирус использует свои трансформирующие способности для активации недавно инфицированных покоящихся В-клеток, а затем вирусные белки, связанные с латентностью, передают суррогатные сигналы, позволяющие вновь активированным клеткам дифференцироваться через зародышевый центр в компартмент памяти [1]. – [3].

ВЭБ

имеет клиническое значение из-за его вовлеченности в несколько видов рака человека, включая болезнь Ходжкина, лимфому Беркитта, иммунобластную лимфому с подавленным иммунитетом, карциному носоглотки и желудка [5], [6].Способность иммортализировать В-клетки и тот факт, что ВЭБ кодирует несколько потенциальных онкогенов [7], [8], является одним из источников риска онкогенеза, связанного с ВЭБ. Вторым фактором предрасположенности к раку, связанному с ВЭБ, является то, что вирус вызывает персистентную инфекцию, приводящую к пожизненному контакту хозяина с инфекционным вирусом и продуктами вирусного гена. Тканью, наиболее подверженной инфекционному вирусу, является эпителий миндалин и носоглотки, поскольку именно здесь вирус реплицируется и попадает в слюну для горизонтального распространения инфекции новым хозяевам [9], [10].Длительное воздействие инфекционного вируса в этой анатомической области может быть важным фактором риска развития рака носоглотки, ассоциированного с ВЭБ.

Хотя выделение вируса является признаком персистирующей инфекции, насколько нам известно, оно не изучалось систематически у здоровых носителей вируса с помощью чувствительных методов количественной ПЦР. Поэтому в настоящее время не хватает систематических количественных данных о вирусовыделении, которые позволили бы сформулировать и протестировать модели продукции вируса.Следовательно, остается неясным, что регулирует уровень выделения вируса в слюне. В некоторых предыдущих исследованиях для обнаружения ВЭБ [10], [11] использовался биологический анализ, основанный на его способности трансформировать В-клетки в культуре. Однако в наших руках этот анализ ненадежен, нечувствителен и не является количественным. Другие использовали относительно нечувствительные и, следовательно, неколичественные подходы ПЦР для оценки выделения вируса, особенно во время острых инфекций, например. [12]–[15]. Возможно, неудивительно, что эти исследования дали противоречивые результаты.Например, одно исследование пришло к выводу, что выделение вируса коррелирует с уровнем инфицированных В-клеток в крови, тогда как второе исследование не обнаружило такой корреляции [11], [13]. Однако в целом в этой области, по-видимому, существует мнение, что людей можно классифицировать по относительным уровням выделения на высокие, средние и низкие уровни выделения, при которых выделение вируса носит спорадический характер и часто не поддается обнаружению [5], [11]. Поскольку эти выводы основаны на неколичественных и нечувствительных анализах, их трудно оценить и согласовать.Например, неясно, связано ли неспособность обнаружить вирус с его отсутствием или просто с нечувствительностью используемых анализов.

Ранее мы разработали чувствительные методы количественной ПЦР для обнаружения ДНК EBV [4], [16] и продуктов гена EBV [17], [18]. С помощью этих тестов мы впервые показали, что уровни инфицированных вирусом клеток в крови здоровых носителей индивидуально специфичны и высоко стабильны в течение длительных периодов времени (годы) [19]. В этом исследовании мы решили применить тот же подход к динамике выделения вируса в слюну здоровыми носителями вируса и использовать эти данные для разработки и тестирования потенциальных моделей выделения ВЭБ.Мы обнаружили, что общая динамика сильно указывает на то, что эпителий является местом, где вирус амплифицируется перед выделением.

Результаты

Высокий уровень выделения вируса здоровыми носителями ВЭБ

Традиционно уровни вируса в слюне оценивались в определенный момент времени, когда субъекты полоскали горло определенным объемом жидкости. Затем количество вируса в полоскании измеряют либо с помощью биологического анализа [10], [11], основанного на трансформации В-клеток в культуре, либо с помощью ПЦР для количества копий вирусных геномов [12]–[15]. Однако этот тип анализа является статическим и не дает кинетической информации о скорости продукции вируса. Поэтому в нашей первой серии исследований мы стремились измерить скорость производства вируса, сначала вымывая весь вирус из слюны, а затем измеряя скорость, с которой вирус возвращается. С этой целью добровольцев попросили последовательно полоскать и полоскать горло 5 см3 жидкости, а уровни вируса измеряли с помощью количественного метода ПЦР ДНК, который может обнаружить одну копию вирусного генома.К нашему удивлению, последовательные полоскания не смогли снизить уровень вируса в слюне, даже когда было протестировано до 8 полосканий подряд (на рис. 1 показаны результаты для двух испытуемых, которые находились на более низком и верхнем уровне выделения вируса соответственно во время выделения). эксперимент). Это сохранялось даже тогда, когда испытуемые пытались смыть вирус сначала с помощью 4 последовательных полосканий по 25 мл, а затем с помощью еще двух полосканий по 25 мл. После каждой попытки последующая промывка объемом 5 мл содержала практически такое же количество вируса, как и исходная промывка (см. Рисунок S1).Таким образом, мы пришли к неожиданному выводу, что вирус постоянно выделяется в слюну с такой высокой скоростью, что вирус, удаленный промыванием, уже был заменен к тому времени, когда мы повторно протестировали слюну (~ 2 минуты). Насколько нам известно, этот простой метод последовательного отбора проб применяется впервые и приводит нас к выводу, что скорость производства вирусов намного выше, чем считалось ранее. На рисунке 1 показано предполагаемое выделение вируса в день для двух проанализированных субъектов, что позволяет сделать вывод о том, что 5×10 5 и 10 8 геномов продуцируются субъектом 1 и 2 соответственно за полоскание или 3.2×10 8 и 6×10 10 в день.

Рисунок 1. Уровень вируса в слюне стабилен и не может быть устранен повторным промыванием.

Двух испытуемых попросили повторно промыть 5 мл жидкости, и число копий вирусного генома в промывках было определено с помощью ПЦР ДНК, специфичной для EBV, для последовательности повторов W вирусного генома. Обратите внимание, что даже после 8 последовательных полосканий был обнаружен аналогичный уровень вируса. Расчет справа основан на среднем времени между промываниями, составляющем примерно 2 минуты, и конечном объеме промывания слюной 5 мл.

https://doi.org/10.1371/journal.ppat.1000496.g001

Расчетное количество клеток, необходимое для выделения вируса

По оценкам, время продукции вируса отдельными клетками в культуре составляет примерно 24 часа от инициации транскрипции литического гена до высвобождения инфекционного вируса [20]. Однако, насколько нам известно, никто не пытался точно оценить размер вирусной вспышки. Мы делали это несколько раз как для линий В-клеток (Akata и B95-8), так и для линий эпителиальных клеток (HONEAkata и AGSBX1).Фракция клеток, реплицирующих вирус, оценивалась с помощью проточной цитометрии после окрашивания на вирусный капсидный антиген через 48 часов после стимуляции. Количество высвобожденного вируса измеряли путем проведения ПЦР ДНК, специфичной к EBV, на супернатантах клеточных культур через 72 часа. Результаты этого анализа суммированы в таблице 1. Для линий В-клеток средняя продукция была довольно близкой, несмотря на их очень различное происхождение или на то, был ли вирус химически индуцирован. Аналогично для двух линий эпителиальных клеток.Однако продукция эпителиальных клеток (6,2×10 5 копий генома на клетку) была примерно в десять раз выше, чем у В-клеток (7,3×10 4 копий генома на клетку). Однако появилось менее 10% этих геномов. быть интактными вирионами, основанными на устойчивости к расщеплению ДНКазой. (Таблица 1).

Используя размер пакета 7,3×10 4 копий генома на В-клетку и предполагая 24-часовой литический цикл, мы можем оценить, что выделение Субъектами 1 и 2 потребует производства вируса от 4.4×10 3 и 8,2×10 5 В-клеток в сутки соответственно. Это на несколько логарифмов выше, чем значение, которое мы измерили ранее для числа лимфоцитов в кольце Вальдейера, завершивших репликацию вируса, которое, по нашим оценкам, является чрезвычайно малым, в среднем 0,5 клетки в день с верхней границей <100 (вставка 1). Таким образом, мы можем заключить, что В-клеток, реплицирующих ВЭБ в кольце Вальдейера, недостаточно, чтобы объяснить уровень выделения вируса в слюну (см. также вставку 1 и обсуждение).

Вставка 1. Ни абсолютные уровни, ни изменение выделения вируса с течением времени не могут быть объяснены только В-клетками, реплицирующими вирус в кольце Вальдейера

Частота инфицированных В-клеток в кольце Вальдейера у большой когорты здоровых носителей колеблется от 1/10 7 до 1/10 4 [27].

Если предположить, что 10 10 В-клеток во всем кольце Вальдейера, то имеется не более 10 6 инфицированных В-клеток. Мы измерили, что доля инфицированных В-клеток, реплицирующих вирус в день (при 24-часовом литическом цикле), не превышает 0.5%* [26].

Следовательно, существует не более ~5×10 3 клеток, реплицирующих вирус. А.

В качестве альтернативы: при скрининге небных миндалин мы обнаружили репликацию вируса у 8 из 20 субъектов [26]. Применяя статистику Пуассона, можно предположить, что в среднем на небную миндалину приходится 0,51 клетки или 6,5 на кольцо Вальдейера, реплицирующих вирус в любое время. Б.

Однако ранее мы показали, что только 10% большинства клеток, которые инициируют репликацию вируса в кольце Вальдейера, завершают ее.

Следовательно, не более 5×10 2 В-клеток завершают репликацию вируса в день (из линии А), в среднем всего 0,65 в день (из линии В).

Из таблицы 1 размер пакета на В-клетку = 7,3×10 4 копий генома.

Следовательно, максимальное количество вируса, которое могут продуцировать В-клетки в кольце Вальдейера

 = 5×10 2 ×(7,3×10 4 )   = 3,6×10 7 копий генома в сутки        7     

А в среднем за сутки

 = 0.65×(7,3×10 4 )   = 4,7×10 4 копий генома в день

Из рисунка 5 диапазон выделения для 8 здоровых носителей

 = от 5 до 2×10 7 геномов/мл/полоскание

Если полоскание занимает в среднем 2 минуты и содержит 5 мл, то диапазон выделения в день для 8 здоровых носителей

 = (от 5 до 2×10 7 геномов/мл)×5 мл/полоскание×30 полосканий/час×24 часа

 = 1,8×10 4 до 7,2×10 10 копий генома в день                    

Сравнение линии C и линии D показывает, что существует ~3 логарифмическое расхождение между максимальным уровнем выделения вируса, который может быть объяснен В-клетками, и верхним пределом, который мы фактически измерили.

*Примечание. Это значение основано на оценке 2 миндалин, которые имели самый высокий сигнал для экспрессии вирусного литического гена BZLF1, поэтому оно представляет собой верхний предел % инфицированных клеток, реплицирующих вирус.

Стабильность выделения вируса во времени

Рисунок 1 демонстрирует, что выделение вируса в слюну было достаточно стабильным, по крайней мере, в течение коротких периодов времени.Когда мы измеряли выпадение у одних и тех же людей в течение нескольких часов или дней, мы наблюдали аналогичную степень стабильности (рис. 2). Однако при более длительном отслеживании (до полутора лет) мы увидели совершенно иной результат (рис. 3) с колебаниями более 4–5 log. Чтобы проверить, было ли это изменение следствием переменной «агрессивности» в процедуре отбора проб с течением времени, мы также провели ПЦР для внутреннего клеточного контрольного гена (bcl-2). Когда уровни клеточной ДНК в слюне отслеживались в течение трех месяцев у трех человек, наибольшее изменение в восстановлении, которое мы получили, было 40-кратным по сравнению с 1. 5×10 4 кратность выделения вируса в одних и тех же образцах (не показаны) Это указывает на то, что изменчивость выборки не была источником наблюдаемой нами изменчивости выделения вируса. В отличие от вирусовыделения мы показали ранее, что уровень латентно инфицированных В-клеток памяти (mB Lat ) в крови здоровых носителей чрезвычайно стабилен в течение многих лет [19] и даже десятилетий (неопубликованные наблюдения DTL) у здоровых носителей. Чтобы подтвердить, что это верно для субъектов и времени, изучаемого здесь, мы измерили уровни mB Lat в их крови в то же время, когда мы измеряли выделение вируса.Как и ожидалось, уровни mB Lat в их крови были стабильными в течение всего периода времени (рис. 3).

Рисунок 2. Выделение вируса стабильно в течение нескольких часов и дней.

Столбцы представляют уровни вирусной ДНК, обнаруженные в слюне в указанные моменты времени. Подробности см. в условных обозначениях к рисунку 1. N.B. Для данных на нижней правой панели одиночные пробы были взяты в день 1 и 2, но две пробы были взяты в дни 3 и 8, одна утром (утром) и одна вечером (после полудня).

https://дои.org/10.1371/journal.ppat.1000496.g002

Рисунок 3. Выделение вируса, но не уровни инфицированных клеток, изменяются на 4–5 логарифмических единиц в течение месяцев/лет.

Количество вируса, выделяемого в слюне, и частота латентно инфицированных mB Lat в крови измерялись одновременно у трех человек в течение 500 дней. Обратите внимание, что выделение вируса варьируется в пределах от 4 до 5 журналов, тогда как частота mB Lat варьируется менее чем в один журнал.

https://дои.org/10.1371/journal.ppat.1000496.g003

Мы пришли к выводу, что, хотя выделение вируса внутри человека довольно стабильно в течение коротких периодов времени (часы/дни), оно сильно варьируется в течение месяцев и лет. Как описано выше, мы ранее показали, что количество В-клеток, завершающих репликацию вируса в день в кольце Вальдейера, невелико, поэтому также невозможно объяснить вариации выделения внутри человека просто с точки зрения вариации количества В-лимфоцитов. репликации вируса в кольце Вальдейера в любой момент времени (см. также Обсуждение).

Субъекты не могут быть выделены как высокие, средние или низкие шеддеры

Мы проанализировали данные с рис. 3, чтобы увидеть, содержит ли он основную структуру, которая могла бы пролить свет на динамику и механизм выделения вируса. Наиболее показательной была кумулятивная функция распределения (CDF). CDF (http://en.wikipedia.org/wiki/Cumulative_distribution_function) описывает распределение вероятностей случайной величины X с действительным знаком, в данном случае логарифмического значения выделения вируса.CDF данного значения X представляет собой долю измерений, значение которых равно или меньше X. По мере увеличения значения X CDF X увеличивается от 0 до 1. Так, например, медиана для набора измерений имеет CDF 0,5. CDF для трех субъектов на рисунке 3 представлены на рисунке 4A. Здесь значения журнала выделения вирусов нанесены кумулятивно от самого низкого до самого высокого и, таким образом, представлены в виде шагов, а количество точек данных нормализуется путем установки общего значения равным 1. Поразительно, что распределения были по существу линейными для всех трех наборов данных. Чтобы увидеть, было ли это совпадением, уникальным для данного конкретного эксперимента, или общим свойством выделения вируса, мы проанализировали большой набор данных, собранный у 8 разных субъектов в течение длительного периода времени (до двух лет), который также включал гораздо большее количество точки данных для субъектов 1–3 (по сути, дополнительные точки, для которых у нас не было соответствующих измерений уровня в крови). Сводка всех этих данных, которая включает в себя в общей сложности 165 положительных точек данных и 8 моментов времени, когда выделение вируса не было обнаружено, представлена ​​в диаграммах на рисунке 5A и в таблице S1.Моменты времени, когда выделение вируса не было обнаружено, не включены в диаграммы, но обозначены звездочками на рисунке 5A. Мы уверены, что в это время в образцах слюны не было вирусной ДНК, потому что наша методика ПЦР может воспроизводимо обнаруживать одну копию вирусного генома, а положительное обнаружение контрольной клеточной последовательности (bcl-2) подтвердило, что процесс взятия образцов был нормальным. .

Рисунок 4. Кумулятивная функция распределения (CDF) для данных о сбросе.

(A) Значения log 10 для данных сброса на рис. 3 нанесены кумулятивно от наименьшего к наибольшему относительно нормализованного количества точек данных. Каждый шаг вверх представляет точку данных. Таким образом, крайняя левая точка на каждом графике представляет собой наименьшее значение, для которого имеется только одна точка данных, следующий шаг вверх представляет собой вторую наименьшую точку и так далее, пока последняя крайняя правая точка не представляет наивысшее значение и, следовательно, включает в совокупности все точки данных.(B) Кумулятивная функция распределения (CDF) для всех данных о пролитии, обобщенных на рисунке 5A.

https://doi.org/10.1371/journal.ppat.1000496.g004

Рисунок 5. Не существует такой сущности, как постоянно высокий или низкий уровень выделения ВЭБ, и нет корреляции между уровнями выделения и частотой инфицирования mB Lat в крови.

(A) Показывает диапазон выделения вируса у 8 человек в течение месяцев/лет. Обратите внимание, что выпадение варьируется от 3.5 и 5,5 журналов. Красные столбцы = медиана, черный ящик = 25-й и 75-й -й процентили, пунктирная линия = диапазон, N = количество независимых положительных измерений. * — количество звездочек указывает количество моментов времени, когда не было обнаружено выделения вируса. (B) Показаны средние значения для данных, показанных в A., нанесенные на график в зависимости от частоты инфицирования mBLat (FOI) в периферической крови для каждого субъекта.

https://doi.org/10.1371/journal.ppat.1000496.g005

Из рисунка 5А видно, что широкий диапазон вариаций является повсеместной особенностью выделения вируса, при этом у большинства субъектов наблюдается диапазон около 4 логарифмов, самый большой будучи 5.5 бревен (испытуемый № 9) и наименьшие 3,3 лога (испытуемый № 8). Таблица S1 показывает среднее значение, медиану и стандартную ошибку среднего (SEM) для измерений у всех 8 субъектов. -6 порядков, что указывает на то, в какой степени диапазон выделения вируса перекрывается между отдельными людьми и что профили выделения у разных людей статистически не различаются.Однако наиболее показательным был анализ CDF этих данных, показанный на рисунке 4B, который подтвердил первоначальный результат с ограниченным набором данных от субъектов 1–3. Для всех 8 субъектов наблюдалась линейная зависимость между логарифмическим значением выделения и его кумулятивной вероятностью возникновения. Иными словами, вероятность (логарифмического) выделения была одинаковой для всех уровней в диапазоне нескольких логарифмических значений. Это ожидаемый результат, когда простой экспоненциальный процесс, такой как рост или распространение инфекции, выбирается случайным образом с течением времени.На рисунке 6 мы показываем линии, наиболее подходящие для данных всех 8 субъектов (из рисунка 4B), а в таблице 2 мы описываем свойства этих линий, включая наклоны и результаты линейного регрессионного анализа (с поправкой R 2 ). Значение R 2 для всех 8 субъектов было чрезвычайно высоким (≥0,88), что указывает на то, что данные близки к линейной зависимости. Кроме того, очевидно, что наклоны линий очень похожи для всех 8 субъектов, хотя линии были разбросаны по широкому диапазону, охватывающему >2 log (сравните субъектов 2 и 9 на рис. 4B и точки пересечения x для всех 8 субъектов на рис. 6).

Рисунок 6. Линейный регрессионный анализ данных на рисунке 4B.

CDF для 8 испытуемых наносятся индивидуально в виде точек данных, а не в виде шагов с наилучшей прямой линией из линейного регрессионного анализа. Наклоны и скорректированные значения R 2 приведены в таблице 2. Синяя линия = наиболее подходящая прямая линия из линейного регрессионного анализа. Красные кружки = точки данных; зеленые кружки   =   остатки, т. е. разница между каждой точкой данных и значением, заданным линией.

https://doi.org/10.1371/journal.ppat.1000496.g006

Эти результаты позволяют сделать несколько важных выводов. Вопреки тому, что утверждалось ранее [11], не существует четко выраженных вирусов с высоким, средним или низким уровнем выделения вируса. Таким образом, хотя в среднем, например, субъект № 9 имеет низкий уровень, субъект № 3 — средний и субъект № 2 — высокий, многочисленные измерения в течение длительного времени показывают, что эти назначения относительно бессмысленны. Скорее, в любой момент времени человек может быть высоким, низким или средним.Кроме того, основной процесс, лежащий в основе вариации сброса, представляет собой простую экспоненту, которая либо останавливается случайным образом, а затем остается стабильной, либо наблюдается в случайные моменты времени. Эта экспонента инициируется в диапазоне выпадения на уровнях, которые зависят от конкретного субъекта (линии смещены более чем на 2 логарифма на графиках CDF), но чья последующая скорость роста не зависит от субъекта (наклоны на графиках CDF аналогичны). Мы предполагаем, что эти события представляют собой экспоненциальное распространение бляшек инфицированных эпителиальных клеток (см. Обсуждение).

Моделирование экспоненциальной функции показывает, что количество независимых событий очень мало

Прямолинейная зависимость между логарифмом выпадения и кумулятивным числом наблюдений (CDF) подразумевает, что количество этих предполагаемых бляшек должно быть очень небольшим, иначе всегда будет доминировать выпадение самых больших бляшек, и график станет нелинейным. . Это показано на рис. 6 и рис. S2, где мы выполнили моделирование этого процесса для различного количества бляшек (подробности моделирования см. в тексте S1 — «Эмпирическая CDF отслаивания предполагает наличие не более 3 бляшек одновременно).»). В этом моделировании различное количество бляшек засевается случайным образом, им дают расти в геометрической прогрессии, а затем отбирают образцы в 20 случайных моментов времени. Это создает смоделированный CDF осыпания бревен, из которого можно рассчитать скорректированное значение R 2 . По мере увеличения количества бляшек графики становятся более крутыми и все больше отклоняются от линейных. Затем мы использовали моделирование, чтобы спросить: какова вероятность получения нашего фактического набора данных с разным количеством бляшек? Чтобы достичь этого, мы просто повторили моделирование, показанное на рисунке S2, 100 раз для каждого количества налета, провели линейный регрессионный анализ для расчета скорректированного R 2 для каждого цикла, а затем нанесли эти значения в виде CDF для скорректированного R 2 ‘. с (рис. 7).Затем мы можем спросить: какова вероятность получения скорректированных значений R 2 , которые мы наблюдали для наших 8 испытуемых при моделировании, включающем разное количество бляшек. Мы использовали три различных критерия. Во-первых, какова вероятность получения скорректированного значения R 2 7 из 8 раз подряд, которое выше самого низкого значения, которое мы наблюдали у наших 8 испытуемых? Во-вторых, какова вероятность получения 8 значений со средним значением, равным или превышающим среднее значение для наших 8 испытуемых? В-третьих, какова вероятность получения 8 значений, равных или превышающих самое низкое значение, которое мы наблюдали у наших испытуемых. Этот расчет показал значения p <0,05 для ≥2 бляшек, ≥3 бляшек и ≥4 бляшек для трех методов соответственно. Взятые вместе, эти анализы позволяют предположить, что выделение EBV у здоровых носителей является результатом очень небольшого количества, ≤3, этих предполагаемых эпителиальных бляшек.

Рис. 7. Скорректированные значения R 2 для моделирования зубного налета.

Было проведено моделирование, в котором инфекционные бляшки инициировались случайным образом, им давали возможность расти в геометрической прогрессии и случайным образом отбирали образцы 25 раз (см. текст S1 и рисунок S2).Затем эти данные были нанесены на график в виде CDF, и скорректированное значение R 2 было оценено как наилучшая прямая линия, подходящая к данным. Этот процесс повторяли 100 раз для каждого из указанных номеров бляшек, и результирующие значения R 2 наносили на график в виде CDF. Красная линия указывает самое низкое значение (0,88), зеленая линия — 7, th , самое низкое значение (0,94), а синяя линия — медиану R 2 для наших 8 субъектов (см. Таблицу 2).

https://doi.org/10.1371/journal.ppat.1000496.g007

Мы также можем получить оценку среднего количества бляшек совершенно другим и независимым способом, поскольку мы наблюдали, что вирус не выделялся в 8 случаях из 173 проведенных нами измерений. Из простой статистики Пуассона мы можем подсчитать, что если мы не находим признаков инфекционных бляшек 8/173 раза, то в среднем таких бляшек должно быть ∼3, значение, которое очень близко согласуется с прогнозом (≤3) анализа CDF. .

В заключение представляется, что выделение ВЭБ является следствием экспоненциального процесса, который либо прекращается, либо наблюдается случайным образом, и что в любой момент времени происходит ≤3 таких событий.

Уровни выделения вируса не коррелируют с уровнями mB

Lat в крови внутри или между людьми

Как отмечалось выше, уровни mB Lat в крови здоровых носителей ВЭБ стабильны в течение длительных периодов времени ([19] и рис. 3), и теперь мы показали обратное, что выделение вируса чрезвычайно изменчиво в течение аналогичного времени. пролеты. Следовательно, у отдельных людей нет корреляции между выделением вируса и уровнями инфицированных клеток.На рисунке 5B мы нанесли средние значения из таблицы S1 в зависимости от частоты mB Lat в кровотоке для всех исследованных субъектов, и очевидно, что также нет корреляции между уровнями mB Lat в крови и количество вируса, выделяемого в слюну между людьми. (Тот же результат остается верным, если медиана нанесена на график, а не показана).

Одним из возможных объяснений отсутствия корреляции между выделением вируса и уровнями mB Lat в крови является то, что ПЦР не отличает интактные вирионы от неинфекционной вирусной ДНК.Чтобы оценить это, мы оценили чувствительность к ДНКазе вирусной ДНК в слюне (см. Рисунок S3 в качестве примера такого эксперимента). Мы обнаружили, что большая его часть была устойчива; соответствует интактным вирионам независимо от того, тестировали ли мы сырую слюну или супернатант после осветления центрифугированием (таблица 3). Это было намного выше, чем для двух протестированных нами клеточных линий Akata и B95-8 (только 10–20% резистентности), что позволяет предположить, что вирионы, попадающие в слюну, упакованы более эффективно, чем в клеточных линиях. Когда мы отслеживали уровни материала, устойчивого к ДНКазе, в сырой или осветленной слюне, мы снова увидели 4-5 логарифмические колебания в течение длительных периодов времени (рис. 8) и отсутствие корреляции с уровнем mB Lat (рис. S4).

Рис. 8. Изменения выделения вируса в слюну с течением времени постоянно наблюдаются в осветленных препаратах и ​​препаратах, обработанных ДНКазой.

Сплошная линия = Слюну предварительно обрабатывали ДНКазой для удаления некапсулированной вирусной ДНК. Пунктирная линия = Слюну осветляли центрифугированием и затем обрабатывали ДНКазой. Данные показаны для трех разных субъектов (A–C).

https://doi.org/10.1371/journal.ppat.1000496.g008

Другим возможным объяснением того, что нам не удалось найти корреляцию между шедшим вирусом и mB Lat , было то, что ПЦР измеряет все вирионы, независимо от их инфекционности, и это было высказано предположение, что большая часть вирионов в слюне связана с нейтрализующими антителами [21]. Чтобы проверить эту возможность, мы проанализировали количество вирусной ДНК, которая будет специфически связываться (судя по неспособности связываться с линией Т-клеток Jurkat и способности блокироваться нейтрализующим антителом против gp350 72A1 — не показано) с линией В-клеток. . Как показано в таблице 4, в двух отдельных экспериментах, несмотря на повторные абсорбции (до 6 раз), только <5% вирусной ДНК в слюне могло связываться с В-клеточной линией Akata. Однако, когда мы проверили количество активности связывания Akata в слюне в течение длительного периода времени, мы снова обнаружили, что уровни варьировались примерно в 4-5 log и что не было корреляции с уровнями mB Lat в периферической крови ( Рисунок S5).

Обсуждение

В этой статье мы подробно описали кинетику выделения ВЭБ в слюне здоровых носителей вируса. Мы использовали чувствительный и количественный анализ ДНК ПЦР, который может надежно обнаружить одну копию вирусного генома. Используя этот анализ, мы впервые показываем, что EBV-положительные люди постоянно выделяют EBV, так что резервуар слюны полностью заменяется примерно за 2 минуты. Это согласуется с исследованиями, показывающими, что нормальный человек глотает в среднем каждые 2 минуты (www.uiowa.edu/~c003236/indexS1L1a.html). Таким образом, рот является не резервуаром вируса, а каналом, через который проходит непрерывный поток вируса в слюне (рис. 9). В течение от нескольких месяцев до года уровень линьки у данной особи колеблется в пределах 3,5—5,5 log. Таким образом, вопреки тому, что в настоящее время считается [11], нет четкого различия между низким, средним или высоким уровнем выделения EBV. На самом деле линька меняется со временем так сильно, что большая часть различий между высоким и низким уровнем происходит внутри человека, а не между людьми.Если когорту людей измерять только в течение нескольких дней, некоторые из них будут низкими, некоторые — промежуточными, а некоторые — высокими, но классификация со временем изменится. Например, на рисунке 3 субъект 1 может быть классифицирован как высокий (от 10 6 до 10 8 на мл) на 300-й день или низкий (от 10 2 до 10 4 на мл) на 325-й день и промежуточный (10 от 4 до 10 6 на мл) на 500-й день, тогда как у субъекта 2 будет высокий уровень на 50-й день, низкий на 300-й день и средний на 325-й день. Этот момент подтверждается анализом CDF, который демонстрирует, что индивидуум имеет одинаковую вероятность выделения на любом уровне (логарифмические значения) от высокого до низкого.

Рисунок 9. Схематическое представление предлагаемой модели из этого исследования.

ВЭБ-инфицированные mB Lat , которые возвращаются в кольцо Вальдейера (миндалины и аденоиды), подвергаются дифференцировке плазматических клеток и инициируют репликацию вируса. У типичного здорового носителя количество таких клеток в любой момент времени составляет ≤50 и, следовательно, недостаточно, чтобы объяснить абсолютный уровень или изменение выделения, которое мы наблюдали с течением времени.Вирус, высвобождаемый из плазматических клеток, заражает эпителий кольца Вальдейера, где он образует бляшку, содержащую от 1 до 10 5 инфицированных эпителиальных клеток, тем самым увеличивая количество выделяемого вируса. Изменчивость конечного размера и стабильности этих бляшек объясняет высокие уровни и изменчивость выделения вируса и, вероятно, является функцией исходного зародыша инфицированных эпителиальных клеток, структуры эпителия и иммунного ответа. Вирус из бляшки непрерывно выделяется в слюну в течение нескольких дней, обеспечивая непрерывный поток вирионов в слюне, который заменяется ≤каждые 1–2 минуты.

https://doi.org/10.1371/journal.ppat.1000496.g009

Предыдущие исследования с использованием биологического анализа [22], [23] или ПЦР [24], [25] для обнаружения вируса показали, что 10 до 70 процентов EBV-позитивных людей выделяют поддающийся обнаружению вирус. В этом исследовании мы провели 173 измерения с течением времени у 8 различных EBV-положительных людей и последовательно обнаружили, что все 8 были положительными, и только 8/173 отрицательных показаний. В отличие от предыдущих исследований, мы можем быть уверены, что в образцах слюны в это время не было вирусной ДНК, потому что наш метод ПЦР может воспроизводимо обнаруживать одну копию вирусного генома.Таким образом, мы не обнаружили EBV-положительного человека, который постоянно не выделял вирус. Гораздо более высокая степень успеха, которую мы получили, без сомнения, отражает то, что используемые ранее тесты были значительно менее чувствительными. Подобные расхождения мы наблюдали ранее при оценке распространенности ВЭБ в В-клетках периферической крови. В более ранних отчетах предлагался широкий диапазон обнаружения на основе ПЦР или биологического анализа. Однако применение нашего ПЦР-анализа ДНК показало, что 100% серопозитивных к ВЭБ лиц имели инфицированные клетки в крови в 100% случаев, и действительно, уровни были очень стабильными и специфичными для каждого человека [19].Эти исследования вирусной нагрузки в В-клетках слюны и крови демонстрируют, что проведение точных, чувствительных и систематических количественных исследований может обеспечить последовательное и новое понимание биологии ВЭБ.

Удивительно, но основные выводы наших исследований выделения вируса указывают на потенциальную важность эпителиальных клеток в репликации и выделении ВЭБ. Это связано с тем, что ни абсолютные уровни, ни изменение во времени выделения вируса, которое мы наблюдали, не могут быть объяснены только В-клетками, реплицирующими вирус в кольце Вальдейера [26]. В блоке 1 мы попытались оценить количество вируса, выделяемого В-клетками из кольца Вальдейера. Этот расчет основан на количестве инфицированных В-клеток в кольце Вальдейера, полученных в результате измерений на большой когорте здоровых людей [27], наших ранее опубликованных оценках доли инфицированных В-клеток, которые завершают репликацию вируса в любое время в кольце Вальдейера [26]. ] и размер вирусной вспышки, согласно оценке в текущем исследовании. Из этого расчета мы видим, что существует ~3 логарифмическое расхождение между абсолютным максимальным количеством вируса, которое может быть произведено В-клетками в кольце Вальдейера, и фактическим уровнем, который мы измерили в слюне.Поэтому крайне маловероятно, что только В-клетки могут объяснить уровни выделения вируса, которые мы наблюдали. Помимо абсолютных уровней выделения вируса, диапазон (от 3,5 до 5,5 log), который мы наблюдали с течением времени у любого данного здорового носителя, также слишком велик, чтобы его можно было объяснить только B-клетками, реплицирующими вирус, поскольку ранее мы оценили, что не более ∼100 В-клетки завершают репликацию EBV в кольце Вальдейера в любой момент времени ([26] и вставка 1). Это могло дать в лучшем случае лишь ~2 логарифма вариации, что опять-таки указывает на наличие второго сайта репликации EBV.Что/где может быть этот тип клетки? В последнее время вновь поднимается вопрос о возможной роли инфекции эпителиальных клеток в биологии ВЭБ. Инфицированные эпителиальные клетки были обнаружены в культурах эпителия первичных миндалин [28], было показано, что ВЭБ имеет кластер гликопротеинов вириона (gH и gL), которые опосредуют инфекцию эпителиальных клеток [29], [30], а ВЭБ обнаружен в эпителиальные клетки карциномы носоглотки [31] (где вирус латентный) и волосатой лейкоплакии полости рта [32] (где вирус литический).Кроме того, вирус в слюне имеет высокое содержание гликопротеина gp42. Этот гликопротеин связывается с MHC класса II и обычно истощается в вирионах, возникающих из В-клеток, что позволяет предположить, что вирус в слюне происходит из не-В-клеток [33]. Это согласуется с моделью, согласно которой вирус, высвобождаемый из В-клеток, заражает эпителий миндалин, где он реплицируется и амплифицируется до попадания в слюну. Чтобы исследовать эту возможность, мы оценили потенциальное количество вируса, продуцируемого эпителиальными клетками в кольце Вальдейера (вставка 2).Этот расчет был основан на опубликованных значениях площади поверхности эпителиальных клеток в кольце Вальдейера [34], нашей оценке плотности монослоя эпителиальных клеток [28], наших опубликованных оценках частоты эпителиальных клеток, реплицирующих ВЭБ в культурах первичных эпителия миндалин [28] и размер вирусного выброса эпителиальных клеток, оцененный в этом исследовании (таблица 1). Из этих расчетов становится очевидным, что эпителиальная клеточная инфекция может объяснять уровни выделения, которые мы наблюдали.

Вставка 2. Инфекция эпителиальных клеток может объяснить наблюдаемый уровень выделения вируса

Площадь поверхности небной миндалины, включая крипты, составляет 340 см 2 [34].

Небная миндалина составляет примерно одну двенадцатую часть кольца Вальдейера [34].

Таким образом, общая площадь поверхности эпителиальных клеток кольца Вальдейера составляет ∼4080 см 2 .

Из монослойных культур эпителия первичной миндалины [28] мы оценили, что 1 см 2 сливного эпителия содержит ∼2×10 5 эпителиальных клеток.

Таким образом, 4080 см 2 содержат ∼10 9 эпителиальных клеток.

Поскольку в настоящих миндалинах эпителий многослойный, общее количество эпителиальных клеток в кольце Вальдейера приблизительно равно ∼10 10 .

В первичных культурах эпителия миндалин мы видели, что около 0,01% клеток были литически инфицированы ВЭБ [28].

Таким образом, ∼10 6 эпителиальных клеток могут быть литическими во всем кольце Вальдейера у этих субъектов.

Учитывая средний размер вспышки для эпителиальных клеток 6,2×10 5 и предполагая время вспышки 24 часа:

Типичная продукция вириона из эпителия может составлять ≈6,2×10 11 геномов в день. Е.

Сравнивая линию E с линией D в блоке 1, становится очевидным, что эпителий может объяснить уровни выделения вируса, которые мы измерили.

Анализ CDF дает значительное представление о том, как эпителиальная инфекция может объяснить наблюдаемое нами выделение.Мы видели, что CDF для журнала линьки близка к линейной для каждого субъекта. Линейный CDF возникает, когда процесс растет экспоненциально по времени в течение фиксированного периода времени, и либо выборка производится случайным образом, либо останавливается и поддерживается постоянным в случайные моменты времени. Мы можем не принимать во внимание первую гипотезу (отбор проб), потому что выделение вируса стабильно в течение коротких периодов времени и, следовательно, не является просто экспоненциально растущей функцией. Скорее это экспоненциально растущая функция, которая останавливается случайным образом, остается стабильной в течение нескольких часов/дней, а затем рассеивается.Поскольку выделение вируса не может быть объяснено В-клетками, мы предполагаем, что эта функция заключается в росте инфицированных эпителиальных бляшек, засеянных вирусом, высвобождаемым из В-клеток, и что эти бляшки останавливаются в своем распространении случайным образом с течением времени. Это было бы EBV-эквивалентом реактивации HSV в ганглиях, попадающих на кожу и инфицирующих окружающие фибробласты, что приводит к образованию герпетических поражений. Предполагая, что размер пакета 6,2 × 10 5 для эпителиальных клеток (таблица 1), диапазон выделения вируса / мл смыва слюны, который мы наблюдали на рисунке 5A и в таблице S1 (5–2 × 10 7 геномов, дает [5– 2.10 7 ]×5 мл/полоскание×30 полосканий/час×24 часа = 1,8×10 4 до 7,2×10 10 геномов в день) будет происходить от <1 до 10 5 эпителиальных клеток, выделяющих вирус в день. Это означает, что размер бляшек варьируется от 1 клетки (которая может быть просто исходной В-клеткой) до 10 5 эпителиальных клеток.

Как показано в разделе результатов, линейный характер CDF для наших субъектов ограничивает количество этих бляшек до ≤3 в любое время.Однако если это так, то почему мы не видим периодов простого экспоненциального роста в наших измерениях? Когда мы проводим измерения во все более короткие периоды времени, мы в конечном итоге сталкиваемся со стабильностью, а не с экспоненциальным ростом. Это наблюдение накладывает на модель два ограничения. Первое состоит в том, что количество бляшек обычно больше 1, так что бляшка в своем стабильном состоянии обычно маскирует часть или всю фазу роста новой(ых) бляшки. максимальное время роста бляшки должно быть меньше периода времени, в течение которого они остаются стабильными, что, как мы видели, составляет до 7 дней (подробное обсуждение этого вопроса см. в тексте S2 — «Почему мы не наблюдали фазу роста.». Таким образом, максимальное время жизни бляшки составляет 14 дней: не более 7 дней роста, за которыми следует <7 дней стабильности.

Двумя очевидными кандидатами на экспоненциальную функцию, предсказанную CDF, являются рост инфицированных эпителиальных клеток или инфекционное распространение вируса. Если бы причиной был рост, предполагается модель, в которой новая инфекция продуцирует латентно инфицированные эпителиальные клетки, которые продолжают пролиферировать и одновременно генерировать клетки, продуцирующие вирус, до тех пор, пока какое-то событие, предположительно, иммунный ответ не остановит рост. Латентная инфекция эпителия миндалин была задокументирована [28], и этот тип сценария был предложен много лет назад на основе аналогии с системой ВПЧ [35], где дифференцировка латентно инфицированных клеток запускает репликацию вируса. В поддержку этой идеи была зарегистрирована зависимая от дифференцировки репликация EBV как в эпителиальных [36], так и в В-клетках [26]. Однако мы не одобряем эту модель, потому что для достижения максимального размера бляшек в 10 5 клеток потребуется от двух до трех недель (при условии, что клетки делятся каждые 24 часа).Как мы видели, данные ограничивают фазу роста продолжительностью не более недели, и, кроме того, кажется весьма маловероятным, что такая структура может уклоняться от иммунного ответа в течение такого длительного периода времени.

Альтернативная гипотеза состоит в том, что бляшки просто растут за счет инфекционного распространения. Преимущество этой идеи связано с инфекцией in vitro поляризованного эпителия миндалин, которая, как было показано, легко образует бляшки клеток, реплицирующих вирус [37], [38], и in vivo из патологической формы волосатой лейкоплакии полости рта, которая возникает при иммуносупрессии и, по существу, состоит из очень больших бляшек эпителиальных клеток, реплицирующих ВЭБ [32]. В этой модели одна эпителиальная клетка, высвобождающая вирионы, достаточная для заражения в среднем ∼10 или более новых клеток после каждого раунда, достигает максимального размера бляшки менее чем за неделю. Однако необходимо учитывать геометрические ограничения. Поверхность миндалин имеет сложную геометрию, но ее можно рассматривать как большую двумерную поверхность. Если инфекция может происходить только между соседними эпителиальными клетками, то инфекция ограничивается растущим двумерным диском. Радиус этого диска зависит от количества циклов заражения от соседа к соседу, т.е.е. продолжительность распространения инфекции. Так как площадь диска растет пропорционально квадрату его радиуса, то количество инфицированных клеток должно расти только пропорционально квадрату времени. Это означает, что строгое контактное заражение от соседа к соседу не будет поддерживать экспоненциальный рост. Для поддержания экспоненциальной экспансии вирус должен распространяться на мишени помимо тех, которые находятся в проксимальном контакте, но этот вирус обычно удаляется нейтрализующими антителами. Тем не менее, Tugizov et al. показали in vitro развитие эпителиальных бляшек через межклеточное распространение инфекционного вируса с помощью механизма, включающего тесно связанные боковые мембраны, который зависит от времени [37] и устойчив к нейтрализующим антителам [38].Кроме того, они показали in vitro, что ВЭБ может быстро распространяться в эпителии за счет трансцеллюлярного трансцитоза, потенциально позволяя вирусу быстро распространяться за пределы соседних клеток, что приводит к экспоненциальному расширению бляшки (личное сообщение Шарофа Тугизова).

Еще один результат анализа CDF заключается в том, что наклоны сходны, но диапазон потери различается у разных субъектов. Это означает, что экспоненциальное расширение бляшек инициируется с разным размером для каждого субъекта, но однажды начавшись, оно остается постоянным между субъектами.Это прекрасно согласуется с идеей о том, что очень небольшое количество В-клеток высвобождает вирус, который инициирует образование бляшек, а количество первоначально инфицированных эпителиальных клеток зависит от конкретного субъекта. Этот вариант может быть введен просто на основании, например, эффективности нейтрализующего антитела, вырабатываемого каждым субъектом. Как только достигается инфицирование эпителиальных клеток, рост образующихся бляшек становится независимым, что снова согласуется с результатами Tugizov et al., согласно которым на эпителиальную инфекцию не влияют нейтрализующие антитела.Если мы предположим, что наименьшее значение для каждого субъекта приблизительно соответствует начальному размеру бляшек, то мы можем оценить (при условии, что скорость взрыва эпителиальных клеток составляет 6,2×10 5 на клетку в день), что начальная инфекция колеблется от ∼0 до 5 эпителиальные клетки. Выше мы подсчитали, что бляшки растут в течение максимум одной недели, а затем стабильно сохраняются в течение максимально еще одной недели и что в среднем имеется около 3 бляшек. Если каждая бляшка засеяна одним вирусом, высвобождающим В-клетки, то в среднем только около 3 таких В-клеток образуются в кольце Вальдейера каждые 1-2 недели или 1 клетка каждые 2-5 дней. Хотя это кажется чрезвычайно низким, оно согласуется с нашими предыдущими выводами ([26] и вставка 1). Как описано во вставке 1, скрининг миндалин на предмет экспрессии гена непосредственной ранней литической реакции BZLF1 показал, что в среднем около 1 В-клетки каждые два дня завершает литический цикл (см. анализ CDF.

Еще один вывод из анализа CDF заключается в том, что экспоненциальное расширение останавливается в случайные промежутки времени для создания простых линейных ступенчатых лестниц, наблюдаемых на рисунке 4.Два объяснения кажутся возможными/вероятными. Во-первых, гетерогенная структура эпителия создает барьер произвольного размера для расширения. Этот барьер может иметь форму клеток, которые не могут быть инфицированы ВЭБ или иным образом препятствуют распространению вируса. Однако для этого потребовалось бы, чтобы эпителиальные клетки продолжали выделять относительно стабильное количество вируса в течение нескольких часов/дней. Непрерывная продукция вируса в течение нескольких дней без гибели не была задокументирована для EBV in vitro, однако у нас практически нет информации о репликации EBV in vivo, и такое поведение было описано для другого герпесвируса CMV [39], [40].

Другим процессом, который может случайным образом прерывать экспоненциальную экспансию с течением времени, может быть реакция цитотоксических Т-клеток. Было показано, что миндалины содержат большое количество EBV-специфических ЦТЛ [14]. Часто >1% Т-клеток CD8 в миндалинах специфичны для литических антигенов ВЭБ. Это исследование показало, что около 10% этих ЦТЛ были активированы в любой момент времени, что указывает на продолжающийся иммунный ответ. Тогда случайное логарифмическое распределение бляшек по размерам могло бы просто отражать случайную вероятность того, что CTL столкнется с экспоненциально растущими бляшками с течением времени и уничтожит их.Это, по крайней мере частично, отвечает на вопрос, почему вирус может безнаказанно непрерывно размножаться в кольце Вальдейера, несмотря на постоянный продолжающийся ответ ЦТЛ. Еще одним способствующим фактором может быть то, что вирус, как известно, обладает механизмами уклонения от иммунитета, которые могут задерживать или помогать уклоняться от ответа ЦТЛ. К ним относятся гомолог IL-10, который подавляет ответ ЦТЛ, и генные продукты, препятствующие презентации антигена (обзор в [41]). Предположительно, если небольшое количество бляшек регулярно засеивается из В-клеток, эти механизмы уклонения должны быть достаточно эффективными, чтобы позволить бляшкам расти и выживать в течение нескольких дней.Действительно, наблюдаемое нами относительно стабильное краткосрочное выделение может просто отражать продолжительный период времени, когда ответ ЦТЛ способен только сдерживать распространение бляшки, и для ее окончательного устранения требуется несколько дней.

Если мы прогнозируем, что ВЭБ выделяется через эпителиальные бляшки размером до 10 5 клеток, почему они не наблюдались при иммуногистохимическом исследовании миндалин? Ответ почти наверняка зависит от случая, поскольку наш анализ предсказывает, что бляшки в диапазоне от 10 4 до 10 5 клеток присутствуют только в ~10% случаев в случайной выборке субъектов. Кроме того, эти клетки, вероятно, содержатся в одной бляшке во всем кольце Вальдейера. Поэтому наши результаты предсказывают, что потребуется исчерпывающий и всесторонний анализ нескольких миндалин, чтобы иметь шанс увидеть инфицированную бляшку эпителиальных клеток.

Таким образом, динамика выделения ВЭБ, по-видимому, благоприятствует модели (рис. 9), в которой отдельные В-клетки спорадически инициируют репликацию ВЭБ в кольце Вальдейера. Образовавшийся вирус вызывает местную инфекцию эпителиальных клеток, которая экспоненциально растет в течение не более 7 дней до инфицированной бляшки.Образование бляшек происходит с такой скоростью, что в любой момент времени имеется от 1 до 3 бляшек литической инфекции эпителиальных клеток. Размер этих бляшек зависит от начального количества инфицированных эпителиальных клеток и способности инфекции распространяться и расти. Размер в конечном итоге ограничен случайным образом либо структурными ограничениями эпителия, либо эффективностью иммунного ответа. Как только бляшка достигает своего зрелого размера, она производит в течение короткого времени (до 7 дней) постоянную скорость клеток, которые инициируют литическую репликацию, что, вероятно, представляет собой баланс между инфекционным распространением и иммунным сдерживанием.Это продолжается в течение нескольких дней, пока бляшка не перестанет образовываться, предположительно из-за разрушения клеточным иммунным ответом.

Наши результаты также связаны с выводами, сделанными ранее другими группами. Давним утверждением в области ВЭБ является то, что уровень инфицированных клеток в крови коррелирует с уровнем выделения вируса в слюне [11]. Нам не удалось подтвердить это открытие как между людьми, так и внутри них. Кроме того, это несоответствие нельзя объяснить тем фактом, что мы использовали ПЦР для обнаружения вируса, тогда как в предыдущем исследовании использовался биологический анализ.Мы не обнаружили никакой корреляции независимо от того, измеряли ли мы общий сброшенный геном, геном, устойчивый к ДНКазе (вирион), или связывание вируса. В ходе этих исследований мы наблюдали, что, в отличие от вируса, продуцируемого клеточными линиями, большая часть вируса слюны инкапсулируется (10% против 60% соответственно), но большая его часть не связывается с клетками (<5%), в соответствии с предыдущими исследованиями. наблюдений, что большая часть вируса может быть покрыта нейтрализующими антителами [21].

В заключение, подробные исследования выделения вируса показывают, что здоровые носители ВЭБ постоянно выделяют большое количество вируса со слюной.Кроме того, динамика выделения предполагает решающую роль эпителиальных клеток в увеличении количества выделяемого вируса. Однако у здоровых носителей, хотя большая часть выделяемого вируса не повреждена, очень немногие из них заразны.

Материалы и методы

Заявление об этике

Это исследование было проведено в соответствии с принципами, изложенными в Хельсинкской декларации. Исследование было одобрено Институциональным наблюдательным советом Медицинской школы Тафтса и Медицинского центра Тафтса (исследование IRB № 731). Все испытуемые дали письменное информированное согласие на сбор образцов и последующий анализ.

Клетки и клеточные линии

Образцы цельной крови были получены от добровольцев. РВМС выделяли центрифугированием Ficoll Hypaque, а В-клетки очищали негативной селекцией на колонке StemSep в соответствии с инструкциями производителя. Эффективность очистки проверяли окрашиванием на CD20 и FACS-анализом. В-клетки всегда были чистыми на 90–96%. В-клетки памяти выделяли из очищенных В-клеток с использованием сортировщика MoFlo FACS на основе окрашивания анти-CD27-FITC (маркер В-клеток памяти) и анти-CD20-PE (маркер пан-В-клеток).

Линия EB4-положительных лимфобластоидов IB4 (подаренная доктором Эллиотом Киффом) использовалась в качестве положительного контроля, а линия Т-клеток мыши CB59 (подаренная доктором Мигелем Стадекером) использовалась в качестве отрицательного контроля для ПЦР ДНК EBV. В качестве клеток-мишеней для анализа связывания использовали EBV-отрицательную линию лимфомы Беркитта Akata и клеточную линию карциномы желудка AGS (подарки доктора Линдси Хатт-Флетчер). EBV-положительные В-клетки мартышки B95-8 (подарок доктора Эллиота Киффа), Akata 2A8.1 (подарок доктора Джеффа Сэмпла), карцинома желудка AGSBX1 (подарок доктора Линдси Хатт-Флетчер) и карцинома носоглотки Hone1Akata (подарок доктора Рона Глейзера) использовали для измерения размера вирусной вспышки.

ПЦР в реальном времени

генома EBV были обнаружены с помощью ПЦР-анализа ДНК человека Taq в реальном времени для области W-повтора, как описано ранее [4]. Этот анализ позволяет обнаружить одну копию генома ВЭБ на фоне 10 6 ВЭБ-отрицательных клеток и один вирион в 0,1 мл слюны (не показано). ПЦР проводили в объеме 25 мкл на ABI Prism 5700 (Perkin Elmer) или MyIQ System (BioRad). Термическое циклирование начинали со стадии денатурации при 95°С в течение 3 мин и продолжали 50 циклами амплификации при 95°С в течение 15 секунд и при 60°С в течение 1 минуты.Для каждой реакции 5 мкл ДНК-матрицы добавляли к мастер-миксу, содержащему 12,5 мкл Universal TaqMan Master Mix (Applied Biosystems или BioRad) и по 2,5 мкл прямого праймера, обратного праймера и флурогенного зонда. Используемые праймеры представляли собой AGTGGGCTTGTTTGTGACTTCA (прямой) и GGACTCCTGGCGCTCTGAT (обратный), а флурогенный зонд представлял собой 6-FAM-TTACGTAAGCCAGACAGCAGCCAATTGTC-TAMRA.

Для контроля изменений в образцах с течением времени уровни вирусной ДНК в образцах слюны были нормализованы к уровням эндогенной клеточной ДНК на основе обнаружения гена bcl-2.Bcl-2 Sybr Green ПЦР в реальном времени проводили в объеме 25 мкл. Для каждой реакции 5 мкл ДНК-матрицы из анализа выделения добавляли к мастер-миксу, содержащему 12,5 мкл Sybr Green Master Mix (BioRad) и по 2,5 мкл прямого, обратного праймеров и воды. Используемые праймеры: CTTTAGAGAGTTGCTTTACGTG (прямой) и TCCATATTCATCACTTTGACAA (обратный). Термическое циклирование начинали со стадии денатурации при 95°С в течение 3 минут и продолжали 45 циклами амплификации при 95°С в течение 15 секунд, 55°С в течение 15 секунд, 72°С в течение 30 секунд и 83°С в течение 10 секунд. секунды.Затем следовал анализ кривой плавления при 95°С в течение 1 минуты, 55°С в течение 1 минуты и 80 циклов при 55°С в течение 30 секунд.

Для оценки эффективности обработки ДНКазой образцы были проанализированы на наличие клеточной ДНК с помощью ПЦР в реальном времени Sybr Green для гена β-актина. ПЦР проводили в объеме 25 мкл. Для каждой реакции 5 мкл матрицы ДНК из образцов слюны добавляли к мастер-миксу, содержащему 12,5 мкл Sybr Green Master Mix (BioRad) и по 2,5 мкл прямого, обратного праймеров и воды.Используемые праймеры: GCGGGAAATCGTGCGTGACATT и GATGGAGTTGAAGGTAGTTTCGTG. Термоциклирование начинали со стадии денатурации при 95°С в течение 3 минут и продолжали 40 циклами амплификации при 95°С в течение 15 секунд, 60°С в течение 20 секунд и 72°С в течение 25 секунд. Затем следовал анализ кривой плавления при 95°С в течение 1 минуты и 80 циклов при 58°С в течение 20 секунд.

Частота инфицирования В-клеток

Частота латентно инфицированных клеток в очищенных целых популяциях В-клеток или В-клеток памяти была измерена путем анализа предельного разведения клеточной популяции с последующим обнаружением инфицированных ВЭБ клеток с помощью EBV-специфического ПЦР в реальном времени Taq ДНК человека для последовательности повторов W, как описано выше и в [4]. Эта ПЦР может воспроизводимо обнаружить одну копию вирусного генома.

Выделение вируса

образца слюны были получены от добровольцев. Если не указано иное, образцы слюны собирали путем полоскания рта и полоскания горла 5 мл жидкости. Мы сравнили эффективность оздоровления изотоническим раствором, PBS, RPMI 1640 и простой родниковой питьевой водой. Мы обнаружили, что выделение вирусной ДНК было одинаковым независимо от используемой жидкости. После этого промывки всегда выполняли водой, а соленость и pH регулировали немедленным добавлением 10× PBS.Для некоторых экспериментов слюну очищали центрифугированием при 1500 об/мин в течение 5 минут при 4°С в настольной микроцентрифуге Allegra 6 (Beckman Coulter) и/или обрабатывали ДНКазой (см. ниже). Образцы хранились при температуре -80°C до тех пор, пока не были собраны все временные точки, а затем проанализированы одновременно. В контрольных экспериментах мы не обнаружили заметных изменений в восстановлении вирусной ДНК после таких сроков хранения.

100 мкл образца слюны расщепляли в течение ночи протеиназой К (ПК) (Invitrogen, 0.конечная концентрация 5 мг/мл) при 55°C в 96-луночном планшете (8–10 повторных лунок на субъекта в момент времени). 5 мкл переваренного образца использовали в качестве матрицы для ПЦР ДНК EBV, как описано, после деактивации РК путем нагревания до 95°C в течение 10 минут. Затем количество вирусной ДНК в каждом повторе оценивали по стандартной кривой, полученной серийным разведением (в повторах) аликвоты из супернатанта определенной культуры В958. Количество вирусной ДНК в этом супернатанте предварительно определяли с помощью анализа предельных разведений, а супернатант делили на аликвоты и хранили в замороженном виде. Затем среднее значение из 8–10 повторов использовали для расчета абсолютного числа вирионов в 5 мл образца слюны.

Обработка ДНКазой

Смесь

ДНКазы была предварительно приготовлена ​​и содержала ДНКазу (Invitrogen), 10× буфер для ДНКазы и воду. 10 мкл смеси ДНКазы добавляли на лунку 100 мкл образца слюны до конечной концентрации 1 ед/мкл, если не указано иное. Обработку ДНКазой проводили при комнатной температуре в течение 30 минут. ДНКазу дезактивировали добавлением ЭДТА (2 мМ) с последующей инкубацией при 70–80°С в течение 30 мин. В этих условиях вирионная ДНК, определенная как устойчивые к ДНКазе вирусные последовательности, была стабильной в течение как минимум 1 часа, тогда как практически вся свободная клеточная ДНК (>99% β-актина) расщеплялась в течение 15 минут (см. Рисунок S3).

Анализ связывания

В качестве клеток-мишеней использовали EBV-отрицательную клеточную линию Akata и клеточную линию карциномы желудка AGS в концентрации 10 ± клеток на мл. Клетки AGS помещали в суспензию путем кратковременной обработки трипсином. В 96-луночном планшете устанавливали восемь повторов каждого условия связывания. Образцы слюны с предварительным осветлением центрифугированием или без него и с обработкой ДНКазой или без нее добавляли в лунки клеток-мишеней. Реакцию связывания затем проводили при 37°С в течение 30 минут. Затем клетки осаждали центрифугированием при 1500 об/мин при 4°С в течение 10 минут. Осадки клеток промывали 3 раза 100 мкл PBSA (0,5% BSA в PBS) на лунку и затем расщепляли ФК при 55°C в течение ночи. В качестве стандарта для анализа связывания использовали серийное разведение супернатанта B958 (клеточная линия, продуцирующая EBV) с известным количеством вирионов. Слюну субъекта EBV (-) и PBSA, добавленный к клеткам-мишеням, использовали в качестве отрицательного контроля.

Измерение размера вирусной вспышки

Для индукции литической репликации В-клеточную линию В95-8 стимулировали РМА в концентрации 20 нг/мл, Akata 2A8.1 В-клеточную линию стимулировали комбинацией ФМА (20 нг/мл) и иономицина (1 или 10 мкг/мл) [42], эпителиальную линию AGSBX1 стимулировали комбинацией ФМА (30 нг/мл) и масляной кислоты. кислота (2,5 мМ) [29] и эпителиальная линия Hone1Akata с ФМА (40 нг/мл) и масляной кислотой (3 мМ) [43]. Перед стимуляцией клеточные линии синхронизировали путем пересева в среду в течение ночи при 5×10 5 /мл для В-клеток и 3–5×106/мл для эпителиальных клеток. В-клетки собирали через 48 часов для внутриклеточного окрашивания VCA (вирусный капсидный антиген) и анализа FACS, а культуральные супернатанты собирали для EBV-специфичной ДНК-ПЦР через 72 часа.Эпителиальные клетки собирали для окрашивания VCA через 96 часов и для ПЦР через 96–174 часа.

Для внутриклеточного окрашивания VCA собранные клетки однократно промывали PBS и осаждали центрифугированием при 1300 об/мин в течение 7 минут при 4°C. Осадок клеток ресуспендировали в количестве 10 ± клеток на 200 мкл фиксирующего буфера (4% формальдегида в PBS) и инкубировали при комнатной температуре в течение 10 минут. После фиксации клеток добавляли 1 мл PBS на 10 6 клеток и осадок клеток диссоциировали встряхиванием, а затем снова осаждали центрифугированием.Стадию промывания PBS повторяли снова перед ресуспендированием в 200 мкл пермеабилизирующего буфера (8% FBS, 0,02% NaN3, 0,04% сапонин, 2% козьей сыворотки в PBS) на 10 6 клеток с последующей инкубацией при 4°C в течение 30 минут. Все окрашивание проводили в пробирках FACS при 10 ± клеток на пробирку. Клетки окрашивали либо 200 мкл изотипического контроля мышиного IgG2a (Caltag), либо 200 мкл мышиного анти-VCA-IgG2a антитела (Capricorn) на 10 6 клеток, разбавленных 1:1000 в пермеабилизирующем буфере, и инкубировали при 37°C в течение 30 минут.Затем клетки дважды промывали 1 мл промывочного буфера (8% FBS, 0,02% NaN3, 0,04% сапонина в PBS) и осаждали. Затем клетки ресуспендировали в 100 мкл разведения 1∶10000 Alexa Fluor 488 или 647, конъюгированного козьего антимышиного IgG (H+L) (Molecular Probes), разведенного в пермеабилизирующем буфере, и инкубировали при 37°C в течение 30 мин в темно. Затем клетки дважды промывали встряхиванием в 2 мл промывочного буфера и осаждали центрифугированием. Наконец, клетки ресуспендировали в 300 мкл буфера FACS (8% FBS, 0.02% NaN3 в PBS) для анализа на проточном цитометре FACS Caliber или 60 мкл буфера FACS для анализа на Amnis ImageStream с аналитическим программным обеспечением IDEA для подтверждения подлинности окрашивания.

Содержание ДНК EBV в культуральных супернатантах измеряли с помощью ДНК-ПЦР с обработкой ДНКазой или без нее, как описано для образцов слюны.

Моделирование и статистический анализ

Моделирование и статистический анализ (CDF и скорректированный R 2 линейный регрессионный анализ) были выполнены с помощью программного обеспечения MatLab.Для изучения линейности ожидаемой CDF для ограниченного числа точек данных с различным количеством гипотетических бляшек было проведено моделирование. В этом моделировании бляшкам было произвольно назначено подвергаться экспоненциальному росту. Рост бляшек инициировали случайным образом, и сумму зараженных клеток оценивали в 20 случайных моментов времени, выбранных с использованием алгоритма Монте-Карло. Для получения дополнительной информации см. Рисунок S2 и соответствующий текст.

Дополнительная информация

Рисунок S2.

Смоделированные CDF для инфекций с участием различного количества гипотетических бляшек, отобранных случайным образом 20 раз. CDF для двух симуляций показаны для каждого количества бляшек вместе с их наилучшей линейной аппроксимацией. Количество смоделированных бляшек (n) и результирующее значение для скорректированного R 2 приведены над каждым графиком. Подробное обсуждение см. в следующем тексте.

10.1371/journal.ppat.1000496.s002

(0,05 МБ PDF)

Рисунок S4.

Нет корреляции между частотой инфицирования mBlat (FOI) в крови и уровнями выделения вируса в четырех различных типах препаратов образцов слюны от 5 субъектов.

10.1371/journal.ppat.1000496.s004

(0,02 МБ PDF)

Рисунок S5.

Нет корреляции между частотой инфицирования mBlatin в крови (FOI) и уровнями вируса, который связывается с B-клетками (Akata) или эпителиальными клетками (AGS) в двух разных типах препаратов образцов слюны от 5 субъектов.

10.1371/journal.ppat.1000496.s005

(0,03 МБ PDF)

Благодарности

Мы благодарим доктора Шарофа Тугизова за предварительное чтение рукописи, полезные обсуждения и предложения, а также за разрешение цитировать неопубликованные работы. Мы также признательны Аллену Пармели и Стиву Квоку за FACS.

Вклад авторов

Задумал и спроектировал эксперименты: DATL. Проведены эксперименты: VH CCS. Проанализированы данные: MS DATL. Написал статью: MS DATL.

Каталожные номера

  1. 1. Кифф Э., Рикинсон А.Б. (2007)Вирус Эпштейна-Барра и его репликация. В: Knipe DM, Howley PM, редакторы. Вирусология Филдса. 5-е изд. Филадельфия: Липпинкотт Уильямс и Уилкинс.
  2. 2. Thorley-Lawson D (2005)Сохранение EBV и латентная инфекция in vivo.В: ЕС Р, редактор. Вирус Эпштейна-Барра. 1-е изд. Норфолк, Англия: Caister Academic Press.
  3. 3. Торли-Лоусон Д.А. (2001) Вирус Эпштейна-Барр: использование иммунной системы. Nat Rev Immunol 1: 75–82.
  4. 4. Hadinoto V, Shapiro M, Greenough TC, Sullivan JL, Luzuriaga K, et al. (2008) О динамике острой ВЭБ-инфекции и патогенезе инфекционного мононуклеоза. Кровь 111: 1420–1427.
  5. 5. Рикинсон А. Б., Кифф Э. (2007)Вирус Эпштейна-Барра.В: Knipe DM, Howley PM, редакторы. Вирусология Филдса. 5-е изд. Филадельфия: Липпинкотт Уильямс и Уилкинс.
  6. 6. Торли-Лоусон Д.А., Гросс А. (2004)Сохранение вируса Эпштейна-Барр и происхождение ассоциированных лимфом. N Engl J Med 350: 1328–1337.
  7. 7. Паркер Г.А., Крук Т., Бейн М., Сара Э.А., Фаррелл П.Дж. и др. (1996) Ядерный антиген вируса Эпштейна-Барр (EBNA)3C представляет собой иммортализующий онкопротеин со свойствами, сходными с аденовирусом E1A и папилломавирусом E7.Онкоген 13: 2541–2549.
  8. 8. Wang D, Liebowitz D, Kieff E (1985) Мембранный белок EBV, экспрессируемый в иммортализованных лимфоцитах, трансформирует установленные клетки грызунов. Ячейка 43: 831–840.
  9. 9. Niederman JC (1982)Инфекционный мононуклеоз: наблюдения за передачей. Yale J Biol Med 55: 259–264.
  10. 10. Niederman JC, Miller G, Pearson HA, Pagano JS, Dowaliby JM (1976)Инфекционный мононуклеоз. Выделение вируса Эпштейна-Барр со слюной и ротоглоткой.N Engl J Med 294: 1355–1359.
  11. 11. Yao QY, Rickinson AB, Epstein MA (1985) Повторное исследование состояния носителя вируса Эпштейна-Барр у здоровых серопозитивных лиц. Int J Рак 35: 35–42.
  12. 12. Фафи-Кремер С., Моранд П., Брион Дж. П., Павезе П., Баккард М. и др. (2005)Долгосрочное выделение инфекционного вируса Эпштейна-Барра после инфекционного мононуклеоза. J Infect Dis 191: 985–989.
  13. 13. Haque T, Crawford DH (1997) ПЦР-амплификация более чувствительна, чем методы тканевых культур для обнаружения вируса Эпштейна-Барр в клиническом материале.J Gen Virol 78 (Pt 12): 3357–3360.
  14. 14. Хислоп А.Д., Куо М., Дрейк-Ли А.Б., Акбар А.Н., Берглер В. и др. (2005)Тонзиллярное возвращение специфичных к вирусу Эпштейна-Барра CD8+T-клеток и баланс вирус-хозяин. Дж. Клин Инвест 115: 2546–2555.
  15. 15. Линг П.Д., Ледницки Дж.А., Кейтель В.А., Постон Д. Г., Уайт З.С. и соавт. (2003)Динамика реактивации и выделения герпесвирусов и полиомавирусов у здоровых взрослых: 14-месячное продольное исследование. J Infect Dis 187: 1571–1580.
  16. 16. Babcock GJ, Miyashita-Lin EM, Thorley-Lawson DA (2001)Обнаружение инфекции EBV на уровне отдельных клеток. Точный количественный анализ инфицированных вирусом клеток in vivo. Методы Мол Биол 174: 103–110.
  17. 17. Хохберг Д., Мидделдорп Дж. М., Каталина М., Салливан Дж. Л., Лузуриага К. и др. (2004) Демонстрация фенотипа вируса лимфомы Беркитта Эпштейна-Барра при делении латентно инфицированных клеток памяти in vivo. Proc Natl Acad Sci USA 101: 239–244.
  18. 18.Хохберг Д.Р., Торли-Лоусон Д.А. (2005)Количественное определение экспрессии вирусных генов в популяциях клеток, инфицированных вирусом Эпштейна-Барр, in vivo. Методы Мол Биол 292: 39–56.
  19. 19. Khan G, Miyashita EM, Yang B, Babcock GJ, Thorley-Lawson DA (1996) Является ли персистенция EBV in vivo моделью гомеостаза B-клеток? Иммунитет 5: 173–179.
  20. 20. Takada K, Ono Y (1989)Синхронная и последовательная активация латентно инфицированных геномов вируса Эпштейна-Барр.Дж. Вирол 63: 445–449.
  21. 21. Турк С.М., Цзян Р., Чеснокова Л.С., Хатт-Флетчер Л.М. (2006)Антитела к gp350/220 усиливают способность вируса Эпштейна-Барр инфицировать эпителиальные клетки. Дж. Вирол 80: 9628–9633.
  22. 22. Chang RS, Lewis JP, Abildgaard CF (1973)Распространенность ротоглоточных выделений агентов, преобразующих лейкоциты, среди населения человека. N Engl J Med 289: 1325–1329.
  23. 23. Golden HD, Chang RS, Prescott W, Simpson E, Cooper TY (1973)Агент, преобразующий лейкоциты: пролонгированная экскреция у пациентов с мононуклеозом и экскреция у нормальных людей.J Infect Dis 127: 471–473.
  24. 24. Сиксби Дж.В., Ширли П., Чесни П.Дж., Бантин Д.М., Резник Л. (1989) Обнаружение второго широко распространенного штамма вируса Эпштейна-Барра. Ланцет 2: 761–765.
  25. 25. Yao QY, Rowe M, Martin B, Young LS, Rickinson AB (1991)Состояние вирусоносительства Эпштейна-Барра: доминирование одного трансформирующего рост изолята в крови и в ротоглотке здоровых носителей вируса. J Gen Virol 72 (Pt 7): 1579–1590.
  26. 26. Лайчалк Л.Л., Торли-Лоусон Д.А. (2005)Конечная дифференцировка в плазматические клетки инициирует репликативный цикл вируса Эпштейна-Барр in vivo.Дж. Вирол 79: 1296–1307.
  27. 27. Лайчалк Л.Л., Хохберг Д., Бэбкок Г.Дж., Фримен Р.Б., Торли-Лоусон Д.А. (2002)Рассеивание В-клеток памяти слизистой оболочки: свидетельство персистирующей инфекции ВЭБ. Иммунитет 16: 745–754.
  28. 28. Пегтель Д.М., Мидделдорп Дж., Торли-Лоусон Д.А. (2004)Вирусная инфекция Эпштейна-Барра в культурах эпителиальных клеток миндалин ex vivo бессимптомных носителей. Дж. Вирол 78: 12613–12624.
  29. 29. Borza CM, Hutt-Fletcher LM (2002)Попеременная репликация в B-клетках и эпителиальных клетках переключает тропизм вируса Эпштейна-Барр. Nat Med 8: 594–599.
  30. 30. Hutt-Fletcher LM (2007) Заражение вирусом Эпштейна-Барра. Дж. Вирол 81: 7825–7832.
  31. 31. Андерссон-Анврет ​​М., Форсби Н., Кляйн Г., Хенле В. (1977)Связь между вирусом Эпштейна-Барра и недифференцированной карциномой носоглотки: коррелированная гибридизация нуклеиновых кислот и гистопатологическое исследование. Int J Рак 20: 486–494.
  32. 32. Гринспен Дж.С., Гринспен Д., Леннетт Э.Т., Абрамс Д.И., Конант М.А. и др.(1985) Репликация вируса Эпштейна-Барр в эпителиальных клетках «волосатой» лейкоплакии полости рта, поражения, связанного со СПИДом. N Engl J Med 313: 1564–1571.
  33. 33. Цзян Р., Скотт Р.С., Хатт-Флетчер Л.М. (2006) Вирус Эпштейна-Барр, выделяемый в слюне, имеет высокое содержание тропного к В-клеткам гликопротеина gp42. Дж. Вирол 80: 7281–7283.
  34. 34. Перри М., Уайт А. (1998) Иммунология миндалин. Иммунол Сегодня 19: 414–421.
  35. 35. Рааб-Трауб Н. (1989) Вирусы опухолей ДНК человека: вирус папилломы человека и вирус Эпштейна-Барра.Лечение рака, рез. 47: 285–302.
  36. 36. Karimi L, Crawford DH, Speck S, Nicholson LJ (1995)Идентификация области, реагирующей на дифференцировку эпителиальных клеток, в промоторе BZLF1 вируса Эпштейна-Барр. Дж. Ген Вирол 76: 759–765.
  37. 37. Тугизов С., Эррера Р., Велуппиллай П., Гринспен Дж., Гринспен Д. и др. (2007) Инфицированные вирусом Эпштейна-Барр (ВЭБ) моноциты способствуют распространению ВЭБ в эпителии слизистой оболочки полости рта. Дж. Вирол 81: 5484–5496.
  38. 38. Тугизов С.М., Берлин Дж.В., Палефски Дж.М. (2003)Вирусная инфекция Эпштейна-Барра поляризованных эпителиальных клеток языка и носоглотки. Nat Med 9: 307–314.
  39. 39. Фиш К.Н., Бритт В., Нельсон Дж.А. (1996)Новый механизм персистенции цитомегаловируса человека в макрофагах. Дж. Вирол 70: 1855–1862.
  40. 40. Luo MH, Fortunato EA (2007)Долговременная инфекция и выделение цитомегаловируса человека в клетках глиобластомы T98G. Дж. Вирол 81: 10424–10436.
  41. 41. Рессинг М.Е., Хорст Д., Гриффин Б.Д., Теллам Дж., Зуо Дж. и др. (2008)Уклонение вируса Эпштейна-Барр от CD8(+) и CD4(+) Т-клеточного иммунитета посредством согласованных действий множества генных продуктов. Семин Рак Биол.
  42. 42. Миллер С.Л., Ли Дж.Х., Кифф Э., Лонгнекер Р. (1994)Интегральный мембранный белок (LMP2) блокирует реактивацию вируса Эпштейна-Барр из латентного периода после перекрестного связывания поверхностного иммуноглобулина. Proc Natl Acad Sci U S A 91: 772–776.
  43. 43.Chang SS, Lo YC, Chua HH, Chiu HY, Tsai SC, et al. (2008) Критическая роль p53 в экспрессии Zta вируса Эпштейна-Барр, индуцированной ингибитором гистондеацетилазы. Дж. Вирол 82: 7745–7751.

Высокие уровни ДНК вируса Эпштейна-Барра в слюне и периферической крови от пар мать-ребенок из Уганды | Журнал инфекционных болезней

Аннотация

В Африке вирус Эпштейна-Барр (EBV) связан с лимфомой Беркитта. Мы измерили уровни ДНК EBV в слюне и лейкоцитах 233 бессимптомных детей из Уганды с серповидно-клеточной анемией и их матерей с помощью количественной полимеразной цепной реакции в реальном времени. ДНК ВЭБ была обнаружена в слюне у 90% детей (медиана [межквартильный размах {IQR}] уровень, 5,2 [4,2–6,0] log ·10 копий/мл слюны) и 79% матерей (медиана [IQR] уровень, 4,8 [3,7–5,6] log 10 копий/мл слюны) (P<0,001). ДНК ВЭБ была обнаружена в лейкоцитарных пленках у 86% детей (средний уровень [IQR] 2.5 [2,2–2,9] log 10 копий/1×10 6 периферических лейкоцитов [PWBCs]) и 72% матерей (средний уровень [IQR], 2,7 [2,4–3,1] log 10 копий /1×10 6 PWBC) (P=0,24). Обнаружение ДНК ВЭБ в слюне положительно коррелировало с обнаружением в лейкоцитарных пленках. ДНК ВЭБ чаще обнаруживали в слюне и лейкоцитах, чем ДНК вируса герпеса человека 8 типа. Наши результаты показывают, что инфекция ВЭБ сохраняется, при этом вирус легко обнаруживается в слюне и лейкоцитарных пленках людей без явных симптомов в Африке

Вирус Эпштейна-Барр (ВЭБ) распространен повсеместно, но возраст инфицирования варьирует [1]. В Африке большинство инфекций происходит в раннем детстве и протекает бессимптомно [2]; однако они связаны с эндемической лимфомой Беркитта, наиболее распространенной опухолью у африканских детей. На Западе инфекции возникают в основном у детей старшего возраста и подростков, у которых часто бывает инфекционный мононуклеоз [1]

ВЭБ, вероятно, передается через слюну, например, когда матери предварительно пережевывают пищу, которую затем дают младенцам, когда люди пользуются общей посудой, и когда люди целуются [1]. ВЭБ персистирует у инфицированных людей в лимфоидных или эпителиальных клетках полости рта или слюнных желез и периодически реактивируется, что приводит к выделению вируса в слюне [1].Мало что известно о закономерностях выделения ВЭБ со слюной или периферической кровью у африканцев. В популяциях на Западе, где исследования количественно определяли уровни ДНК EBV в слюне и периферической крови [3–5], EBV выявляется у здоровых людей по-разному, а уровни у отдельных лиц обычно низкие. Только в одном исследовании оценивались уровни EBV в периферической крови бессимптомных субъектов в Африке; было обнаружено, что высокие уровни ВЭБ легко обнаруживаются в периферической крови кенийских детей в возрасте 1–4 лет [6].Мы оценили выделение вируса у детей и их матерей в Уганде, стране, эндемичной по лимфоме Беркитта, чтобы узнать больше о распространенности ВЭБ, интенсивности инфекции и выделении вируса среди африканцев

Испытуемые, материалы и методы

Мы изучили 600 детей с серповидно-клеточной анемией и их матерей, которые в период с ноября 2001 г. по апрель 2002 г. были набраны из клиники серповидно-клеточной анемии в больнице Мулаго, Кампала, для участия в исследовании, в котором оценивался риск передачи вируса герпеса человека 8 типа через кровь ( HHV-8), вирус, причинно связанный с саркомой Капоши [7].По замыслу примерно половина детей была перелита. В настоящем подисследовании были проанализированы лица, которые ранее изучались на предмет обнаружения ДНК ВГЧ-8 в быстрозамороженных образцах слюны и лейкоцитарных пленках [8], включая всех детей, которые были либо серопозитивными (n = 143), либо неопределенными (n = 40) в отношении HHV- 8 с помощью серологического тестирования, а также 50 случайно выбранных HHV-8-серонегативных детей. Матери этих субъектов, если они были доступны, также изучались. Поскольку заражение ВЭБ среди африканцев происходит к 2-летнему возрасту [2], серологическое тестирование на ВЭБ не проводилось.Разрешение на тестирование на ВИЧ-инфекцию получено не было и поэтому не проводилось. Ни у одного субъекта не было известно или подозревалось, что он инфицирован ВИЧ. Для проведения серологического тестирования на HHV-8 матери дали письменное информированное согласие для себя и своих детей, а дети в возрасте ⩾7 лет дали засвидетельствованное согласие. Настоящее исследование было одобрено советами по этике Национального института рака и Национального института науки и технологий Уганды

ДНК была извлечена из слюны и лейкоцитарной пленки с использованием набора для выделения ДНК QIAamp (Qiagen).Приблизительно 150 мкг ДНК использовали для обнаружения ДНК EBV с помощью количественной полимеразной цепной реакции (ПЦР) в реальном времени на машине ABI Prism 7700 (Applied Biosystems). Образцы тестировали в трех повторностях в анализе с праймерами, специфичными для гена EBNA1, 5′-TCATCATCATCCGGGTCTCC-3′ и 5′-CCTACAGGGTGGAAAAATGGC-3′, а также меченым зондом 5′-(FAM)CGCAGGCCCCCCTCCAGGTAGAA(TAMRA)-3′. 9]. Уровни ДНК ВЭБ рассчитывали как среднее число копий вируса, обнаруженных в трех лунках для каждого образца; уровни в образцах слюны рассчитывали как количество копий на миллилитр слюны, а уровни в лейкоцитарных пленках рассчитывали как количество копий на 1×10 6 периферических лейкоцитов (PWBC) на основе количества копий гена эндогенного ретровируса человека 3 (2 копии/клетку) [10].Чтобы свести к минимуму контаминацию ПЦР, для подготовки реагентов, выделения ДНК и амплификации ПЦР использовались специальные помещения и оборудование. Субъекты с результатами ПЦР ниже предела количественного определения были исключены из анализа уровней ДНК EBV. Поскольку уровни ДНК EBV были искажены, они были преобразованы log 10 до того, как были проведены анализы. Значимость связи между обнаружением ДНК ВЭБ в слюне или периферической крови и социально-демографическими переменными определялась с помощью таблиц сопряженности.Значимость связей между уровнями ДНК EBV в слюне или периферической крови и социально-демографическими переменными, а также значения P тренда для переменных с 3 или более категориями определяли с помощью линейной регрессии. Средние уровни ДНК ВЭБ в слюне и клетках периферической крови детей и матерей сравнивали с помощью двухпробного теста t для независимых популяций. Отношения шансов (ОШ) и 95% доверительные интервалы (ДИ) для обнаружения ВЭБ в слюне и периферической крови оценивались с использованием логистической регрессии.Двусторонний P<0,05 считался статистически значимым

Результаты

Средний возраст детей составил 8,4 года (SD 3,9 года). Девятнадцать детей были младше 2 лет, в том числе 1 ребенок в возрасте 11 месяцев (входил в группу 1–4 лет). Средний возраст матерей составил 34,4 года (SD 7,8 года). Среди субъектов с адекватными образцами мы обнаружили ДНК ВЭБ в слюне у 90% (194/216) детей и у 79% (175/222) матерей.В обеих группах обнаружение ДНК ВЭБ не было связано с социально-демографическими переменными (данные не показаны). По сравнению с их матерями у детей были более высокие уровни ДНК ВЭБ в слюне (медиана [межквартильный размах {IQR}], 5,2 [4,2–6,0] против 4,8 [3,7–5,6] log 10 копий/мл слюны; P <. 001). У детей уровни ДНК ВЭБ в слюне не были связаны с полом (P=0,57) и возрастом (P=0,66), хотя они были слабо (хотя и недостоверно) обратно связаны с образованием матери (P=0,13) и напрямую относительно плотности домохозяйства (P=.10) (рис. 1). У матерей средний уровень ДНК ВЭБ в слюне был выше у женщин 17–29 лет, чем у женщин ⩾30 лет (5,1 против 4,5 log 10 копий/мл; P<0,007), был обратно пропорционален к образованию (P = 0,03) и не было связано с плотностью домохозяйства (P = 0,15)

Рисунок 1

Сравнение уровней ДНК вируса Эпштейна-Барр (ВЭБ), обнаруженных в слюне детей и их матерей, в соответствии с выбранными социально-демографическими переменными. Темные полосы внутри прямоугольников обозначают медианы, левая и правая границы прямоугольников отмечают межквартильный диапазон, а левые и правые границы линий за пределами прямоугольников обозначают 10-й и 90-й процентили соответственно.Также показан номер. субъектов с количественными измерениями ДНК EBV (за исключением субъектов с качественно положительным результатом на EBV с помощью полимеразной цепной реакции или с отсутствующими ковариантными данными). Плотность домохозяйства рассчитывалась как число. человек в доме по номеру. комнат в доме (низкая ⩽1,50; средняя 1,51–2,24; высокая 2,25–2,99; очень высокая ⩾3,00). P значения возраста, образования матери, плотности домохозяйства и источника воды приведены для тенденции переменные.Темные полосы внутри прямоугольников обозначают медианы, левая и правая границы прямоугольников отмечают межквартильный диапазон, а левые и правые границы линий за пределами прямоугольников обозначают 10-й и 90-й процентили соответственно. Также показан номер. субъектов с количественными измерениями ДНК EBV (за исключением субъектов с качественно положительным результатом на EBV с помощью полимеразной цепной реакции или с отсутствующими ковариантными данными). Плотность домохозяйства рассчитывалась как число. человек в доме по номеру. комнат в доме (низкий, ⩽1.50; средний 1,51–2,24; высокий, 2,25–2,99; и очень высокий, ⩾3,00). P значения возраста, образования матери, плотности домохозяйства и источника воды приведены для тенденции

Среди субъектов с адекватными образцами мы обнаружили ДНК ВЭБ в лейкоцитах у 86% (201/233) детей и у 72% ( 166/230) матерей. Как и в слюне, частота обнаружения ДНК ВЭБ в лейкоцитарных пленках обеих групп не была связана с социально-демографическими переменными (данные не представлены). В отличие от данных для слюны, уровни ДНК ВЭБ в лейкоцитарных пленках детей не отличались от уровней в лейкоцитарных пленках матерей (медиана [IQR], 2.5 [2,2–2,9] против 2,7 [2,4–3,1] log 10 копий/1×10 6 PWBC; Р=0,24). У детей уровни ДНК ВЭБ в лейкоцитарной пленке не были связаны с полом (P = 0,18), образованием матери (P = 0,16) и плотностью домохозяйства (P = 0,52), но сильно зависели от возраста (P = 0,52). .001) (рис. 2). У матерей уровни ДНК ВЭБ в лейкоцитарной пленке не были связаны с возрастом (P = 0,77), образованием (P = 0,91) и другими показателями социально-экономического статуса (рисунок 2 и данные не показаны)

Рисунок 2

Сравнение уровней ДНК вируса Эпштейна-Барр (ВЭБ), обнаруженных в лейкоцитарных пленках детей и их матерей, в соответствии с выбранными социально-демографическими переменными. Подробности см. в легенде к рисунку 1. PWBCs, лейкоциты периферической крови

Рисунок 2

Сравнение уровней ДНК вируса Эпштейна-Барр (ВЭБ), обнаруженных в лейкоцитах детей и их матерей, в соответствии с выбранными социально-демографическими переменными. Подробности см. в легенде к рисунку 1. PWBCs, лейкоциты периферической крови

ДНК ВЭБ чаще обнаруживали в лейкоцитах при обнаружении в слюне как у детей (ОШ 3,1 [95% ДИ 1,1–8,8]), так и у матерей (ОШ 2.6 [95% ДИ, 1,3–5,1]). Поскольку ранее мы обнаружили тесную связь между источником воды и выделением ДНК ВГЧ-8 [8], мы изучили связь между источником воды и уровнями ДНК ВЭБ в слюне и лейкоцитарной пленке. Уровни ДНК ВЭБ были самыми высокими в лейкоцитарной пленке, но не в слюне, у детей, которые потребляли воду из поверхностных источников, были промежуточными в лейкоцитарной пленке у детей, имевших доступ к воде из общественного крана или скважины, и были самыми низкими у детей с лейкоцитарной пленкой. пальто детей, потреблявших воду из личных кранов (P=. 001; фигура 2). Уровни ДНК ВЭБ в слюне и лейкоцитарных пленках матерей не зависели от источника воды. Ни частота обнаружения, ни уровни ДНК ВЭБ в слюне или лейкоцитарных пленках у детей и матерей не были связаны с местом проживания (т. е. город, пригород или сельская местность), использованием противомоскитных сеток, недавним заболеванием или ВГЧ-8. serostatus (данные не представлены)

По сравнению с ДНК ВГЧ-8 [8] ДНК ВЭБ выявлялась в слюне в 5 раз чаще (89% против 17% у детей и 86% против 80% у детей).17% у матерей) и в 8-14 раз чаще у лейкоцитов (79% против 10% у детей и 72% против 5% у матерей). При обнаружении уровни ДНК EBV были в среднем на 0,25 log 10 копий выше в слюне и на 0,5 log 10 копий выше в лейкоцитарных пленках, чем соответствующие уровни ДНК HHV-8 (P<0,001, для всех; данные не показано). У детей ДНК ВЭБ чаще выявлялась в слюне при обнаружении ДНК ВГЧ-8, чем при ее отсутствии (100% против 88%; P=0,02). Однако обнаружение ДНК ВЭБ в лейкоцитарных пленках у детей не было связано с обнаружением ДНК ВГЧ-8 (93% против 93%). 85%; Р=0,20). Соответствующие частоты обнаружения ДНК ВЭБ у матерей с ДНК HHV-8 или без нее составляли 91% против 77% (P=0,12) в слюне и 82% против 72% (P=0,46) в лейкоцитарных пленках

Обсуждение

Это первое исследование ДНК ВЭБ в слюне и периферической крови бессимптомных субъектов в Африке. ДНК ВЭБ часто и в больших количествах обнаруживали как в слюне, так и в лейкоцитах детей с серповидно-клеточной анемией и их матерей. Обнаружение ДНК EBV в слюне коррелировало с обнаружением в лейкоцитарных пленках, что позволяет предположить, что уровни вируса в полости рта и в периферической крови тесно связаны.Уровни ДНК EBV, обнаруженные у наших субъектов, были высокими, что указывает на то, что инфекция EBV сохраняется при высоких уровнях вируса даже у людей без явных симптомов. Уровни, измеренные в лейкоцитарной пленке у наших субъектов, аналогичны уровням, зарегистрированным у реципиентов трансплантата с подавленным иммунитетом в западных популяциях, которые обычно составляют 3,5–4,9 log 10 копий/1×10 6 мононуклеарных клеток периферической крови [11]

Уровни ДНК ВЭБ в слюне и лейкоцитах были самыми высокими в самой младшей возрастной группе (1–4 года). Недавнее исследование бессимптомных детей в Кении также выявило очень высокие уровни ДНК ВЭБ в периферической крови детей в возрасте 1–4 лет [6]. Высокие уровни ДНК ВЭБ у этих детей младшего возраста могут быть связаны с первичной инфекцией ВЭБ; тем не менее, уровни вируса у детей старшего возраста и у матерей в нашем исследовании все еще были довольно высокими, хотя эти люди должны были быть инфицированы много лет назад. Наши результаты, а также данные из Кении, позволяют предположить, что количество В-клеток, инфицированных ВЭБ, увеличивается у лиц, инфицированных ВЭБ в Африке.Мы предполагаем, что рецидивирующая малярия или другие паразитарные инфекции могут быть важны. Малярийные и другие паразиты влияют на иммунную систему и могут нарушать специфический к ВЭБ Т-клеточный иммунитет и, таким образом, влиять на уровни ДНК ВЭБ в слюне или периферической крови [12]. В качестве альтернативы они могут стимулировать расширение пула латентно инфицированных В-клеток [12]. В поддержку этой гипотезы было показано, что уровни ДНК EBV в периферической крови выше у детей в районах с высокой интенсивностью передачи малярии, чем у детей в районах с низкой интенсивностью передачи малярии в Кении [6]. Мы не можем исключить или подтвердить роль малярийных или других паразитов, потому что они не оценивались в настоящем исследовании. Однако около 17% детей в Кампале, Уганда, имеют бессимптомную малярию с положительным мазком, а 45% имеют малярийную ДНК, обнаруженную с помощью ПЦР [13]. Здесь уровни ДНК ВЭБ в слюне были связаны с некоторыми (низкий уровень образования матери и высокая плотность домохозяйства), но не со всеми, маркерами низкого социально-экономического статуса. На уровни ДНК ВЭБ могут влиять социально-экономические факторы, влияющие на возраст инфицирования, количество инокулята и частоту повторных контактов с ВЭБ и/или другими паразитами

В Африке ВЭБ распространен повсеместно, тогда как ВГЧ-8 имеет более ограниченное распространение .В настоящей когорте ДНК ВЭБ обнаруживалась чаще и в более высоких количествах в слюне и лейкоцитах, чем ДНК ВГЧ-8. Хотя оба вируса являются γ-герпесвирусами и, по-видимому, передаются через слюну, более высокие уровни ДНК EBV в слюне могут объяснить более высокую трансмиссивность и более ранний возраст инфицирования для EBV, чем для HHV-8 [2, 14]. Наше исследование предполагает, что заражение одним вирусом связано с повышенным выделением другого вируса. За эту корреляцию могут быть ответственны генетические факторы или факторы окружающей среды [15].В отличие от этих данных, ДНК ВГЧ-8 обнаруживается нечасто и в едва обнаруживаемых количествах в слюне и лейкоцитарном слое у людей в регионах с низкой эндемичностью, таких как Европа и Северная Америка, за исключением мужчин, имеющих половые контакты с мужчинами

Наши исследование ограничено тем, что в нем анализировались дети с серповидно-клеточной анемией, склонные к иммуносупрессии из-за потери функции селезенки в результате повторных инфарктов. Таким образом, наши результаты не могут быть распространены на все население Уганды.Однако наши результаты аналогичны результатам для практически здоровых кенийских детей [6]. Они также аналогичны результатам для матерей наших детей, у которых не было серповидно-клеточной анемии. Эти матери должны были быть гетерозиготными по гену серповидно-клеточной анемии, но как носители не страдали бы инфарктом селезенки. Кроме того, наше исследование было поперечным; таким образом, мы не смогли определить продольные отношения между уровнями ДНК EBV и клиническими и социально-демографическими факторами. В-третьих, мы не тестировали на заражение малярией или другими паразитами, что могло бы повлиять на наши результаты.Поскольку наше исследование является первым, в котором оценивается выделение ВЭБ со слюной у африканцев, наши результаты нуждаются в подтверждении. Из-за его связи с лимфомой Беркитта, злокачественной опухолью, эндемичной для Африки, важно понимать факторы, которые контролируют инфекцию ВЭБ

Благодарности

Мы благодарны субъектам исследования и персоналу Клиники серповидно-клеточной анемии в больнице Мулаго, Кампала, за их участие; Амали Амарасингхе (Исследовательский институт треугольника, Вашингтон, округ Колумбия) за координацию полевых работ; к докторуBenon Biryahwaho (Угандийский научно-исследовательский институт вирусов) за хранение и доставку образцов; и Abhijit Dasgupta (отделение биостатики, отдел эпидемиологии и генетики рака, Rockville, MD) и Vickie Marshall (секция вирусной эпидемиологии, Frederick, MD) за полезные обсуждения. Мы также благодарны больнице Мулаго, Медицинской школе Университета Макерере и Министерству здравоохранения Уганды за разрешение на проведение исследования

Ссылки

1..

Вирусная инфекция Эпштейна-Барр

,

N Engl J Med

,

2000

, vol.

343

 (стр. 

481

92

)2.,  ,  ,  ,  ,  .

Первичные инфекции вируса Эпштейна-Барр у африканских младенцев. I. Снижение материнских антител и время заражения

,

Int J Cancer

,

1978

, vol.

22

 (стр. 

239

43

)3.,  ,  , и др.

Повышенная точность обнаружения карциномы носоглотки за счет комбинированного применения ДНК циркулирующего вируса Эпштейна-Барр и антител IgA к капсидному антигену вируса Эпштейна-Барр

50

 (стр. 

339

45

)4.,  ,  ,  .

Обнаружение вируса Эпштейна-Барр в слюне и смывах из горла у здоровых взрослых и детей

2

 (стр. 

115

20

)5.,  ,  , и др.

Частый мониторинг нагрузки ДНК вируса Эпштейна-Барр в нефракционированной цельной крови необходим для раннего выявления посттрансплантационного лимфопролиферативного заболевания у пациентов с высоким риском

97

 (стр. 

1165

71

)6.,  ,  , и др.

Воздействие голоэндемической малярии приводит к повышению вирусной нагрузки Эпштейна-Барр у детей

191

 (стр. 

1233

8

)7.,  ,  , и др.

Инфекция вирусом герпеса человека 8 и история трансфузий у детей с серповидно-клеточной анемией в Уганде

95

 (стр.

1330

5

)8.,  ,  , и др.

Обнаружение ДНК герпесвируса, ассоциированного с саркомой Капоши, в образцах слюны и лейкоцитарной пленки у детей с серповидноклеточной анемией в Уганде

190

 (стр. 

1382

6

)9.,  ,  , и др.

Количественный анализ ДНК бесклеточного вируса Эпштейна-Барр в плазме крови пациентов с карциномой носоглотки

59

 (стр. 

1188

91

)10. ,  ,  .

Количественное определение клеток человека с использованием ПЦР в реальном времени ERV-3

91

 (стр. 

109

17

)11.,  ,  , и др.

Характеристика В-клеток, инфицированных вирусом Эпштейна-Барр, у пациентов с посттрансплантационным лимфопролиферативным заболеванием: исчезновение после терапии ритуксимабом не предсказывает клинический ответ

96

 (стр. 

4055

63

)12.,  ,  .

Эндемическая лимфома Беркитта: полимикробное заболевание?

,

Nat Rev Microbiol

,

2005

, vol.

3

 (стр. 

182

7

)13.,  ,  .

Бессимптомная паразитемия как фактор риска симптоматической малярии в когорте детей Уганды

9

 (стр. 

862

8

)14.,  ,  ,  ,  ,  .

Инфицирование вирусом герпеса человека типа 8 в семьях в сельских районах Танзании

,

J Infect Dis

,

2003

, vol.

187

 (стр. 

1780

5

)15.,  ,  , и др.

Обнаружение и количественная оценка вируса герпеса, ассоциированного с саркомой Капоши, для прогнозирования саркомы Капоши, ассоциированной со СПИДом

17

 (стр.  

1847

51

)

© 2005 г. Американского общества инфекционистов

Вирус Эпштейна-Барр в слюнных железах при синдроме Шегрена вызывает локальный аутоиммунитет

Была предложена этиологическая связь между В-клеточно-трофическим вирусом Эпштейна-Барр (EBV) и синдромом Шегрена, но данные о преимущественной экспрессии EBV в слюнных железах пациентов с синдромом Шегрена противоречивы.Новое исследование, опубликованное в Arthritis & Rheumatology , предполагает, что ответ может заключаться в эктопических лимфоидных структурах (ЭЛС) в слюнных железах пациентов с синдромом Шегрена, которые служат нишами для латентного периода и реактивации ВЭБ и способствуют активации и дифференцировке плазматические клетки.

«…эктопические лимфоидные структуры… служат нишами для латентного периода и реактивации ВЭБ. ..»

Сравнение слюнных желез 28 пациентов с синдромом Шегрена и 38 пациентов с неспецифическим хроническим сиалоаденитом (НСХС), Croia et ​​al .показали, что EBV аберрантно экспрессируется в слюнных железах предков, особенно в тех железах, которые демонстрируют ELS, о чем свидетельствует присутствие кодируемых EBV транскриптов малых РНК (EBER) и клеток EBER + в инфильтрирующих клетках. Кроме того, В-клетки в эктопических фолликулах экспрессировали латентный белок ВЭБ LMP2A, а перифолликулярные плазматические клетки экспрессировали литический антиген ВЭБ BFRF1; напротив, практически ни в одной из слюнных желез без ELS или у пациентов с NSCS не было выявлено латентного или литического EBV.

Цитотоксический CD8 + Т-клетки накапливаются вне фолликулов В-клеток, в областях, богатых клетками BFRF1 + . Примечательно, что окрашивание как для BFRF1, так и для основного антигена синдрома Шегрена Ro52 показало, что реактивация EBV происходит в значительной части перифолликулярных плазматических клеток, которые продуцируют антитела против Ro52.

Дальнейшие исследования показали, что аутореактивный профиль В-клеток, инфицированных EBV, является специфичным для заболевания: перифолликулярные плазматические клетки слюнных желез с синдромом Шегрена реагировали с Ro52, но не цитруллинированным фибриногеном, и, наоборот, аутореактивные плазматические клетки из ELS-содержащей синовиальной ткани пациентов с ревматоидный артрит (РА) реагировал на цитруллинированный фибриноген, но не на Ro52.Подтверждая эти результаты in vivo , приживление ELS-содержащих слюнных желез или синовиальной оболочки RA мышам SCID поддерживало локальную продукцию антител против EBV и специфических для заболевания аутоантигенов.

Результаты показывают, что ВЭБ-инфекция тесно связана с эктопической реакцией, подобной зародышевой, хотя причинно-следственная связь между вирусом и синдромом Шегрена еще предстоит определить.

Ссылки

  1. 1

    Croia, C. и др. . Влияние инфекции вируса Эпштейна-Барр на аутореактивную активацию В-клеток, специфичную для болезни, в эктопических лимфоидных структурах синдрома Шегрена. Ревматоидный артрит. 10.1002/арт.38726

Скачать ссылки

Об этой статье

Цитировать эту статью

Onuora, S. Вирус Эпштейна-Барра в слюнных железах при синдроме Шегрена стимулирует местный аутоиммунитет. Nat Rev Rheumatol 10, 384 (2014).https://doi.org/10.1038/nrrheum.2014.97

Скачать цитату

Поделиться этой статьей

Любой, с кем вы поделитесь следующей ссылкой, сможет прочитать этот контент:

Получить ссылку для общего доступа

Извините, ссылка для общего доступа в настоящее время недоступно для этой статьи.

Предоставлено инициативой Springer Nature SharedIt по обмену контентом.

Цитомегаловирус, вирус Эпштейна-Барр и вирус герпеса человека 8 выделение слюны у ВИЧ-позитивных мужчин, имеющих половые контакты с мужчинами, с контролируемой и неконтролируемой виремией ВИЧ в плазме: 24-месячное продольное исследование | BMC Infectious Diseases

  • 1.

    Virgin HW, Wherry EJ, Ahmed R. Новое определение хронической вирусной инфекции. Клетка. 2009; 138:30–50.

    КАС Статья Google Scholar

  • 2.

    Крус-Муньос ME, Фуэнтес-Панана EM. Бета- и гамма-герпесвирусы человека: агонистические и антагонистические взаимодействия с иммунной системой хозяина. Фронт микробиол. 2018;8:2521.

    Артикул Google Scholar

  • 3.

    Gilden DH, Mahalingam R, Cohrs RJ, Tyler KL.Герпесвирусные инфекции нервной системы. Нат Клин Практ Нейрол. 2007; 3:82–94.

    КАС Статья Google Scholar

  • 4.

    Sinzger C, Digel M, Jahn G. Клеточный тропизм цитомегаловируса. Курр Топ Микробиол Иммунол. 2008; 325: 63–83.

    КАС пабмед Google Scholar

  • 5.

    Hau PM, Tsao SW. Вирус Эпштейна-Барра захватывает датчики реакции на повреждение ДНК, чтобы управлять своим жизненным циклом. Вирусы. 2017;9.

  • 6.

    Хайдар Г., Сингх Н. Вирусные инфекции у реципиентов трансплантатов солидных органов: новые обновления и обзор классики. Curr Opin Infect Dis. 2017;3:579–88.

    Артикул Google Scholar

  • 7.

    Янг Л.С., Яп Л.Ф., Мюррей П.Г. Вирус Эпштейна-Барр: ему более 50 лет, а он все еще преподносит сюрпризы. Нат Рев Рак. 2016; 16: 789–802.

    КАС Статья Google Scholar

  • 8.

    Дзюжинский К., Чанг С.М., Хеймбергер А.Б., Калейта Р.Ф., МакГрегор Даллас С.Р., Смит М. и соавт. Консенсус о роли цитомегаловируса человека в глиобластоме. Нейроонкология. 2012;14:246–55.

    Артикул Google Scholar

  • 9.

    Goncalves PH, Uldrick TS, Yarchoan R. ВИЧ-ассоциированная саркома Капоши и родственные заболевания. СПИД. 2017; 31: 1903–16.

    Артикул Google Scholar

  • 10.

    Улдрик Т.С., Ван В., О’Махони Д., Алеман К., Вивилл К.М., Маршалл В. и др. Системный воспалительный синдром, связанный с интерлейкином-6, у пациентов с коинфекцией герпесвирусом, ассоциированным с саркомой Капоши, и ВИЧ, но без мультицентрической болезни Кастлемана. Клин Инфекция Дис. 2010;51:350–8.

    КАС Статья Google Scholar

  • 11.

    Halenius A, Hengel H. Цитомегаловирус человека и аутоиммунное заболевание. Биомед Рез Инт. 2014;2014:472978.

    Артикул Google Scholar

  • 12.

    Канг И., Куан Т., Ноласко Х., Парк С.Х., Хонг М.С., Крауч Дж. и др. Дефектный контроль латентной вирусной инфекции Эпштейна-Барр при системной красной волчанке. Дж Иммунол. 2004; 172:1287–94.

    КАС Статья Google Scholar

  • 13.

    Boppana SB, Ross SA, Shimamura M, Palmer AL, Ahmed A, Michaels MG, et al. Анализ полимеразной цепной реакции слюны для скрининга цитомегаловируса у новорожденных. N Engl J Med. 2011;364:2111–8.

    КАС Статья Google Scholar

  • 14.

    Pow EH, Law MY, Tsang PC, Perera RA, Kwong DL. Уровень ДНК вируса Эпштейна-Барр в слюне у пациентов с раком носоглотки после лучевой терапии. Оральный онкол. 2011;47:879–82.

    КАС Статья Google Scholar

  • 15.

    Parisi SG, Cruciani M, Scaggiante R, Boldrin C, Andreas S, Dal Bello F, et al.Анальная и оральная папилломавирусная инфекция (ВПЧ) у ВИЧ-инфицированных в северной Италии: продольное когортное исследование среди мужчин, имеющих половые контакты с мужчинами. BMC Infect Dis. 2011;11:150.

    Артикул Google Scholar

  • 16.

    Dittmer DP, Tamburro K, Chen H, Lee A, Sanders MK, Wade TA, et al. Оральное выделение герпесвирусов у ВИЧ-инфицированных пациентов с различной степенью иммунного статуса. СПИД. 2017;31:2077–84.

    Артикул Google Scholar

  • 17.

    Миллер К.С., Бергер Дж.Р., Мутур Ю., Авдиушко С.А., Чжу Х., Крисцио Р.Дж. Высокая распространенность множественных герпесвирусов человека в слюне от лиц, инфицированных вирусом иммунодефицита человека, в эпоху высокоактивной антиретровирусной терапии. Дж. Клин Микробиол. 2006;44:2409–15.

    КАС Статья Google Scholar

  • 18.

    Карвалью К.С., Сильвестре Эде А., Масиэль Сда С., Лира Х.И., Гальван Р.А., Соареш М.Дж. и др. ПЦР-обнаружение множественной ДНК вируса герпеса человека в слюне ВИЧ-инфицированных в Терезине, штат Пиауи, Бразилия.Rev Soc Bras Med Trop. 2010;43:620–3.

    Артикул Google Scholar

  • 19.

    Jacobson MA, Ditmer DP, Sinclair E, Martin JN, Deeks SG, Hunt P, et al. Репликация вируса герпеса человека и аномальная активация CD8+ Т-клеток и низкое количество CD4+ Т-клеток у ВИЧ-инфицированных пациентов с антиретровирусной супрессией. ПЛОС Один. 2009;4:e5277.

    Артикул Google Scholar

  • 20.

    Scaggiante R, Andreas S, Basso M, Franchin E, Franzetti M, Del Vecchio C, et al.Выделение ДНК вируса Эпштейна-Барр и цитомегаловируса из слюны коррелирует с долгосрочным обнаружением РНК ВИЧ в плазме у ВИЧ-инфицированных мужчин, имеющих половые контакты с мужчинами. J Med Virol. 2016;88:1211–21.

    КАС Статья Google Scholar

  • 21.

    May MT, Gompels M, Delpech V, Porter K, Orkin C, Kegg S, et al. Влияние на ожидаемую продолжительность жизни ВИЧ-1-положительных людей числа клеток CD4+ и ответа вирусной нагрузки на антиретровирусную терапию. СПИД. 2014; 28:1193–202.

    Артикул Google Scholar

  • 22.

    Hofstra LM, Mudrikova T, Stam AJ, Otto S, Tesselaar K, Nijhuis M, et al. Остаточная виремия предшествует вирусным вспышкам и стойкой низкоуровневой виремии у пациентов, получавших лечение ВИЧ-1. ПЛОС Один. 2014;9:e110749.

    Артикул Google Scholar

  • 23.

    Young J, Rickenbach M, Calmy A, Bernasconi E, Staehelin C, Schmid P, et al. Транзиторная обнаруживаемая виремия и риск рецидива вируса у пациентов из швейцарского когортного исследования ВИЧ.BMC Infect Dis. 2015;15:382.

    Артикул Google Scholar

  • 24.

    Навазеш М. Методы сбора слюны. Энн Н.Ю. Академия наук. 1993; 694: 72–7.

    КАС Статья Google Scholar

  • 25.

    Parisi SG, Basso M, Del Vecchio C, Andreas S, Franchin E, Bello FD, et al. Вирусологическое исследование спинномозговой жидкости у детей в возрасте до 14 лет с подозрением на инфекцию центральной нервной системы: ретроспективное исследование 304 последовательных детей с января 2012 г. по май 2015 г.Eur J Paediatr Neurol. 2016;20:588–96.

    Артикул Google Scholar

  • 26.

    Biasolo MA, Calistri A, Cesaro S, Gentile G, Mengoli C, Palu G. История болезни: кинетика вирусной нагрузки Эпштейна-Барр у пациента с трансплантацией костного мозга без признаков лимфопролиферативного заболевания. J Med Virol. 2003;69:220–2.

    Артикул Google Scholar

  • 27.

    Менголи С., Кузинато Р., Биасоло М.А., Чезаро С., Паролин С., Палу Г.Оценка ЦМВ-нагрузки у реципиентов трансплантатов паренхиматозных органов с помощью антигенемии pp65 и количественного ПЦР-анализа ДНК в реальном времени: корреляция с обнаружением РНК pp67. J Med Virol. 2004; 74: 78–84.

    Артикул Google Scholar

  • 28.

    Уайт IE, Campbell TB. Количественное определение бесклеточной и ассоциированной с клетками ДНК герпесвируса, ассоциированного с саркомой Капоши, методом ПЦР в реальном времени. Дж. Клин Микроб. 2000; 38:1992–5.

    КАС Google Scholar

  • 29.

    Коновер В.Дж. Практическая непараметрическая статистика. 3-е изд. Нью-Йорк: Джон Уайли и сыновья.

  • 30.

    Руководство Европейского клинического общества по СПИДу, версия 7.1. http://www.eacsociety.org. По состоянию на 12 октября 2017 г.

  • 31.

    Руководство Европейского клинического общества по СПИДу, версия 9.0. http://www.eacsociety.org. По состоянию на 18 января 2018 г.

  • 32.

    Rohner E, Wyss N, Heg Z, Faralli Z, Mbulaiteye SM, Novak U, et al. Коинфекция ВИЧ и вируса герпеса человека 8 по всему миру: систематический обзор и метаанализ.Инт Джей Рак. 2016; 138:45–54.

    КАС Статья Google Scholar

  • 33.

    Hislop AD, Taylor GS, Sauce D, Rickinson AB. Клеточные реакции на вирусную инфекцию у людей: уроки вируса Эпштейна-Барр. Анну Рев Иммунол. 2007; 25: 587–617.

    КАС Статья Google Scholar

  • 34.

    Crough T, Khanna R. Иммунобиология цитомегаловируса человека: от скамьи до постели.Clin Microbiol Rev. 2009; 22:76–98.

    КАС Статья Google Scholar

  • 35.

    Хаттаб С., Гиге М., Карселен Г., Фурати С., Гихо А., Отран Б. и др. Растворимые биомаркеры иммунной активации и воспаления при ВИЧ-инфекции: влияние двухлетней эффективной комбинированной антиретровирусной терапии первой линии. ВИЧ Мед. 2015; 16: 553–62.

    КАС Статья Google Scholar

  • 36.

    Агудело-Эрнандес А., Чен Ю., Буллотта А., Бьюкенен В.Г., Кламар-Блейн К.Р., Боровски Л. и соавт. Субклиническое выделение вируса герпеса среди ВИЧ-1-инфицированных мужчин, получающих антиретровирусную терапию. СПИД. 2017;31:2085–94.

    Артикул Google Scholar

  • 37.

    Паризи С.Г., Болдрин С., Андреис С., Ферретто Р., Фузер Р., Малена М. и др. ДНК-виремия KSHV коррелирует с низким количеством клеток CD4+ у итальянских мужчин во время диагностики ВИЧ-инфекции. J Med Virol.2011; 83: 384–90.

    Артикул Google Scholar

  • 38.

    Кухара Т., Ватанабэ Д., Исида Н., Тамада Й., Мацумото Й., Ихира М. и др. Количественный анализ выделения вируса Эпштейна-Барр в слюне пациентов с заболеваниями соединительной ткани: экспериментальное исследование. Int J Дерматол. 2013;52:887–90.

    Артикул Google Scholar

  • 39.

    Никообахт М., Бейтоллахи Дж., Никообахт Н., Алуш М., Сахебджами М., Резайданеш М. и др.Оценка вирусной нагрузки Эпштейна-Барра в слюне до и после трансплантации почки. Пересадка Proc. 2011;43:540–2.

    КАС Статья Google Scholar

  • 40.

    Shan J, Pow EH, Tsang PC, Perera RA, Kwong DL. Сравнение двух методов лабораторной экстракции для обнаружения вируса Эпштейна-Барр в слюне пациентов с раком носоглотки. Джей Инвестиг Клин Дент. 2014;5:104–8.

    Артикул Google Scholar

  • 41.

    Mui UN, Haley CT, Tyring SK. Вирусная онкология: молекулярная биология и патогенез. Дж. Клин Мед. 2017;6.

  • 42.

    Масиа М., Робледано С., Ортис де ла Табла В., Антекера П., Лумбрерас Б., Эрнандес И. и др. Коинфекция вирусом герпеса человека 8 связана с персистирующим воспалением и иммунной активацией у ВИЧ-инфицированных пациентов с подавленным вирусом. ПЛОС Один. 2014;9:e105442.

    Артикул Google Scholar

  • 43.

    Ong DSY, Bonten MJM, Spitoni C, Verduyn Lunel FM, Frencken JF, Horn J и др. Эпидемиология множественной герпетической виремии у ранее иммунокомпетентных пациентов с септическим шоком. Клин Инфекция Дис. 2017;64:1204–10.

    КАС Статья Google Scholar

  • Вирус Эпштейна-Барр | инфекционный агент

    Вирус Эпштейна-Барр (EBV) , вирус семейства Herpesviridae, который является основной причиной острого инфекционного мононуклеоза, распространенного синдрома, характеризующегося лихорадкой, болью в горле, сильной усталостью и увеличением лимфатических узлов.

    Вирус Эпштейна-Барра впервые был описан британскими учеными М.А. Эпштейном, Ю.М. Барр и Б.Г. Achong, который обнаружил вирусоподобные частицы в клетках, выращенных из тканей, пораженных недавно описанным лимфатическим раком. Известно, что вирус Эпштейна-Барра способен инфицировать только два различных типа клеток в организме: некоторые клетки слюнных желез и один особый тип лейкоцитов (лейкоциты). Вирус, поражающий клетку слюнной железы, попадает в рот со слюной, которая является единственной телесной жидкостью, содержащей инфекционные частицы ВЭБ.Тип лейкоцитов, называемый В-лимфоцитом, также может нести вирус Эпштейна-Барр. Эти узкоспециализированные клетки вырабатывают антитела, помогающие бороться с инфекциями. В слюнной железе завершается цикл роста вируса и образуются инфекционные вирусные частицы; однако внутри В-лимфоцитов цикл роста вируса прерывается, и ВЭБ сохраняется в В-лимфоцитах в частично реплицированном состоянии на протяжении всей жизни клетки. Несмотря на то, что рост вируса в В-клетке является неполным, лимфоцит постоянно изменяется в результате инфекционного процесса, т. е.д., В-клетки могут приобретать характеристики роста, напоминающие характеристики раковых лимфоцитов. Пораженные В-лимфоциты могут чрезмерно размножаться, вызывая рак лимфатической системы.

    Подробнее по этой теме

    рак: вирус Эпштейна-Барр

    Вирус Эпштейна-Барр (ВЭБ) представляет собой тип вируса герпеса, хорошо известный тем, что вызывает мононуклеоз. Тоже способствует…

    В менее развитых странах заражение ВЭБ встречается почти у всех детей в возрасте до пяти лет и не сопровождается узнаваемыми симптомами. В промышленно развитых странах около половины населения успешно избегает заражения ВЭБ в позднем подростковом возрасте или в начале 20-летнего возраста. Когда заражение ВЭБ задерживается до подросткового или раннего взрослого возраста, организм, по-видимому, реагирует на него по-разному. Примерно в двух третях этих случаев инфекция протекает бессимптомно или в очень легкой форме. В оставшейся трети случаев инфекция вызывает мононуклеоз.

    Другие редкие заболевания также связаны с вирусом Эпштейна-Барр. К ним относятся африканский лимфоидный рак, называемый лимфомой Беркитта; карцинома носоглотки, рак придаточных пазух носа и горла, распространенный в Южном Китае, Юго-Восточной Азии и Северной Африке, а также среди эскимосов; и некоторые неврологические заболевания, включая энцефалит (воспаление головного мозга) и параличи различных групп нервов (например, паралич Белла, поражающий лицевой нерв).

    Специфических методов лечения любой формы EBV-инфекции не существует, и вакцины еще не разработаны.

    Эта статья была недавно отредактирована и обновлена ​​Эми Тикканен.

    Вирус Эпштейна-Барра | Everyday Health

    К 35 годам почти каждый заражается вирусом Эпштейна-Барр, наиболее частой причиной мононуклеоза.

    Вирус Эпштейна-Барр (ВЭБ) относится к семейству вирусов герпеса и является одним из наиболее распространенных вирусов человека в мире.

    К 35 годам почти у всех есть антитела к ВЭБ, что указывает на то, что они были инфицированы вирусом в какой-то момент своей жизни — независимо от того, были ли у них когда-либо симптомы.

    Вирус Эпштейна-Барра и мононуклеоз

    ВЭБ является наиболее частой причиной инфекционного мононуклеоза, также известного как железистая лихорадка, «болезнь поцелуев» или просто «моно».

    Его характерные симптомы:

    Примерно в 30-50% случаев ВЭБ вызывает моно, но многие инфекции ВЭБ остаются незамеченными либо потому, что они не вызывают симптомов, либо симптомы легко спутать с другими признаками инфекции.

    Подростки и молодые люди особенно уязвимы: по крайней мере, у 25 процентов из них разовьется моно.

    Вирус Эпштейна-Барра Причины

    ВЭБ заразен и обычно распространяется через биологические жидкости, особенно слюну и другие слизистые жидкости.

    Кровь и сперма также могут передавать вирус во время полового контакта, переливания крови и трансплантации органов.

    Вы можете заразиться ВЭБ, пользуясь общими стаканами для питья, столовыми приборами или зубными щетками с человеком, у которого есть вирус.

    Нет никаких доказательств того, что дезинфекция таких предметов остановит распространение ВЭБ. Считается, что вирус может выжить, пока зараженный объект остается влажным.

    Человек, впервые заразившийся ВЭБ, может распространять вирус в течение нескольких недель, не осознавая, что он инфицирован.

    После инфицирования ВЭБ остается в организме в неактивном состоянии.

    Однако, если вирус реактивируется, вы потенциально можете передать его другим, независимо от того, сколько времени прошло с момента вашего первоначального заражения.

    Симптомы вируса Эпштейна-Барр

    При появлении симптомов ВЭБ они обычно исчезают через две-четыре недели.

    Однако некоторые люди могут чувствовать усталость в течение нескольких недель или даже месяцев.

    Симптомы инфекции EBV могут включать в себя следующее:

    • Усталость
    • лихорадка
    • лихорадка
    • Наспытный горл
    • Надувные лимфатические узлы в вашей шее
    • Увеличенная селезенка
    • боль в животе
    • , вызванная опухшей печенью
    • сыпь как «мононуклеозная сыпь»)

    Диагностика вируса Эпштейна-Барр

    Поскольку симптомы ВЭБ напоминают симптомы других заболеваний, диагностировать инфекцию бывает трудно.

    Однако существуют анализы крови, которые могут подтвердить, инфицированы ли вы ВЭБ.

    Анализ крови Monospot, например, проверяет вашу кровь на наличие антител к ВЭБ.

    Лечение вируса Эпштейна-Барра

    Лечения ВЭБ не существует, но следующие меры могут облегчить симптомы:

    • Обильное питье
    • Много отдыхать
    • Прием безрецептурных обезболивающих от боли и лихорадки
    • Леденцы от горла

    Примеры безрецептурных болеутоляющих и жаропонижающих средств включают:

    Лицам моложе 19 лет не следует принимать аспирин во время вирусного заболевания (включая моно или ВЭБ) из-за риска синдрома Рея.

    Несмотря на то, что вакцины против ВЭБ не существует, вы можете предотвратить заражение, избегая целоваться или делиться напитками, едой или личными вещами (например, зубными щетками) с человеком, который им заражен.

    Осложнения, вызванные вирусом Эпштейна-Барра

    Помимо моноинфекции, ВЭБ-инфекция может привести к ряду других заболеваний и осложнений, особенно у людей с ослабленной иммунной системой.

    Эти осложнения включают:

    • Вирусный менингит, который включает отек тканей, покрывающих головной и спинной мозг стороны тела
    • Синдром Гийена-Барре
    • Внезапное некоординированное движение мышц
    • Нарушения сна
    • Психозы
    • Отрицательное влияние на кровь и костный мозг, образование избыточного количества лейкоцитов
    • Ослабление иммунной системы, приводящее к другим инфекции

    Вирус Эпштейна-Барра и рак

    Рак, связанный с инфекцией ВЭБ, включает:

    • Лимфому Беркитта (рак лимфатической системы)
    • Карциному носоглотки (рак верхней части глотки)
    • Ходжкинскую лимфому и нелимфоматозную лимфому рак)
    • Посттрансплантационный лимфопр олиферативное расстройство (слишком много лейкоцитов после трансплантации органов)
    • Опухоли, включая рак мягких тканей и Т-клеточные лимфомы

    Другие состояния и вирус Эпштейна-Барр

    ВЭБ-инфекция также может вызывать следующее:

    • Пневмонию
    • Scaring Lung Scaring
    • поджелудочная железа набухание
    • Сердце мышцы
    • поднял, белые пятна на языке
    • наполненные глюбовые ткани вблизи минсилсов
    • Синусовая инфекция (синусит)
    • воспаление печени (гепатит)
    • Отек лимфатических узлов
    • Бактериальная инфекция сосцевидного отростка черепа сразу за ухом
    • Отек и повреждение слюнных желез
    • Закупорка дыхательных путей в носу и горле LMP1 среди ВИЧ-инфицированных | Кристина М Мунте

      Выявление вируса Эпштейна-Барр в слюне и Gen LMP1 у ВИЧ-инфицированных пациентов

      Элиза Кристина М. Мунте, Руди Висаксана, Риецки Амалия, Ирна Суфиавати


      Реферат

      Вирус Эпштейна-Барра (EBV), также называемый вирусом герпеса человека 4 (HHV-4), обнаружен у 95% населения и протекает бессимптомно.ВЭБ является этиологическим агентом волосатой лейкоплакии полости рта (ВЛЛ) у больных ВИЧ. Латентный мембранный белок 1 ( LMP1 ), интегральный белок EBV, может модулировать рост, дифференцировку, индуцировать экспрессию нескольких клеток, активацию антигенов и молекул адгезии. Ген LMP1 был связан с OHL. Цели : определить распространенность EBV в слюне и гена LMP1 у пациентов с ВИЧ/СПИДом с положительным результатом на EBV. Методы : Было проведено перекрестное исследование пациентов с ВИЧ/СПИДом.Наличие ВЭБ в слюне определяли с помощью микрочиповой ПЦР. LMP1 исследуют с помощью вложенной ПЦР. Результаты : Объектами исследования были 30 пациентов с ВИЧ/СПИДом, состоящих из 70% мужчин и 30% женщин, из них 50% в возрастной группе 31-40 лет и 40% имели количество CD4 <200 клеток/мм 3 (40% ). ВЭБ в слюне был обнаружен у 26 из 30 (87%) больных ВИЧ и LMP1 выявлен у 17 больных (65,38%). Заключение : Высокая распространенность ВЭБ в слюне и ген LMP1 могут повышать риск ОХЛ.Ранний скрининг на ВЭБ-инфекцию у пациентов с ВИЧ/СПИДом важен для снижения риска заболеваний, связанных с ВЭБ.


      Ключевые слова

      ЭБВ; ВИЧ/СПИД; ЛМП1; ОХЛ


      Полный текст: PDF

      Рефбеки

      • В настоящее время нет рефбеков.


      Эта работа находится под лицензией Creative Commons Attribution 3.0 License.


      Эта работа находится под лицензией Creative Commons Attribution 3.0 Лицензия.

      .
      Вирус эпштейна барра в слюне: Молекулярно-биологическое исследование слюны на вирус Эпштейна-Барра (Epstein

    Добавить комментарий

    Ваш адрес email не будет опубликован.