Содержание

Дисбактериоз кишечника / Статьи

Под дисбактериозом кишечника зачастую подразумевают заболевание, но по словам работников медицинской сферы, точнее вести речь о синдроме, когда нарушается количественный и качественный состава микрофлоры. В здоровом кишечнике превалирую полезные бактерии – в случае дисбактериоза они гибнут, и на их место приходят микроорганизмы патогенного характера.

В чем здесь заключается опасность?  

  • Нарушается обмен веществ.
  • Ухудшается синтез витаминов
  • Ухудшается выработка микро – и макроэлементов.

Этот синдром ведет к появлению авитаминоза хронического характера, к развитию неспособности организма противостоять заболеваниям. Из-за недостатка витамина B «падает» зрение, образуется конъюнктивит и прочие глазные заболевания. Дефицит витамина A провоцирует дерматит и сухость кожи. Проблемы с витамином D – хрупкие кости и даже остеопороз. Вообще проблем со здоровьем из-за дисбактериоза существует масса.

Причины возникновения и способы борьбы с недугом

Стрессы – пусковые факторы для развития дисбактериоза, а также прием пищи и воды, несвойственных человеку (например, в заграничных поездках), а также инфекции, прием антибиотиков.

Кроме того, важно смотреть и на повседневную деятельность человека – дисбактериоз могут «заработать» лица, которые злоупотребляют чипсами, газировкой, шоколадом, консервированными продуктами.

По этой причине в период лечения сильнодействующими лекарствами или в отпуске нужно сберечь микрофлору и пить препараты натурального происхождения, в которых есть полезные бактерии для всего кишечника. «Линекс», например, способствует восстановлению бактериального баланса в организме. В качестве профилактики и дополнительных мер нужна организация правильного питания- есть больше кисломолочных продуктов, фрукты, овощи, каши. Топинамбур богат олигосахаридами, что стимулирует рост полезных кишечных бактерий.

Расстройство пищеварения – это первый тревожный маячок, показывающий на дисбактериоз. Вздутие живота, диарея, кишечный дискомфорт должны насторожить! Здесь настоятельно применять средства для снятия симптомов «Имодиум», «Лопедиум» и «Смекта», но лишь для облегчения на время. Симптомы довольно быстро возвращаются.

Изменения веса в обе стороны  — резкий набор или похудение – тоже говорят о проблеме. Также должны вызвать закономерное беспокойство высыпания на коже.

Все причисленное в сочетании с ослабленным иммунитетом – просто-таки призыв обратиться к специалисту и сдать анализы на возможный дисбактериоз кишечника.

Если диагноз подтвердится, терапевт или гастроэнтеролог назначает курс лечения, т.е. ряд процедур, в ходе которых восстанавливается состав микрофлоры кишечника.

Признаки и причины дисбактериоза — сеть клиник НИАРМЕДИК

Симптомы дисбактериоза кишечника

Симптомы дисбактериоза кишечника у взрослых и детей аналогичны признакам различных заболеваний желудочно-кишечного тракта, которые сопровождаются следующими проявлениями:

  • отрыжкой;
  • тошнотой;
  • изжогой;
  • вздутием живота;
  • поносами;
  • запорами;
  • неприятным привкусом во рту;
  • неприятным запахом изо рта;
  • болями в животе;
  • аллергическими реакциямидаже на безобидные продукты питания;
  • субфибрильной температурой.

При дисбактериозе в первую очередьпод удар попадаетпроцесс пищеварения. Пищу в кишечнике сначала расщепляют бактерии, а уже потом она всасывается в кровь. Без содействияполезных микробовчеловеческий организм не может полноценно усвоить необходимые питательные вещества. Поэтому и появляются такие признаки дисбактериоза кишечника как тошнота, рвота, жидкий стул и т.п.

Диагностика дисбактериоза

Для определения наличия и характера дисбактериоза кишечника необходимо сдать анализ, чтобы выяснить, какие именно микроорганизмы и в каком количестве населяют кишечник. Применяются следующие методы диагностики:

  • Бактериологическое исследование. Результат данного анализа готовится восемь дней – именно столько времени в среднем нужно для того, чтобы бактерии выросли в специальных питательных средах и стали доступны для выявления. Качество результатов зависит от соблюдения сроков доставки, от качества материала и особенностей и трудностей культивирования отдельных видов бактерий.
  • Метод обследования метаболитов микрофлоры, основанный на определении летучих жирных кислот, выделяемых микробами в процессе своего развития. Способ отличается высокой чувствительностью и очень прост в определении микробов, а также позволяет получить результат уже в течение нескольких часов.

Необходимо учитывать, что состав микрофлоры кишечника у каждого человека индивидуален. Это зависит от возраста, рациона питания, и даже от времени года. Потому одних лишь анализов для установления диагноза недостаточно. Обычно требуется дополнительное обследование для выявления причин дисбактериоза.

На сегодняшний день не существует ни одного способа диагностики, который позволил бы уверенно говорить о наличии кишечного дисбактериоза. Симптомы, приписываемые этому заболеванию, обычно являются проявлениями какого-либо основного заболевания. Малоинформативным является даже широко распространенный анализ на дисбактериоз у детей. Копроскопия не дает совсем никакой информации о микроорганизмах в кишечнике, только выявить наличие паразитов в некоторых случаях.

Лечение дисбактериоза

В сети клиник НИАРМЕДИК в большинстве случаев проводят комплексное лечение дисбактериоза кишечника у взрослых и детей, так как заболевание часто связано с нарушением моторики кишечника, синдромом раздраженного кишечника, а также психоэмоциональными нарушениями. Выбор методовлечения зависит от того, как протекает заболевание, на фоне которого проявляется кишечный дисбактериоз, а также от преобладающих симптомов.

Эффективные мероприятия по лечению дисбактериоза обычно направлены на то, чтобы:

  • изменить образ жизни,
  • соблюдать диету.

Огромное значение в терапии дисбактериоза имеет пересмотр образа жизни и правильное питание. Пациентам рекомендуется:

  • избегать работы, требующей большой физической нагрузки;
  • избегать психоэмоциональных потрясений и стрессовых ситуаций;
  • дозировать регулярную физическую нагрузку – это оказывает положительное влияние на нервную систему и позволяет избавиться от депрессии.

Основные принципы питания при дисбактериозе

  • кишечник должен быть максимально защищен от механического, химического и термического воздействия пищи;
  • еда должна быть полноценной и разнообразной;
  • пища должна содержать все необходимые витамины и микроэлементы;
  • питаться следует по определенному графику в строго определенные часы;
  • последний прием пищи должен быть не позднее, чем за три часа до сна;
  • кушать следует медленно, хорошо пережевывая пищу, не отвлекаясь на чтение, разговоры или просмотр телевизора;
  • соблюдать рекомендации врача по употреблению или же исключения из рациона тех или иных продуктов;
  • устранить избыточное размножение вредных микроорганизмов в кишечнике.

Лечение антибиотиками должно осуществляться исключительно по показаниям врача. Антибактериальные препараты применяются только при сильном дисбактериозе с угрозой попадания микробов из кишечника в кровь и развитии сепсиса.

В остальных случаях лечение начинают с кишечных антисептиков, которые назначаются на 10-14 дней. Данные препараты оказывают более мягкое воздействие, не нарушают нормальную микрофлору, и при этом значительно снижают количество болезнетворных бактерий. Если антисептики не дали эффекта, могут назначить антибиотики.

Имплантировать нормальную кишечную микрофлору

Для восстановления микрофлоры применяются пробиотики — препараты, которые содержат представителей нормальной флоры кишечника и пребиотики — лекарства, облегчающие их выживание и размножение в кишечнике.

Самые изученные и полезные бактерии для кишечника – это бифидо и лактобактерии. Пробиотики применяются регулярно, длительно (в течение 1-2-х месяцев) и дозировано.

Повысить иммунитет для создания естественной микрофлоры кишечника

Пациентам со сниженным иммунитетом могут назначить иммуностимуляторы и витамины в дополнение к диете.

Также могут применяться адсорбенты – препараты, которые обладают вяжущим и обволакивающим действием, а также впитывают растворы токсинов.

Профилактика дисбактериоза кишечника

Профилактика дисбактериоза состоит из лечения антибактериальными средствами, обязательного общеукрепляющего лечения и полноценного питания для ослабленных пациентов.

симптомы и лечение, профилактика дисбактериоза

Лекарство от дисбактериоза должно быть направлено не только на снятие симптомов, но и благоприятно устранять патологическую микрофлору, которая вызывает это кишечное заболевание. Что такое дисбактериоз, и какие препараты эффективно справятся с ним?


Дисбактериоз. Симптомы

Когда состав микрофлоры кишечника по каким-либо патогенным причинам меняется, то наступает дисбактериоз – нарушение работы желудка и пищеварительной системы, в связи с появлением патогенной микрофлоры.

Здоровый кишечник богат полезными бактериями – бифидобактериями, лактобактериями, бактероидами. Данные микроорганизмы помогают в работе желудка, и имеет защитную функцию. При попадании нежелательных бактерий – стрептококков, протея, грибков рода кандида или стафилококков, происходит дисбаланс здоровой и патогенной микрофлоры.

В процессе борьбы этих двух групп за выживание, человек и ощущает на себе проявление дисбактериоза. Правильное лекарство от дисбактериоза восстанавливает работу кишечника, и человек вновь чувствует себя здоровым.

Но что это за симптомы? Во-первых, это – вздутие живота, болезненные ощущение в области кишечника, поносы, продолжительные запоры и неустойчивый стул (чередование проноса и запора). Также заболевание может проявляться в виде общей слабости и снижении работоспособности, постоянной усталости, снижении аппетита.

Причинами дисбактериоза могут быть следующие факторы:

  • Нерациональное употребление антибиотиков;
  • Кишечные инфекции;
  • Болезни пищеварительных органов, такие как: гастрит, язвы, панкреатит;
  • Перенесенные операции на органах пищеварения;
  • Неправильное питание, недостаток природных витаминов в пище;
  • Снижение иммунитета.

В случае возникновения заболевания после антибиотиков применяют лекарство от дисбактериоза, которые нормализируют микрофлору, уравновешивают баланс бифидобактерий.

Нарушение работы на фоне неправильного питания устраняется путем составления диеты, анализом образа жизни и его коррекции.

Лечение дисбактериоза

Лечение дисбактериоза проводится препаратами двух групп: пробиотики и пребиотики.

Пробиотики – лекарство от дисбактериоза, наиболее эффективные преператы, так как имеют высокую концентрацию бактерий, которые угнетают рост патогенных микроорганизмов. Эта группа представлена следующими препаратами: Бифидумбактерин форте (для ректального применения), порошок Пробифор, Флорин Форте в виде порошка и другие.

Пребиотики – механизм действия основан на процессе расщепления фруктозно-галактозного дисахарида на органические кислоты, что подавляет активность патогенной микрофлоры кишечника. Представители: Дюфалак, сироп Нормазе, Порталак, Ромфалак и другие.

Профилактика дисбактериоза

Для профилактики заболевания рекомендуется больше времени проводить на воздухе, употреблять свежие продукты, особенно в осенне-зимний период. Лучшее лекарство от дисбактериоза это правильно соблюденная диета и хорошее настроение. Стрессы могут провоцировать кишечные заболевания, и осознание этого факта позволяет эффективно справиться с заболеванием или вовсе его избежать.


Регулярные консультации у гастроэнтеролога — это верный способ всегда быть осведомленным о состоянии своего здоровья. Также, соблюдая правила питания и приема лекарств мы можем избежать появления дисбактериоза в нашей жизни.

🧬 Сумасшедший дисбактериоз

Слово «дисбактериоз» последнее время внушает практически мистический ужас — на него списывают все практически беды человечества. Болит живот? — Дисбактериоз! Прыщи? Расстройство желудка? Низкий жизненный тонус? — Дисбактериоз! Буркает, кастрюкает, да и вообще как-то не так? Вы еще сомневаетесь — это он, страшный и ужасный, Дис-бак-те-ри-оз…
Есть правда и обратная сторона — некоторые утверждают, что никакого дисбактериоза не существует. Нет на Западе такого понятия. И даже среди врачей эти мифы распространены: одни говорят «есть» и упорно его лечат, другие — «нет» и «не занимайтесь ерундой». Попробуем разобраться более детально с кандидатом медицинских наук, гастроэнтерологом и гепатологом GMS Clinic Сергеем Вяловым.

«А был ли мальчик?»

Для начала важно признать, что от микробов мы никуда не денемся. Они есть на коже, на еде, по разным оценкам, у нас в кишечнике их около 2-3 кг. Это много. У некоторых людей это почти 5 % веса. Поэтому неважно, как называется нарушение в кишечнике, но надо понимать, каково оно. В России, ещё во времена Мечникова, было открыто взаимодействие бактерий и фагоцитоза. Доказано, что это взаимодействие связано с работой иммунной системы. Но потом про это забыли. Позже западные коллеги вспомнили про это. Только назвали не «дисбактериозом», а «неправильной колонизацией кишечника» в немецком варианте, или, например, «синдромом избыточного бактериального роста» в английском. Суть одна, а названия — разные. Вот вам и смута в людских сердцах (и, как следствие, желудочно-кишечных трактах).

Дисбактериоз — есть! Он не может не есть…

В глобальном плане, нас не интересует количество нормальных бактерий. Они прекрасно живут и размножаются, если им комфортно. Но! Если мы включим в комнате температуру плюс 50 градусов, то дееспособные люди разбегутся из нее очень быстро. Тоже самое и с бактериями — они спешно покидают организм, если им некомфортно. Нарушения микрофлоры кишечника являются последствием какого-либо заболевания. Если нарушение есть по анализу или по метеоризму, боли в животе, и т. д. — надо понимать, отчего оно возникло. Либо это последствие приема антибиотиков, либо это наличие заболевания в кишечнике. Важно понимать: это временное нарушение после эпизода отравления или пищевой инфекции, или это воспалительный процесс, который надо лечить.

Не ждать милостей от природы, взять их у нее — наша задача!

Сегодня существует высокотехнологическое производство лактобактериальных препаратов, где выращивают микроорганизмы, прицельно действующие на какое-нибудь звено или процесс. Например, препараты, препятствующие побочному действию антибиотиков.

И они прекрасно с этим справляются. То есть не развиваются на фоне приема антибиотиков ни диарея, ни колиты.

Есть препараты бактерий, выращенные, чтобы влиять на иммунную систему — и это не пробиотики, которые продаются в аптеках.

Есть препараты, недоступные в России, которые улучшают состояния у людей с энцефалопатией. Есть те, которые улучшают состояние у больных депрессией. И это доказанный эффект!

Напутственное слово

По большому счету, вреда от приема бактерий не будет. Пользы, правда, тоже может не быть.

Одно важно — в случае воспалительных процессов лечение только лишь бактериями может привести к серьезным осложнениям.

А еще с помощью грамотно подобранных бактерий можно добиться хороших результатов при различных, на вид не очень связанных с ЖКТ, заболеваний. Но тут, конечно, нужен грамотный специалист.

причины появления, симптомы заболевания, диагностика и способы лечения

ВАЖНО!

Информацию из данного раздела нельзя использовать для самодиагностики и самолечения. В случае боли или иного обострения заболевания диагностические исследования должен назначать только лечащий врач. Для постановки диагноза и правильного назначения лечения следует обращаться к Вашему лечащему врачу.

Диcбактериоз: причины появления, симптомы, диагностика и способы лечения.

Определение

Дисбактериоз, или дисбиоз – это качественное и количественное изменение микрофлоры в организме. Для него характерно увеличение или резкое уменьшение бактерий, снижение их разнообразия. Дисбактериоз может возникнуть на любом участке, где присутствуют бактерии, включая кожу, влагалище, ротовую полость и т.д.

Но чаще всего под дисбактериозом подразумевают нарушение микрофлоры кишечника.

Микрофлора играет важную роль в поддержании работы иммунной системы, но существует и обратная связь – при серьезном снижении иммунитета возникает дисбактериоз.

Причины появления дисбактериоза

В кишечнике человека присутствует от 70 до 80% клеток иммунной системы. Поэтому любая нестабильность кишечной микрофлоры может нарушить естественные защитные механизмы организма, настроенные против болезней и недомоганий.

Дисбактериоз кишечника связан не только с кишечными расстройствами, но и с множеством других состояний, на первый взгляд не относящихся к пищеварению, – кожными проблемами (акне, экзема), неврологическими расстройствами и т.д.

Среди причин развития дисбактериоза отмечают:

  • Увеличение числа болезнетворных бактерий и дрожжевых грибов (например, кандида) и недостаток полезных микроорганизмов.

  • Проникновение микроорганизмов, в норме находящихся в толстом отделе кишечника, в тонкий кишечник. Это происходит при хронических заболеваниях, характеризующихся поражением слизистой оболочки желудочно-кишечного тракта (болезнь Крона или неспецифический язвенный колит).
  • К другим факторам врачи относят генетическую предрасположенность, несбалансированное питание с низким содержанием клетчатки, но с высоким содержанием сахара и обработанных продуктов, физический и психологический стресс, чрезмерное потребление алкоголя, частое применение антибактериальных препаратов и средств от изжоги, плохую гигиену полости рта.
Классификация дисбактериоза

По причине появления:

  1. Дисбактериоз у практически здоровых лиц:
    • возрастной дисбактериоз – изменения микрофлоры у людей пожилого возраста;
    • сезонный дисбактериоз – изменения микрофлоры в холодное время года; 
    • нутритивный дисбактериоз – связанный с несбалансированным питанием;
    • профессиональный дисбактериоз – при различных профессиональных вредностях.
  1. Дисбактериоз, сопровождающий различные заболевания органов пищеварения (желудка, поджелудочной железы, печени и желчевыводящих путей, кишечника, при синдроме мальабсорбции (нарушенном всасывании питательных веществ)).
  2. Дисбактериоз при других заболеваниях: 
    • инфекционных, 
    • иммунодефицитных, 
    • при гипо- и авитаминозах (уменьшенном поступлении в организм или плохой усвояемости необходимых витаминов), 
    • при интоксикациях и воздействии на организм человека радионуклидов (радиоактивных изотопов, которые можно встретить в местах с повышенным радиационным фоном, в ограниченном количестве и под строгим контролем они используются для диагностики и лечения некоторых заболеваний).
  1. Лекарственный дисбактериоз. Возникает вследствие приема антибиотиков, иммунодепрессантов, антацидов, антисекреторных, слабительных средств, химиотерапии и других лекарственных препаратов.
  2. Стрессорный дисбактериоз. Возникает как результат длительного эмоционального или физического стресса. 
По клиническим формам:
  • Бессимптомная форма дисбактериоза.
  • Локальная, или местная форма дисбактериоза. Наблюдается при развитии локального воспалительного процесса в кишечнике (у больного появляются симптомы колита или энтерита – воспалительных заболеваний толстого или тонкого кишечника).
  • Распространенная форма дисбактериоза. Проявляется выраженными нарушениями пищеварения. 
По степени тяжести (определяется количеством и составом бактерий):
  • 1-я степень тяжести;
  • 2-я степень тяжести; 
  • 3-я степень тяжести; 
  • 4-я степень тяжести.  
Симптомы дисбактериоза

Симптомы дисбактериоза зависят от формы и степени тяжести течения заболевания. Пациенты могут предъявлять жалобы на расстройство желудка, тошноту, диарею или запор, повышенное газообразование и вздутие живота, снижение аппетита, необъяснимую усталость и проблемы с концентрацией внимания, неприятный запах изо рта, высыпания на коже.


Диагностика заболевания

При постановке диагноза врач обращает внимание на жалобы, симптомы заболевания и результаты осмотра. Но для оценки степени тяжести дисбактериоза обычно требуются лабораторные и инструментальные обследования.

  1. Клинический анализ крови с развернутой лейкоцитарной формулой.
К каким врачам обращаться

Лечением дисбактериоза кишечника занимаются врачи-гастроэнтерологи, но если дисбактериоз вызван другими заболеваниями или больного беспокоит дисбактериоз иной локализации, потребуется консультация других специалистов: врача-гинеколога, невролога, эндокринолог, дерматолога.

Лечение дисбактериоза

Терапия дисбактериоза направлена не только на излечение заболевания, но и на повышение иммунитета организма.

Первостепенное значение имеет диета, исключающая острую, жареную, копченую пищу, продукты с высоким содержанием сахара, быстрые углеводы, некоторые фрукты (яблоки, бананы, виноград), молочные продукты, но допускающая кисломолочные, поскольку они содержат пробиотики и стимулируют рост полезных микроорганизмов.

Предпочтение следует отдавать продуктам, богатым пищевыми волокнами (хлеб из муки грубого помола, крупы, кроме белого риса, овощи и зелень, сухофрукты).

Медикаментозное лечение дисбактериоза обычно включает антибактериальные синтетические средства (кишечные антисептики), бактериофаги, пробиотики, пребиотики. Антибиотики назначают в случае распространенной формы дисбактериоза, выраженной интоксикации, длительной диареи, лабораторно доказанного микробного заражения кишечника, при тяжелом иммунодефиците. Препарат, дозу, кратность и путь введения рекомендует врач.

Для купирования диареи, боли в животе, уменьшения вздутия принимают препараты симптоматической терапии.

Осложнения

Дисбактериоз негативно влияет на иммунную систему и ослабляет защитные силы организма. В результате повышается восприимчивость к инфекционным и простудным заболеваниям.

Нарушение кишечной микрофлоры ведет к проблемам с обменом веществ, обострениям эндокринологических заболеваний.

Доказана связь между психическим здоровьем и дисбактериозом. Депрессии и повышенная тревожность могут возникнуть на фоне дисбактериоза или же их течение может усугубляться.

У женщин дисбактериоз кишечника способен привести к нарушению нормальной микрофлоры влагалища, что чревато развитием бактериального вагиноза, кандидоза и других заболеваний мочеполовой системы.

Профилактика дисбактериоза

Для профилактики дисбактериоза необходимо следить за рационом питания, обязательно включать в него пищу, богатую клетчаткой и пищевыми волокнами, кисломолочные продукты.

Если по медицинским показаниям врачи назначают антибиотики, то их прием следует сопровождать пробиотиками и пребиотиками, а в ряде случаев противогрибковыми препаратами.

Источники:

  1. Яковенко Э. П. Дисбактериоз кишечника // Лечебное дело. 2004. № 3. С. 6-7.
  2. Кривущев Б.И. Дисбактериоз и пробиотики // ЗР. 2010. № 3. С. 75-78.
  3. Ардатская М.Д., Бельмер С.В., Добрица В.П., Захаренко С.М., Лазебник Л.Б., Минушкин О.Н., Орешко Л.С., Ситкин С.И., Ткаченко Е.И., Суворов А.Н., Хавкин А.И., Шендеров Б.А. Дисбиоз (дисбактериоз) кишечника: современное состояние проблемы. Комплексная диагностика и лечебная коррекция // ЭиКГ. 2015. № 5 (117). С. 13-43.
ВАЖНО!

Информацию из данного раздела нельзя использовать для самодиагностики и самолечения. В случае боли или иного обострения заболевания диагностические исследования должен назначать только лечащий врач. Для постановки диагноза и правильного назначения лечения следует обращаться к Вашему лечащему врачу.


Информация проверена экспертом

Лишова Екатерина Александровна

Высшее медицинское образование, опыт работы — 19 лет

Дисбактериоз — миф российской медицины

Тем не менее, как дань дремучим совковым традициям, «дисбактериоз» продолжает слетать с языка многих практикующих врачей, особенно педиатров. По-прежнему стандарты медосмотров малышей включают тестирование кала на «дисбактериоз». При этом давно известно, что искать корреляцию между составом флоры в кале и реальным ее соотношением в криптах кишечника — все равно, что гадать на кофейной гуще. Во-первых, основу кишечной флоры составляют бактероиды, которые не растут на питательных средах. Во-вторых, соотношение бактерий на выходе имеет очень мало общего с тем, что живет в кишке. В-третьих, все то время, пока вы собираете и несете ваши бесценные фекалии в лабораторию, жизнь в них не прекращается, и уже через несколько часов вся флора и фауна кала радикально видоизменяется. А потому все заключения о «преобладании патогенной флоры над нормальной» в таком анализе попросту смехотворны.

В общем, всем нам надо понимать, что такого самостоятельного заболевания, как дисбактериоз, в природе нет.

Существуют лишь ряд временных состояний организма (те же вирусные диареи или длительная антибиотикотерапия), которые могут привести к временному же дисбалансу нормальной флоры. При этом дисбаланс этот, как правило, не качественный, а количественный. В пример могу привести чрезмерный рост бактерии Clostridium difficile с развитием псевдомембранозного колита на фоне длительной терапии антибиотками.

Чаще же всего дискомфорт в животе обусловлен не мифическими заболеваниями, а совершенно реальным бунтом организма против всякой колы и прочей мак-дряни. Если вашего ребенка в животе не прекращается “шум и гам”, в первую очередь посмотрите, что он у вас ест.

У взрослых под «дисбактериозом» нередко скрываются синдром раздраженного кишечника, синдром избыточного бактериального роста в тонкой кишке, лактазная недостаточность, а также другие невыявленные состояния, при которых нарушается баланс кишечной флоры. Эти расстройства надо лечить, воздействуя на причину такого дисбаланса, а не сам дисбаланс, который является лишь следствием.

На теме дисбактериоза активно паразитируют различные производители кисломолочных продуктов питания, пробиотиков (препаратов с живыми бактериальными культурами) и пребиотиков (веществ, не перевариваемых человеком, но являющихся пищей для ряда бактерий).

Как я уже объяснил в колонке о кишечной флоре, бактерии пробиотиков могут становиться лишь транзитными колонистами, тогда как цель всех лечебных мероприятий заключается в восстановлении баланса СОБСТВЕННОЙ микрофлоры.

В ряду многочисленных препаратов для коррекции дисбактериоза хочу выделить особо абсурдный класс лекарств — бактериофаги. Бактериофаги — это такие вирусы, которые поражают бактерий. Когда-то ученые предложили использовать их против стафилококков, кишечных палочек и других возбудителей диарей. Однако исследования показали, что бактериофаги полностью разрушаются в желудке, и от таких препаратов во всем мире давно уже отказались. Точнее, во всем мире, кроме России — у нас эти псевдолекарства популярны и по сей день, и особенно хорошо неэффективные препараты лечат несуществующие дисбактериозы.

Если ваш врач уверенно заявляет, что ваша микрофлора разбалансирована, и вы вовсю уже «страдаете дисбактериозом», не паникуйте! Попытайтесь отыскать грамотного специалиста, который не станет жонглировать несуществующими диагнозами и назначать фуфломицины, а займется общепринятой диагностикой, которая позволит отличить инфекционную или органическую патологию кишечного тракта от физиологических и психосоматических расстройств. И не спешите разоряться в аптеках! Лучше сэкономьте деньги на полноценное питание себе и вашим детям, «подкормите» микрофлору естественным образом — здоровой пищей. Растительные волокна овощей, фруктов и зерновых — лучшая поддержка для

О дисбактериозе рассказывает педиатр «ЕвроМед клиники»

Дисбактериоз — история о плохих и хороших бактериях

Дисбактериоз — одна из наиболее часто обсуждаемых проблем со здоровьем, особенно, среди детей. Педиатр «ЕвроМед клиники»Елена Сергеевна Кочеткова рассказывает нашим читателям, что известно о дисбактериозе в свете современных знаний.

Дисбактериоз – микроэкологические нарушения в желудочно-кишечном тракте. Это клиническая совокупность нарушений в макроорганизме (то есть в человеке), вызванные изменением количественных соотношений, состава и свойств микрофлоры. Дисбактериоз определяется, по сути, по результату анализа — посева кала на известные и возможные для исследования микроорганизмы толстого кишечника. В последнее время чаще говорят о дисбиозе, это нарушение функционирования и механизмов взаимодействия организма человека, его микрофлоры и окружающей среды. Почему это важно? Согласно результатам последних исследований, микрофлора заселяет практически все поверхности, все слизистые оболочки и полости тела. Конечно, большая часть живет в толстом и тонком кишечнике, но при этом 80–90% не культивируются (то есть невозможно вырастить и изучить) вне тела человека, и как следствие, о них мы практически ничего не знаем. На одну клетку человека приходится примерно 10 микробных, причем вся микрофлора несет в 150 раз больше генетической информации, чем человек. Представьте: на одну единицу «человек-информации» приходится 150 единиц «микробы-информации»! Только в таком соотношении мы можем функционировать, полноценно жить. Как известно, у человека 4 группы крови, точно так выделены 3 энтеротипа микробиоценоза человека. Каждому человеку в рамках своего энтеротипа присуща своя микробная ассоциация. Энтеротип неизменен, но количество и качество поддерживающих бактерий зависит от питания, заболеваний, использования лекарств, окружающей среды.

Что же делает микрофлора в нашем теле?

  • противостоит болезнетворным бактериям и сдерживает рост условно-патогенных бактерий
  • участвует в синтезе и всасывании многих витаминов
  • разрушает и выводит токсины
  • вырабатывает вещества, участвующие в обмене холестерина, жирных кислот, липопротеидов, оксалатов, стероидных гормонов
  • участвует в формировании как местного, так и системного иммунитета. По сути, кишечник и находящиеся в нем бактерии являются самым большим иммунным органом человека
  • участвует в переваривании многих пищевых ингредиентов
  • питает, поддерживает работу клеток кишечной стенки
Это далеко не все, только основные направления работы нашей микрофлоры. Не зря 20% поступающих пищевых ингредиентов и 10% вырабатываемой организмом энергии идет на поддержание нашей микрофлоры.

Симптомы

Как проявляется дисбиоз хорошо известно всем:

  • диспептический синдром: поносы, запоры, метеоризм, повышенное газообразование, отрыжка, боли в животе
  • аллергические реакции: кожные высыпания, бронхиальная астма, насморк, непереносимость некоторых пищевых продуктов
  • частые простудные заболевания, как правило, протекающие длительно и волнообразно
  • синдром мальабсорбции — нарушение всасывания, как следствие: гиповитаминоз, анемия, неврологические расстройства, задержка роста и развития
  • хроническая интоксикация, как следствие: недомогание, плохой аппетит, головные боли, субфебрильная температура

Хотя, как упоминалось выше, кишечная микробиота индивидуальна и в целом постоянна, она не существует как нечто неизменное, представляя собой динамически меняющуюся смесь микробов, индивидуальных для каждого человека. К факторам, влияющим на становление кишечной микробиоты, у младенцев относят:

  • наличие у мамы любых инфекций: хронических урогенитальных и других, даже вне обострения, острых (ОРЗ и др.), прием лекарств, нерациональное питание
  • роды путем кесарева сечения
  • позднее (не в родовом зале) прикладывание к груди. Млечные ходы молочной железы заселены лакто- и бифидобактериями, даже если новорожденный высосет 3–5 мл молозива он получит первой «хорошую» семейную микрофлору, а не больничную, вероятнее всего, вредную
  • гипоксия нервной системы любой степени тяжести
  • долгое нахождение в родильном доме
  • раздельное нахождение мамы и младенца в роддоме
  • искусственное вскармливание
  • применение антибиотиков и некоторых других лекарств
  • раннее введение прикормов и прекращение грудного вскармливания
  • нерациональное питание

Какие анализы можно сдать для выявления дисбиоза:

  • Кал на дисбиоз. До 3 месяцев идет активное заселение кишечника, микрофлора меняется каждый день, анализ будет готов через 7–10 дней, значит, говорит о прошлом состоянии, не о сегодняшнем. Можно по нему назначать какое-либо лечение? Нет, поэтому до 3 месяцев не рекомендуют проводить это исследование. Но после 3 месяцев микрофлора становится более или менее постоянной, и если исследование проводилось не один, а 2–3 раза, то можно более уверенно говорить об устойчивом нахождении каких-либо «нежелательных» нам бактерий.
  • Копрограмма – показывает нарушения характера пищеварения: своевременно ли и в достаточном ли количестве выделяется желчь и секрет поджелудочной железы.
  • Газо-жидкостная хроматография и молекулярно-генетическое исследование фекалий показывают истинное состояние микрофлоры, ее полный количественный и качественный состав (в том числе тонко-кишечный и тот, который невозможно вырастить вне человека), энтеротип человека. Проводится в нескольких НИИ в мире, в широком применении будет только в ближайшие 5–10 лет.

Можем ли мы как то повлиять на количество и качество микробиоты? Даже учитывая, что мы, на сегодняшний день, не знаем большинства «наших» бактерий, но все же можем многое сделать, особенно, для младенца. У всех детей первого полугодия 98-99 % микрофлоры — это бифидо- и лактобактерии, значит, надо обеспечить их достаточное количество и качество их жизнедеятельности. Задача эта очень сложная. Почему? Эти бактерии очень нежные, могут жить и хорошо работать в определенных условиях. Например, при наличии лактазной недостаточности в кишечнике неблагоприятная среда, а бифидо- и лактобактерии не могут ни жить, ни работать в такой среде. С введением прикормов изменяется характер пищи, требуются другие бактерии, происходит заселение кишечника новыми видами. Кстати тут сразу встает вопрос: когда вводить прикорм, какой? Есть определенные рекомендации, даже национальная программа вскармливания по рекомендациям ВОЗ (Всемирная организация здравоохранения), но решение принимается в каждом случае индивидуально!

Получается, мы живем в океане микробов, и только так мы можем жить. Если мы хотим жить долго и здорово, мы должны заботиться о них. Лечение — это одно, а постоянное поддержание здоровья — это другое. Нет никакой волшебной таблетки, никаким однократным курсом лечения с дисбиозом не справиться! Курсы биопрепаратов (разные, в разное время, разные детям и взрослым), рациональное питание, иногда в помощь лекарственные препараты, и всё — только по рекомендации врача!

Дисбиоз кишечника и обнаружение «живых кишечных бактерий» в крови японских пациентов с сахарным диабетом 2 типа

Реферат

ЦЕЛЬ Растущее количество данных указывает на то, что микробиота кишечника является важным модификатором ожирения и диабета. Однако до сих пор нет информации о кишечной микробиоте и «живых кишечных бактериях» в системном кровотоке японских пациентов с диабетом 2 типа.

ДИЗАЙН И МЕТОДЫ ИССЛЕДОВАНИЯ Используя чувствительный метод количественной ПЦР с обратной транскрипцией (RT-qPCR), мы определили состав микробиоты фекального кишечника у 50 японских пациентов с диабетом 2 типа и 50 контрольных субъектов, а также его связь с различными клиническими проявлениями. параметры, включая маркеры воспаления.Мы также проанализировали наличие кишечных бактерий в образцах крови.

РЕЗУЛЬТАТЫ Подсчеты группы Clostridium coccoides , кластера Atopobium и Prevotella (облигатные анаэробы) были значительно ниже ( P <0,05), в то время как количество всего Lactobacillus (факультативно анаэробных бактерий) было значительно ниже. ) были значительно выше ( P < 0,05) в образцах кала больных диабетом, чем в образцах контрольной группы.В частности, количество подгрупп Lactobacillus reuteri и Lactobacillus plantarum было значительно выше ( P <0,05). Кишечные бактерии обнаруживались в крови у пациентов с диабетом значительно чаще, чем у контрольных субъектов (28% против 4%, P < 0,01), и большинство этих бактерий были грамположительными.

ВЫВОДЫ Это первое сообщение о дисбактериозе кишечника у японских пациентов с диабетом 2 типа по оценке с помощью RT-qPCR.Большое количество кишечных бактерий в кровообращении предполагает перемещение бактерий из кишечника в кровоток.

Введение

Микробиота кишечника необходима для иммунной системы хозяина (1), пищеварения, включая расщепление сложных углеводов, таких как пищевые волокна, и производство органических кислот для поддержания соответствующей среды pH в кишечнике (2) . Изучение микробиоты кишечника быстро прогрессирует, и без преувеличения можно сказать, что внедрение культурально-независимых подходов, основанных на анализе 16S рРНК, привело к смене парадигмы в этой области (2,3).Помимо своего физиологического значения, дисбактериоз кишечника связан с ожирением из-за увеличения доступности богатых калориями продуктов, таких как западная диета (4–6). Вместе с предыдущими данными появилась новая информация о патофизиологической роли микробиоты кишечника и крови в развитии атеросклероза (7–9). Важная концепция роли кишечной микробиоты в инсулинорезистентности была впервые описана Кани и его коллегами (4,10–13). В серии исследований эти исследователи продемонстрировали, что кишечные грамотрицательные бактерии продуцируют липополисахарид (ЛПС), который является хорошо известной провоспалительной молекулой, может перемещаться в кровоток из дырявого кишечника и вызывать метаболическую эндотоксемию, которая связана с ожирением. (4).Более конкретно, диета с высоким содержанием жиров усиливает разрушение белков плотных контактов в кишечнике, таких как zonula occludens-1 и окклюдин, которые участвуют в барьерной функции кишечника на моделях мышей (13). Этот эффект напрямую зависит от микробиоты кишечника, поскольку лечение антибиотиками устраняет индуцированную диетой проницаемость кишечника (4). Вышеупомянутые исследования показывают, что дисбактериоз кишечника и связанная с ним повышенная проницаемость кишечника могут служить факторами окружающей среды для развития ожирения до развития диабета.Хотя данные, полученные на мышах, убедительны, функциональные связи между микробиотой кишечника человека и заболеванием менее понятны из-за различных смешивающих факторов, включая возраст, пол, диету, генетику и расу (14,15).

В Японии оценочное число пациентов с диабетом 2 типа увеличилось до 10,7 миллиона, что является шестым по величине таким населением в мире (16). Однако исследований состава кишечной микробиоты у японских пациентов с диабетом 2 типа на людях не проводилось. Японская диета сильно отличается от западной диеты, и известно, что на микробиоту кишечника влияет тип пищи (6), что позволяет предположить, что микробиота кишечника у японских пациентов с диабетом 2 типа может отличаться от таковой у западных людей.Поэтому важно исследовать состав микробиоты кишечника у японских пациентов с диабетом 2 типа.

Интересно, что Amar et al. (17) сообщили, что диета с высоким содержанием жиров индуцирует бактериальную транслокацию из кишечника в кровоток у людей путем обнаружения бактериальной геномной ДНК, кодирующей 16S рРНК. Однако пока нет доказательств того, что «живые бактерии» перемещаются из кишечника в системный кровоток.

В текущем исследовании мы проанализировали состав микробиоты кишечника и уровни кишечных бактерий в плазме у 50 японских пациентов с диабетом 2 типа и 50 контрольных субъектов путем обнаружения 16S рРНК.Мы также исследовали взаимосвязь между различными клиническими параметрами, приемом пищи и микробиотой кишечника, чтобы определить клиническое значение микробиоты кишечника у японских пациентов с диабетом 2 типа.

Дизайн и методы исследования

Субъекты исследования

Мы набрали японских пациентов с диабетом 2 типа, которые регулярно посещали амбулаторную клинику университетской больницы Джунтендо в период с 2011 по 2012 год, и 50 пациентов согласились принять участие в исследовании. Мы также набрали контрольных субъектов, которые регулярно посещали амбулаторную клинику университетской больницы Джунтендо для лечения гипертонии, дислипидемии или заболеваний щитовидной железы, состояние которых находилось под хорошим контролем, или которые посещали университетскую больницу Джунтендо для плановых медицинских осмотров в период с 2011 по 2012 год.Пятьдесят контрольных субъектов с уровнем HbA 1c <6,0% (42 ммоль / моль) согласились участвовать. Из исследования были исключены пациенты со следующими состояниями: 1 ) пролиферативная ретинопатия; 2 ) возраст ≥80 лет; 3 ) серьезное заболевание печени (уровень аспартатаминотрансферазы и / или аланинаминотрансферазы> 100 МЕ / л) или серьезное заболевание почек (уровень креатинина сыворотки> 2,0 мг / дл; 4 ) острая сердечная недостаточность; 5 ) злокачественная опухоль; 6 ) воспалительное заболевание кишечника; и 7 ) история лечения антибиотиками в течение 3 месяцев после участия в исследовании.Протокол исследования был одобрен Комитетом по этике Университета Джунтендо, и письменное информированное согласие было получено от каждого пациента перед включением в исследование.

Определение количества бактерий с помощью обратной транскрипции, направленной на 16S рРНК — количественная ПЦР

После включения в исследование участников попросили предоставить свежие образцы фекалий. Образцы фекалий помещали непосредственно в две пробирки (∼1,0 г / пробирка) участники или сотрудники больницы; одна пробирка содержала 2 мл РНК позже (раствор для стабилизации РНК; Ambion, Austin, TX), а другая была пуста.Образцы помещали в холодильник при 4 ° C (для анализа фекальной микробиоты) или в морозильную камеру при -20 ° C (для анализа концентрации органических кислот в фекалиях и pH фекалий) в течение 30 минут после выделения. Образцы крови были взяты после ночного голодания в течение 5 дней после сдачи образцов кала. Один миллилитр крови добавляли к 2 мл бактериального реагента RNAprotect (Qiagen, Hilden, Германия) сразу после сбора. Образцы хранили при -80 ° C. Образцы кала и крови при температуре −20 ° C были доставлены в Центральный институт микробиологических исследований им. Якульта.

Для количественной оценки бактерий, присутствующих в образцах, мы экстрагировали фракции общей РНК из фекалий и крови ранее описанным методом (18–21) и исследовали состав кишечной микробиоты и уровни кишечных бактерий в плазме с использованием 16S рРНК- прицельная RT – количественная ПЦР (qPCR) с использованием Yakult Intestinal Flora-SCAN. Три серийных разведения образца экстрагированной РНК использовали для бактериальной рРНК-целевой ОТ-кПЦР (18–21), а значения порогового цикла в линейном диапазоне анализа применяли к стандартной кривой для получения соответствующего количества бактериальных клеток в каждый образец нуклеиновой кислоты.Затем эти данные были использованы для определения количества бактерий в образце. Специфичность анализа RT-qPCR с использованием праймеров, специфичных для группы, рода или вида, определяли, как описано ранее (18–21). Последовательности праймеров перечислены в дополнительной таблице 1.

Измерение органических кислот и pH

Концентрации органических кислот в кале и сыворотке определяли с использованием методов, описанных ранее (21) с небольшими изменениями. Вкратце, замороженный образец гомогенизировали в четырех объемах 0.15 моль / л хлорной кислоты и выдерживают при 4 ° C в течение 12 часов. Суспензию центрифугировали при 20 400 × g при 4 ° C в течение 10 мин. Затем полученный супернатант пропускали через фильтр с размером пор 0,45 мкм (Millipore Japan, Токио, Япония). Образец анализировали на наличие органических кислот с помощью системы высокоэффективной жидкостной хроматографии (детектор проводимости 432; Waters Co., Милфорд, Массачусетс), а pH в кале анализировали с помощью pH / термометра IQ 150 (IQ Scientific Instruments, Inc., Карловы Вары, Калифорния).

Биохимические анализы

Образцы крови были получены после ночного голодания. Липиды сыворотки (общий холестерин [T-CHO], холестерин HDL [HDL-C], холестерин LDL и триглицерид [TG]), уровень глюкозы в крови натощак и HbA 1c измеряли стандартными методами. Уровни в плазме высокочувствительного С-реактивного белка (hs-CRP), интерлейкина-6 (IL-6) и фактора некроза опухоли (TNF) -α были измерены с помощью латексной нефелометрии, иммуноферментного хемилюминесцентного анализа и ELISA в частном порядке. лаборатории (SRL Laboratory, Токио, Япония) соответственно.Уровень в плазме LPS-связывающего белка (LBP) измеряли с помощью набора для ELISA LBP человека (Hycult Biotech, Нидерланды).

Опросник по потреблению пищи

Оригинальный опросник по анамнезу диеты (DHQ) был разработан Sasaki et al. (22) в 1998 г., и его справедливость была подтверждена. Однако на ответ требуется около 45–60 минут. В этом исследовании мы приняли краткий тип самоуправляемого DHQ (BDHQ) (23), потому что BDHQ требует всего ∼15–20 минут, чтобы ответить. Действительность BDHQ также подтверждается, как описано ранее (23).Анкета была заполнена, когда участники посетили больницу, чтобы сдать образцы крови. Это четырехстраничная структурированная анкета для самостоятельного заполнения, в которой оцениваются пищевые привычки за предыдущий месяц. Большинство продуктов питания и напитков были выбраны из списка продуктов, которые очень часто потребляются в Японии, с использованием списка продуктов, который с некоторыми изменениями использовался в Национальном обследовании здоровья и питания Японии. В дополнение к BDHQ участники предоставили дополнительную письменную информацию о частоте употребления определенных продуктов, которые, как известно, влияют на микробиоту кишечника, таких как йогурт и пищевые добавки.

Статистический анализ

Все статистические анализы проводились с использованием пакета статистического программного обеспечения JMP, версия 10.0.2 (Институт SAS, Кэри, Северная Каролина). Данные были выражены как среднее значение ± стандартное отклонение для данных с нормальным распределением и медиана (межквартильный размах) для данных с асимметричным распределением. Для анализа данных использовался тест Манна-Уитни U . Корреляционный анализ Спирмена использовался для определения связи между количеством фекальных бактерий / органических кислот, LBP и клиническими параметрами.Степень обнаружения анализировалась с помощью теста прямой вероятности Фишера. P <0,05 считали статистически значимым.

Результаты

ИМТ и уровень глюкозы в крови натощак, HbA 1c и уровни ТГ были значительно выше в группе диабета 2 типа, чем в контрольной группе, в то время как уровни T-CHO и HDL-C были значительно ниже в группе 2 типа. группу диабета по сравнению с контрольной группой. Кроме того, hs-CRP и IL-6 (представляющие маркеры воспаления) были значительно выше в группе диабета 2 типа, чем в контрольной группе.Не было значительных различий в возрасте и уровне TNF-α между двумя группами (Таблица 1).

Таблица 1

Характеристики субъектов исследования

Расчетное общее потребление энергии согласно опроснику BDHQ составило 1,662 ± 569 и 1,749 ± 521 ккал / день в группе диабета 2 типа и контрольной группе, соответственно. Отношение потребления углеводов к общему потреблению энергии составило 56,1 ± 7,9% в группе диабета и 53,9 ± 6,6% в контрольной группе, а соотношение потребления жиров — 26.8 ± 5,7% и 28,6 ± 5,1% соответственно, а соотношение потребления белка составило 17,1 ± 3,5% и 17,5 ± 3,0% соответственно. Не было значительных различий в потреблении общей энергии, углеводов, жиров и белков между двумя группами. Количество участников, употреблявших йогурт не реже одного раза в неделю, было одинаковым в двух группах (группа диабета 32 участника; контрольная группа 30 участников).

Количество фекальных бактерий существенно не различалось между двумя группами (таблица 2).Однако среди облигатных анаэробов количество группы Clostridium coccoides , кластера Atopobium и Prevotella было значительно ниже ( P < 0,05), а общее количество Lactobacillus среди факультативных анаэробов было значительно ниже. выше ( P < 0,05) в группе диабета по сравнению с контрольной группой. Количество подгрупп Lactobacillus reuteri и Lactobacillus plantarum было особенно значительно выше ( P <0.05).

Таблица 2

Сравнение количества бактерий, органических кислот и pH между контрольными субъектами и пациентами с диабетом 2 типа

Известно, что метформин и ингибиторы α-глюкозидазы влияют на желудочно-кишечную систему. Таким образом, мы исследовали разницу в микробиоте кишечника у пациентов с диабетом, принимавших и не принимавших метформин и ингибиторы α-глюкозидазы. Уровни Enterobacteriaceae (7,5 ± 0,9 [ n = 18] против 6,7 ± 1,1 log 10 клеток / г [ n = 31], P <0.05) и Staphylococcus (4,9 ± 0,9 [ n = 17] против 4,4 ± 0,9 log 10 клеток / г [ n = 30], P <0,05) были значительно выше у пациентов, получавших метформин. Уровень Bifidobacterium (9,7 ± 0,6 [ n = 9] против 9,1 ± 0,8 log 10 клеток / г [ n = 41], P <0,05), всего Lactobacillus (8,3 ± 1,1 [ n = 9] против 6,7 ± 1,4 log 10 клеток / г [ n = 41], P <0.01), Lactobacillus gasseri (7,7 ± 1,1 [ n = 9] по сравнению с 5,8 ± 1,6 log 10 клеток / г [ n = 39], P <0,01) и Enterococcus ( 7,8 ± 1,2 [ n = 9] против 6,3 ± 1,2 log 10 клеток / г [ n = 41], P <0,01) были значительно выше у пациентов, получавших ингибиторы α-глюкозидазы.

Концентрации в кале общих органических кислот ( P < 0,05), уксусной кислоты ( P < 0.01) и пропионовой кислоты ( P < 0,05) были значительно ниже в группе диабета, чем в контрольной группе (таблица 2). Концентрация изовалериановой кислоты в кале была значительно выше ( P < 0,05) в группе диабета, чем в контрольной группе, но концентрации других органических кислот в кале и значения pH существенно не различались между двумя группами. С другой стороны, не наблюдалось разницы между концентрацией органических кислот в крови в группе диабета и в контрольной группе.

Затем мы исследовали связи между различными клиническими параметрами (перечисленными в таблице 1), продуктами питания в BDHQ и фекальными бактериями с низким содержанием в группе диабета. Как показано в Таблице 3, количество клеток C. coccoides в кале отрицательно коррелировало с уровнями hs-CRP ( r = -0,387), потреблением энергии ( r = -0,332), потреблением насыщенных жирных кислот ( r = -0,313) и ИМТ ( r = -0,312). Кроме того, количество фекалий кластера Atopobium отрицательно коррелировало с уровнем hs-CRP ( r = -0.392) и ИМТ ( r = -0,321), и положительно с HDL-C ( r = 0,353). Напротив, количество Prevotella не коррелировало с клиническими параметрами или продуктами питания в BDHQ. Общее количество Lactobacillus , которое было выше в группе диабета, не коррелировало с клиническими параметрами или продуктами питания, перечисленными в BDHQ.

Таблица 3

Корреляция между количеством бактерий в кале, органическими кислотами и различными клиническими параметрами у пациентов с диабетом 2 типа

В таблице 3 также обобщены ассоциации между различными клиническими параметрами, продуктами питания, перечисленными в BDHQ, и органическими кислотами в фекалиях, измененными при типе 2 пациенты с диабетом.Общее количество органических кислот в фекалиях отрицательно коррелировало с потреблением насыщенных жирных кислот ( r = -0,325) и общим потреблением жиров ( r = -0,324) и положительно с потреблением углеводов ( r = 0,281) у пациентов с диабетом 2 типа. . Уровень уксусной кислоты в кале отрицательно коррелировал с потреблением насыщенных жирных кислот ( r = -0,364), общим потреблением жиров ( r = -0,327) и продолжительностью диабета ( r = -0,301) и положительно с потреблением углеводов. ( r = 0.356). Как и уксусная кислота, уровень пропионовой кислоты в кале отрицательно коррелировал с продолжительностью диабета ( r = -0,349) и потреблением насыщенных жирных кислот ( r = -0,311). Высокий уровень изовалериановой кислоты в кале у пациентов с диабетом 2 типа не коррелировал с клиническими параметрами или продуктами питания, перечисленными в BDHQ.

В таблице 4 показана скорость обнаружения рРНК кишечных бактерий в образцах крови. Бактерии были обнаружены у 14 из 50 субъектов в группе диабета, по сравнению только с 2 из 50 субъектов в контрольной группе (28% vs.4%, P < 0,01). Частота обнаружения каждой бактерии в группе диабета 2 типа составляла 14% в группе C. coccoides , 14% в кластере Atopobium , 4% в подгруппе Clostridium leptum , 2% в группе Streptococcus в группе Enterobacteriaceae и 2% в группе Enterobacteriaceae , а уровень обнаружения в контрольной группе составил 2% в группе C. coccoides и 2% в группе Streptococcus . Количество видов бактерий, обнаруженных в образцах крови, было ограничено, и большинство из них были грамположительными анаэробными бактериями, которые, как известно, являются частью комменсальной флоры кишечника, за исключением грамотрицательных бактерий Enterobacteriaceae .Уровни LBP в сыворотке, которые, как известно, играют роль в LPS-опосредованном воспалительном ответе (24), были значительно выше в группе диабета, чем в контрольной группе (12,1 ± 3,7 против 10,5 ± 3,0 мкг / мл, P < 0,05). Более того, в группе диабета уровень LBP показал положительную корреляцию с ИМТ ( r = 0,499, P <0,01), HbA 1c ( r = 0,356, P <0,05), hs- CRP ( r = 0,724, P <0.01), TNF- ( r = 0,313, P <0,05) и IL-6 ( r = 0,595, P <0,01).

Таблица 4

Количество бактерий в образцах крови и уровни LBP

Выводы

Основными результатами настоящего исследования были дисбактериоз кишечника и наличие живых бактерий в крови японских пациентов с диабетом 2 типа. Amar et al. (17) ранее сообщали, что концентрация бактериальных генов в крови (с использованием бактериальной 16S рДНК) может предсказать начало диабета, что впервые указывает на клиническое значение микробиоты крови в развитии диабета 2 типа.Однако анализ бактериальной 16S рДНК не может различить, живы или мертвые бактерии-мишени в кишечнике и крови. По этой причине в текущем исследовании мы использовали RT-qPCR, который может обнаруживать живые бактерии как в кишечнике, так и в крови, поскольку в этом методе используются специфические праймеры, нацеленные на молекулы бактериальной РНК (18). Используя эту технологию, мы определили наличие дисбактериоза кишечника и возможную бактериальную транслокацию из кишечника в кровь у японских пациентов с диабетом 2 типа.

Недавно Larsen et al.(25) идентифицировали наличие дисбактериоза кишечника у датских пациентов с диабетом 2 типа с помощью пиросеквенирования с использованием тегов и количественной ПЦР. Кроме того, Qin et al. (26) сообщили о дисбактериозе кишечника у китайских пациентов с сахарным диабетом 2 типа в исследовании ассоциации на уровне всего метагенома. Методы, использованные в двух вышеупомянутых исследованиях, отличались от методов, использованных в нашем исследовании, и, вероятно, объясняют различия в результатах трех исследований. Однако мы подтвердили некоторые аналогичные результаты у японских пациентов с диабетом 2 типа.Кроме того, количество каловых масс в группе C. coccoides было значительно ниже у пациентов с диабетом 2 типа, что согласуется с результатами Qin et al. (26). Более того, общее количество Lactobacillus в кале было значительно выше у пациентов с диабетом 2 типа, что согласуется с данными, представленными Larsen et al. (25) Причина высокого количества Lactobacillus , пробиотика, в настоящее время не ясна. Поскольку наш метод не позволяет различить врожденные бактерии и бактерии, происходящие из таких продуктов, как йогурт, мы подсчитали количество участников, которые потребляли йогурт, но не обнаружили значительной разницы между двумя группами.Эти результаты предполагают, что высокое количество Lactobacillus в фекалиях отражает высокий уровень врожденных бактерий у пациентов с диабетом 2 типа. Необходимы дальнейшие исследования для изучения роли Lactobacillus при диабете 2 типа.

Сложные углеводы, такие как пищевые волокна, метаболизируются микробиотой толстой кишки до олигосахаридов и моносахаридов и ферментируются до короткоцепочечных жирных кислот, таких как масляная кислота, уксусная кислота и пропионовая кислота (2). Масляная кислота обеспечивает энергией эпителиальные клетки толстой кишки (27).Кроме того, сообщалось, что короткоцепочечные жирные кислоты стимулируют секрецию GLP-1 через рецептор, связанный с G-белком (FFAR2) (28). Таким образом, органические кислоты, продуцируемые кишечной флорой, тесно связаны с получением энергии из рациона и гомеостазом глюкозы инкретиновым гормоном. Интересно, что в нашем исследовании концентрации в кале общей органической кислоты, уксусной кислоты и пропионовой кислоты у пациентов с диабетом 2 типа были значительно ниже, чем у контрольных субъектов, а концентрации в кале уксусной кислоты и пропионовой кислоты отрицательно коррелировали с длительность диабета.Кроме того, органические кислоты в кале способствуют удалению Escherichia coli O -157 (29). Принимая во внимание эту роль органических кислот в кале и наши результаты, низкий уровень органических кислот в кале может быть вредным, вызывая ухудшение гликемического контроля за счет снижения секреции инкретинового гормона после еды и повышения восприимчивости к инфекции у пациентов с диабетом 2 типа (28). , 30).

Наши данные показали, что уровень общих органических кислот в фекалиях тесно коррелирует с потреблением углеводов и отрицательно с общим потреблением жиров и насыщенных жирных кислот.Кроме того, уровни LBP в плазме были значительно выше у пациентов с диабетом 2 типа. Известно, что LBP увеличивается при ожирении и отражает уровень LPS, части стенки грамотрицательных анаэробных бактерий, и связывается с важными рецепторами распознавания структуры клеточной поверхности, называемыми Toll-подобным рецептором (TLR) -4 (31). В группе диабета уровень LBP показал положительную корреляцию с клиническими маркерами, такими как BMI, HbA 1c , hs-CRP, TNF-α и IL-6. Эти результаты частично согласуются с гипотезой Cani et al.(4,13), что диета с высоким содержанием жиров вызывает дисбактериоз кишечника и впоследствии приводит к инсулинорезистентности через LPS-зависимый механизм. В текущем исследовании, хотя высокий уровень бактерий был обнаружен в образцах крови пациентов с диабетом 2 типа, большинство обнаруженных бактерий были грамположительными анаэробными бактериями, которые, как известно, являются частью комменсальной флоры кишечника. В экспериментах на мышах пища с высоким содержанием жиров увеличивала транслокацию живых грамотрицательных бактерий через слизистую кишечника в кровь и брыжеечную жировую ткань, что, в свою очередь, было связано с воспалением слабой степени (32).В одном исследовании (17) среди бактерий, обнаруженных в крови пациентов с сахарным диабетом 2 типа,> 90% бактериальной ДНК принадлежали грамотрицательному типу Proteobacteria . Однако в этом исследовании мы обнаружили повышенный уровень LBP без повышенного уровня грамотрицательных бактерий из кишечника. Возможно, это связано с повышенным уровнем бактерий в других местах, например, в полости рта.

Клиническое значение грамположительной бактериальной транслокации у пациентов с диабетом 2 типа остается неизвестным.В этом отношении важно взаимодействие между липотейхоевой кислотой (LTA) и TLR-2 в продукции цитокинов. LTA, грамположительный компонент бактериальной стенки, связывается с TLR-2 (33). Недавние исследования (34,35) показали, что LTA усиливает экспрессию IL-6 в различных клетках, а наше исследование продемонстрировало наличие высоких уровней IL-6 у пациентов с диабетом 2 типа. Вместе взятые, необходимы дальнейшие исследования для определения значимости транслокации грамположительных бактерий в системном воспалении, выявленном у пациентов с ожирением и диабетом 2 типа.

Текущее исследование имеет определенные ограничения. Во-первых, у контрольных субъектов не проводился пероральный тест на толерантность к глюкозе, чтобы полностью исключить наличие диабета. Следовательно, контрольные субъекты в нашем исследовании нельзя с уверенностью отнести к контрольным субъектам, не страдающим диабетом. Однако уровни HbA 1c у всех испытуемых не превышали 6,0% (42 ммоль / моль). Во-вторых, мы не смогли подтвердить причинно-следственную связь между дисбиозом кишечника и бактериальной транслокацией, потому что наше исследование было кросс-секционным по дизайну.В-третьих, поскольку пациенты с диабетом 2 типа имели избыточный вес или страдали ожирением, нельзя исключать, что дисбактериоз кишечника и бактериальная транслокация были вызваны ожирением. В связи с этим мы разделили пациентов с диабетом на две группы: группу с ожирением (ИМТ ≥25 кг / м 2 ) и группу без ожирения (ИМТ <25 кг / м 2 ). Не было значительных различий в частоте обнаружения бактерий крови. Эти данные подтверждают идею о том, что ожирение не было основной причиной различий. В-четвертых, в нашем исследовании была небольшая выборка.

Хотя эти ограничения следует принимать во внимание, наши результаты могут дать новое понимание патофизиологических механизмов диабета 2 типа. Необходимы дальнейшие крупномасштабные исследования микробиоты кишечника и крови у японских пациентов с диабетом 2 типа.

В заключение, наши результаты продемонстрировали дисбактериоз кишечника и возможную бактериальную транслокацию крови у пациентов с диабетом 2 типа. Следующим шагом в этом протоколе исследования является проведение интервенционных исследований, чтобы выяснить, может ли улучшение дисбактериоза кишечника путем изменения образа жизни или введения пробиотиков снизить уровни маркеров кровообращения и скорость бактериальной транслокации с улучшением гликемического контроля.

Информация о статье

Благодарности. Авторы благодарят Норикацу Юки, Акиру Такахаши и Юкико Кадо из Центрального института микробиологических исследований Якульта, которые помогли с анализом собранных образцов. Авторы также благодарят Джо Мацуока, биостатиста из Центра клинических исследований Высшей школы медицины Университета Дзюнтендо, который дал рекомендации по статистическому анализу.

Двойственность интересов. А.К. получил гонорары за лекции от Kissei Pharma, Sanofi и Takeda Pharmaceutical Co.Ю.Т. получил гонорары за лекции от Takeda Pharmaceutical Co., MSD, Boehringer Ingelheim, Sanofi, Eli Lilly, Novartis Pharmaceuticals и Kissei Pharma. Т. получил гонорары за лекции от MSD, Takeda Pharmaceutical Co. и Eli Lilly. Ю.Ф. получил гонорары за лекции от Novartis Pharmaceuticals и Eli Lilly и исследовательские фонды от Novartis Pharmaceuticals, MSD и Takeda Pharmaceutical Co. T.H. получил гонорары за лекции от MSD, Eli Lilly, Takeda Pharmaceutical Co., Novartis Pharmaceuticals, Dainippon Sumitomo, Novo Nordisk Pharma, Sanofi и Daiichi Sankyo, а также получил средства на исследования от MSD, Eli Lilly, Takeda Pharmaceutical Co., Kowa, Mochida, Sanwakagaku, Novo Nordisk Pharma, Kissei Pharma, Novartis, Boehringer Ingelheim, Tanabe Mitsubishi, Dainippon Sumitomo, Telmo, Sanofi Aventis, Roche, Ono и Daiichi Sankyo. С.Н. и Ю.Ю. получили средства на исследования от Yakult Honsha Co. Ltd. H.W. получил гонорары за лекции от Boehringer Ingelheim, Sanofi, Ono Pharmaceutical Co., Novo Nordisk Pharma, Novartis Pharmaceuticals, Eli Lilly, Sanwakagaku Kenkyusho, Daiichi Sankyo Inc., Takeda Pharmaceutical Co., MSD, Dainippon Sumitomo Pharmaceuticals и Kowa Co.и фонды исследований от Boehringer Ingelheim, Pfizer, Mochida Pharmaceutical Co., Sanofi, Novo Nordisk Pharma, Novartis Pharmaceuticals, Sanwakagaku Kenkyusho, Terumo Corporation, Eli Lilly, Mitsubishi Tanabe Pharma, Daiichi Sankyo Inc., Takeda Pharmaceutical Co., MSD, Shionogi. , Dainippon Sumitomo Pharma, Kissei Pharma и AstraZeneca. О других потенциальных конфликтах интересов, относящихся к этой статье, не сообщалось.

Авторские взносы. J.S. и А.К. исследовал данные, участвовал в сборе данных, анализировал данные, участвовал в обсуждении, а также написал и отредактировал рукопись.F.I., T.Y., H.G., H.A., K.K., M.K., T.S., T.O., Y.T., Y.S., R.Y., T.M., Y.F. и H.F. участвовали в сборе данных и внесли свой вклад в обсуждение. К.Н., Т.Т. и Т.А. разработал исследование, проанализировал данные и отредактировал рукопись. T.H. разработал исследование и внес свой вклад в обсуждение. С.Н. участвовал в обсуждении. Ю.Ю. разработал исследование, участвовал в обсуждении и отредактировал рукопись. H.W. исследовал данные, участвовал в сборе данных, участвовал в обсуждении и редактировал рукопись.А.К. является гарантом этой работы и, как таковой, имеет полный доступ ко всем данным в исследовании и берет на себя ответственность за целостность данных и точность анализа данных.

Предварительное представление. Части этого исследования были представлены в виде тезисов на 73-й научной сессии Американской диабетической ассоциации, Чикаго, Иллинойс, 21–25 июня 2013 г.

  • Получено 2 декабря 2013 г.
  • Принято 28 марта 2014 г.
  • © 2014 Американская диабетическая ассоциация.Читатели могут использовать эту статью при условии, что произведение правильно процитировано, используется в образовательных целях, а не для получения прибыли, и если работа не изменена.

Состав микробиоты кишечника отражает тяжесть заболевания и дисфункциональные иммунные реакции у пациентов с COVID-19

Значение этого исследования

Что уже известно по этому вопросу?

  • SARS-CoV-2 в первую очередь поражает дыхательные пути, однако патофизиологию COVID-19 можно отнести к аберрантным иммунным ответам при избавлении от вируса.

  • Несколько линий доказательств, таких как репликация SARS-CoV-2 в энтероцитах человека, обнаружение вирусов в образцах фекалий и изменение состава кишечной микробиоты у пациентов с COVID-19, предполагают поражение желудочно-кишечного тракта.

  • Обследования кишечной микробиоты COVID-19 ограничены и не изучали связи между кишечным микробиомом и патофизиологией заболевания.

Какие новые выводы?

  • Состав микробиоты кишечника у пациентов с COVID-19 соответствует тяжести заболевания и величине концентраций в плазме некоторых воспалительных цитокинов, хемокинов и маркеров повреждения тканей в крови.

  • У пациентов с COVID-19 были истощены кишечные бактерии с известным иммуномодулирующим потенциалом, такие как Faecalibacterium prausnitzii , Eubacterium rectale и несколько видов бифидобактерий.

  • Дисбиотический состав микробиоты кишечника у пациентов с COVID-19 сохраняется после избавления от вируса.

Значение этого исследования

Как оно может повлиять на клиническую практику в обозримом будущем?
  • Эти данные свидетельствуют о том, что истощение иммуномодулирующих кишечных микроорганизмов способствует тяжелому заболеванию COVID-19.

  • Дисбиотическая микробиота кишечника, которая сохраняется после разрешения болезни, может быть фактором развития стойких симптомов и / или синдромов мультисистемного воспаления, которые возникают у некоторых пациентов после устранения вируса.

  • Поддержка полезных видов кишечника, обедненных COVID-19, может служить новым способом смягчения тяжелых заболеваний, подчеркивая важность управления микробиотой кишечника пациентов во время и после COVID-19.

Введение

Инфекция SARS-CoV-2 вызывает иммунный ответ на элиминацию вируса, но появляется все больше свидетельств того, что аберрантные ответы ответственны за тяжелые исходы и, возможно, другие воспалительные состояния, помимо COVID-19.У пациентов с тяжелым заболеванием наблюдается высокий уровень воспалительных цитокинов и маркеров воспаления в плазме крови, таких как IL 6, 8 и 10, а также C-реактивный белок (CRP) и лактатдегидрогеназа (LDH), что отражает иммунный ответ и повреждение тканей от SARS-CoV-2. инфекция. 1–3 Кроме того, у некоторых пациентов после выздоровления развиваются аутовоспалительные симптомы, наиболее выраженными из которых являются мультисистемный воспалительный синдром и болезнь Кавасаки у детей. 4–6 Некоторые наблюдения предполагают значительное поражение желудочно-кишечного тракта, например, способность SARS- CoV-2 для инфицирования и репликации в энтероцитах тонкого кишечника человека 7, последовательное обнаружение вирусной РНК в образцах фекалий8, 9 и измененный состав микробиоты кишечника у субъектов, инфицированных SARS-CoV-2.10 11 Поскольку желудочно-кишечный тракт является крупнейшим иммунологическим органом в организме, а его резидентная микробиота, как известно, модулирует иммунные ответы хозяина, 12 мы предположили, что микробиота кишечника связана с воспалительными иммунными ответами хозяина при COVID-19. Здесь мы охарактеризовали микробиоту кишечника и иммунный ответ у 100 пациентов с COVID-19 во время госпитализации и до 30 дней после выздоровления, показав, что состав микробиоты кишечника во время госпитализации связан с тяжестью заболевания и концентрациями в плазме нескольких цитокинов и воспалительных маркеров.Более того, состав микробиоты кишечника выздоровевших пациентов оставался значительно измененным по сравнению с людьми, не инфицированными COVID-19, что может иметь важные последствия для будущих проблем со здоровьем, помимо COVID-19.

Материалы и методы

Набор субъектов и сбор образцов

Исследование проводилось в соответствии с Хельсинкской декларацией. Все пациенты дали письменное информированное согласие. Как описано в нашем предыдущем исследовании, 10 пациентов с COVID-19 были набраны из больниц Принца Уэльского и Объединенных христианских больниц в Гонконге в период с февраля по май 2020 года.Эти пациенты были лабораторно подтверждены SARS-CoV-2 с помощью количественной ПЦР с обратной транскрипцией (RT-qPCR), проведенной на мазках из носоглотки, собранных персоналом больницы.13 Субъекты, не относящиеся к COVID-19, были набраны до COVID-19 в рамках Гонконгской Обследование кишечного микробиома популяции проводилось с помощью рекламы14 или контрольных групп, не связанных с заболеванием, из испытаний колоноскопии 15, при этом у субъектов была нормальная колоноскопия (стул был собран за несколько дней до подготовки кишечника). Пациенты с COVID-19 были разделены на четыре группы степени тяжести на основе симптомов, как сообщалось Wu et al .16 Вкратце, пациенты были классифицированы как легкие, если не было рентгенологических признаков пневмонии, умеренные, если пневмония с лихорадкой и симптомами респираторных путей, тяжелые, если частота дыхания ≥30 вдохов в минуту, сатурация кислорода ≤93% при вдыхании окружающим воздухом или PaO2 / FiO2 ≤300 мм рт. Ст., Критическое, если дыхательная недостаточность требует искусственной вентиляции легких или органная недостаточность, требующая интенсивной терапии. Кровь и стул у госпитализированных пациентов собирались персоналом больницы, в то время как выписанные пациенты предоставляли стул в день наблюдения или самостоятельно брали пробы дома.Стул собирали в пробирки, содержащие консерванты (каталожный номер 63700, Norgen Biotek Corp, Онтарио, Канада), и хранили при -80 ° C до обработки. Ранее мы показали, что состав кишечной микробиоты, полученный из стула, собранного в этой консервативной среде, был сопоставим с результатами, полученными при немедленном замораживании при -80 ° C.17

Экстракция ДНК стула и секвенирование

Подробные методы описаны в Zuo et al .10 Вкратце, ДНК экстрагировали из 0.1 г гомогенизированных образцов фекалий с использованием набора Maxwell RSC PureFood GMO and Authentication Kit и платформы экстракции нуклеиновых кислот Maxwell RSC Instrument (Promega, Висконсин, США) в соответствии с инструкциями производителя. Библиотеки секвенирования получали из выделенной ДНК с использованием набора Nextera DNA Flex Library Prep Kit (Illumina, Калифорния, США) и секвенировали на системе Illumina NovaSeq 6000 (2 × 150 п.н.) в Центре исследований кишечной микробиоты Китайского университета Гонконга. Необработанные данные о последовательностях, созданные для этого исследования, доступны в архиве чтения последовательностей под регистрационным номером PRJNA650244 BioProject.

Обработка данных последовательностей, определение состава кишечной микробиоты и статистический анализ

Необработанные данные последовательностей были качественно отфильтрованы с помощью Trimmomatic V.39 для удаления адаптеров и низкокачественных последовательностей. После этого профили состава микробиоты были выведены из предварительных чтений с фильтрацией качества с использованием MetaPhlAn218 V.2.7.7 с базой данных V.20. Подсчет участков с разбивкой по видам и таблицы относительной численности были введены в R19 V.3.5.1 для статистического анализа. Для визуализации кластеризации образцов на основе их композиционных профилей на уровне видов.Связь между составом кишечного сообщества и параметрами пациентов оценивалась с помощью пермутационного многомерного дисперсионного анализа (PERMANOVA) и анализа Прокруста. Связи конкретных видов микробов с параметрами пациента были идентифицированы с использованием статистических структур линейного дискриминантного анализа (LEfSe) и многомерного анализа с помощью линейных моделей (MaAsLin), реализованных в экземпляре Huttenhower Lab Galaxy (http: //huttenhower.sph.harvard. эду / галактика /). Анализ PCA, PERMANOVA и Procrustes реализован в веганском пакете R20 V.2.4–6.

Измерение нагрузки SARS-CoV-2 в образцах стула

Нагрузки вируса SARS-CoV-2 были измерены с помощью RT-qPCR, как описано в Zuo et al. . 10 РНК была извлечена из 0,1 г гомогенизированного стула с использованием вирусной РНК QIAamp. Mini Kit (QIAGEN, Hilden Germany) в соответствии с инструкциями производителя. Последовательности праймера и зонда SARS-CoV-2 были предоставлены Центрами по контролю и профилактике заболеваний США (2019-nCoV_N1-F: 5′-GACCCCAAAATCAGC GAAAT-3 ‘, 2019-nCoV_N1-R: 5′-TCTGGTTACTGCCAGTTGAATCTG-3′ и 2019-nCoV_N1-P: 5’-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3 ‘).Каждая одностадийная реакция RT-qPCR содержала 10 мкл экстрагированной РНК, 4 мкл 1-этапной мастер-смеси TaqMan Fast Virus (Thermo Fisher Scientific, Массачусетс, США) в конечном реакционном объеме 20 мкл. Концентрации праймера и зонда составляли 0,5 мкМ и 0,125 мкМ соответственно. Условия цикла: 25 ° C в течение 2 минут, 50 ° C в течение 15 минут, 95 ° C в течение 2 минут, затем 45 циклов при 95 ° C в течение 15 секунд и 55 ° C в течение 30 секунд. Термоциклирование проводили в системе для ПЦР в реальном времени StepOnePlus (Thermo Fisher Scientific). Значения порога цикла (Ct) были преобразованы в копии вирусной РНК на основе стандартной кривой, построенной из 10-кратных серийных разведений известных копий плазмид, содержащих полный ген N (2019-nCoV_N_Positive Control, Integrated DNA Technologies, США).Образцы считались отрицательными, если значения Ct превышали 39,9 цикла. Предел обнаружения составил 347 копий / мл.

Измерения цитокинов в плазме

Образцы цельной крови, собранные в пробирки, обработанные антикоагулянтом, центрифугировали при 2000 × g в течение 10 мин и собирали супернатант. Концентрации цитокинов и хемокинов измеряли, используя MILLIPLEX MAP Human Cytokine / Chemokine Magnetic Bead Panel — иммунологический мультиплексный анализ (Merck Millipore, Массачусетс, США) на системе Bio-Plex 200 (Bio-Rad Laboratories, Калифорния, США).Концентрацию натрийуретического пептида N-конца мозга (NT-proBNP) измеряли с использованием наборов ELISA для человеческого NT-proBNP (Abcam, Кембридж, Великобритания).

Участие пациентов и общественности

Пациенты или общественность не участвовали в разработке, проведении, составлении отчетов или планах распространения данного исследования.

Результаты

Когорта пациентов с COVID-19

В период с февраля по май 2020 года мы собрали образцы крови и стула у 100 пациентов с COVID-19, подтвержденных положительным результатом ОТ-КПЦР на SARS-CoV-2.Демографические и клинические характеристики этих пациентов и контрольной группы из 78 взрослых, не зараженных COVID-19, набранных в Гонконге до COVID-19, представлены в таблице 1. Было 47 женщин и 53 мужчин с COVID-19 со средним возрастом ± SD. 36,4 ± 18,7 года. Критическое, тяжелое, среднетяжелое и легкое заболевание16 наблюдалось у 3,0%, 5,0%, 45,0% и 47,0% пациентов соответственно. Для сравнения, когорта без COVID-19 состояла из 45 женщин и 33 мужчин со средним возрастом ± SD 45,5 ± 13,3 года. Сопутствующие заболевания в когорте COVID-19 включали гипертензию, гиперлипидемию, диабет и сердечные заболевания, хотя у каждого было менее пяти пациентов, за исключением гипертонии с 11.Для когорты, не связанной с COVID-19, гипертония была единственным серьезным сопутствующим заболеванием у 11 человек. Из 100 пациентов с COVID-19 41 предоставил несколько образцов стула во время их пребывания в больнице и / или последующего наблюдения после выписки; 34 и 46 пациентов получали антибиотики и противовирусные препараты, соответственно, до сбора стула.

Таблица 1

Характеристики когорт COVID-19 и не-COVID-19

Измененный состав микробиоты кишечника у пациентов с COVID-19

Всего было секвенировано 274 образца стула, в среднем 6.8 Гбит (47 386 950 чтений) на образец. Во-первых, мы сравнили состав кишечной микробиоты первых образцов стула каждого пациента с COVID-19, собранных во время госпитализации (n = 87; 13 из 100 пациентов с COVID-19 испражнялись только после выздоровления) (40 женщин против 47 мужчин, 35,6 ± 18,8 лет (среднее значение ± стандартное отклонение)) с субъектами, не связанными с COVID-19 (от 45 женщин до 33 мужчин, возраст 45,5 ± 17,4 года (среднее ± стандартное отклонение)), чтобы оценить, изменился ли состав кишечной микробиоты в этой когорте COVID-19. На уровне филума представители Bacteroidetes были относительно многочисленнее среди пациентов с COVID-19 по сравнению с людьми, не связанными с COVID-19 (в среднем 23.9% по сравнению с 12,8%, p <0,001, тест Манна-Уитни), тогда как актинобактерий были более многочисленны у лиц, не инфицированных COVID-19 (26,1% против 19,0%, p <0,05, тест Манна-Уитни) (рисунок 1A). ). На уровне видов мы выявили значительную связь с заболеванием (COVID-19 против COVID-19) и антибиотиками (рис. 1B) (p <0,05, PERMANOVA), но не с нагрузкой SARS-CoV-2 стулом, противовирусными препаратами (лопинавир / ритонавир). , рибавирин или осельтамивир у 39 из 87 пациентов), использование кортикостероидов и ингибиторов протонной помпы (онлайн-дополнительная таблица S1).Без контроля использования антибиотиков, различия в составе кишечной микробиоты COVID-19 в основном были вызваны обогащением видов, включая Ruminococcus gnavus , Ruminococcus Torques и Bacteroides dorei и истощение Bifidobacterium adolescentis falescentis , и Eubacterium rectale (p <0,05, LEfSe) (таблица 2, дополнительная таблица S2 онлайн). Когда изучали эффекты антибиотиков, различия между когортами были в первую очередь связаны с обогащением таксонов, таких как Parabacteroides , Sutterella wadsworthensis и Bacteroides caccae и истощение Adlercreutzia equolifaciens , Dorea formicigenera -19 по сравнению с не COVID-19 (p <0.05, MaAsLin) (онлайн-дополнительная таблица S3), хотя средняя относительная численность большинства затронутых таксонов в этих образцах составляла менее 0,1%. В то время как общий состав кишечной микробиоты отличался между 87 пациентами с COVID-19 и 78 пациентами без COVID-19, не было значительных различий в видовом богатстве и разнообразии Шеннона (p> 0,05, тест Манна-Уитни) (дополнительный рисунок S1 онлайн). В когорте COVID-19 состав микробиоты кишечника, отобранный во время госпитализации (n = 87), был наиболее значимо связан с тяжестью заболевания (легкая, умеренная, тяжелая, критическая), за которой следовали антибиотики с убывающей силой эффекта (p <0.05, ПЕРМАНОВА) (онлайн-дополнительная таблица S1). При идентификации видов микробов, связанных с серьезностью заболевания, мы обнаружили, что F. prausnitzii и Bifidobacterium bifidum отрицательно коррелировали с тяжестью после поправки на использование антибиотиков и возраст пациентов (p <0,05, порядковая регрессия). Относительная численность нескольких других видов микробов, обычно присутствующих в кишечнике человека, включая B. adolescentis и E. rectale , также снижалась с увеличением тяжести заболевания, хотя это не было статистически значимым (онлайн-дополнительная таблица S4).

Рисунок 1

Различия в составе микробиоты кишечника между пациентами с COVID-19 и без COVID-19. (A) Среднее относительное количество микробных типов, обнаруженных в стуле у стационарных пациентов с COVID-19, пациентов, выписанных после отрицательной RT-qPCR на вирусную РНК в мазках из носоглотки, и лиц, не инфицированных COVID-19. (B) Анализ основных компонентов микробиоты кишечника пациентов с COVID-19 с антибиотиками и без них по сравнению с субъектами, не инфицированными COVID-19.Закрашенные кружки представляют первые образцы стула (если доступны серийные образцы) пациентов в больнице, тогда как крестики представляют субъектов, не инфицированных COVID-19. Центроиды групп обозначены метками групп.

Таблица 2

Виды бактерий, ассоциированные с пациентами с COVID-19 во время госпитализации

Концентрации воспалительных цитокинов, хемокинов и маркеров повреждения тканей в плазме коррелируют с составом микробиоты кишечника

При инфекции COVID-19 иммунная система вырабатывает воспалительные цитокины в ответ на вирусная инфекция.В некоторых случаях воспалительная реакция может быть чрезмерно агрессивной (например, «цитокиновый шторм») и приводить к широко распространенному повреждению тканей, септическому шоку и полиорганной недостаточности.1 На основании наблюдения, что микробиота кишечника изменяется у пациентов с COVID-19 ( рисунок 1) и ассоциации нескольких видов с тяжестью заболевания (онлайн-дополнительная таблица S4), мы предположили, что эти композиционные изменения играют роль в обострении заболевания, способствуя нарушению регуляции иммунного ответа. Визуализация состава кишечной микробиоты в когорте из 87 пациентов с COVID-19 во время госпитализации выявила континуум в группах легкой, средней, тяжелой и критической степени тяжести заболевания (рисунок 2), что указывает на стратификацию состава кишечной микробиоты, связанную с серьезностью заболевания.Затем мы сопоставили плазменные концентрации цитокинов (измеренные при поступлении; в среднем за 2 дня до образцов стула) и маркеры воспаления на PCA и наблюдали, что лиганд 10 мотива CXC (CXCL10), IL-10, фактор некроза опухоли-α (TNF-α) , аспартатаминотрансфераза (AST), гамма-глутамилтрансфераза (GGT), CRP, LDH, NT-proBNP и скорость оседания эритроцитов были значительно связаны с составом микробиоты (рисунок 2) (p <0,05, анализ Прокруста). Примечательно, что эти измерения увеличились одновременно с составом микробиоты, представляющим более тяжелые болезненные состояния.Поскольку CXCL10, IL-10, TNF-α, AST, GGT, CRP, LDH и NT-proBNP обычно повышены при более тяжелой форме COVID-19,2 21–23, эти результаты предполагают, что состав кишечной микробиоты связан с величиной иммунного ответа. ответ на COVID-19 и последующее повреждение тканей и, таким образом, может играть роль в регулировании тяжести заболевания. Затем мы оценили, какие конкретные виды, обогащенные или истощенные у пациентов с COVID-19, коррелируют с концентрациями цитокинов. Из списка наиболее распространенных видов в таблице 2 шесть видов, истощенных в когорте COVID-19, отрицательно коррелировали с CXCL10, пять - с IL-10 и по два - с TNF-α и лигандом 2 мотива CC (CCL2) (рис. 3A– D) (p <0.05, корреляция Спирмена). К ним относятся B. adolescentis , E. rectale и F. prausnitzii , которые, как известно, играют иммуномодулирующую роль в системе желудочно-кишечного тракта человека24–26. И наоборот, два вида, обогащенные в когорте COVID-19 B. dorei и Akkermansia muciniphila положительно коррелировали с IL-1β, IL-6 и лигандом 8 мотива CXC (CXCL8) (рис. 3E – G). Корреляции с другими относительно менее многочисленными кишечными бактериями показаны в дополнительной онлайн-таблице S5).

Рисунок 2

Связь между составом микробиоты кишечника госпитализированных пациентов с COVID-19 и концентрацией воспалительных цитокинов и маркеров воспаления в плазме крови. (A) Анализ основных компонентов (PCA) состава кишечной микробиоты и ассоциации с плазменными концентрациями цитокинов / хемокинов. (B) PCA состава микробиоты кишечника и связь с маркерами воспаления крови. Статистические корреляции определяли с помощью тестов Прокруста. Показаны только цитокины и маркеры воспаления, достоверно коррелирующие с составом микробиоты кишечника.Красные стрелки представляют градиенты соответствующих концентраций цитокинов / маркеров воспаления и указывают направление наибольшего увеличения этих показателей. Цвет кружков представляет группы тяжести заболевания, а эллипсы представляют стандартное отклонение центроида группы. Центроиды групп обозначены метками групп. AST, аспартатаминотрансфераза; CRP, C-реактивный белок; СОЭ, скорость оседания эритроцитов; GGT, гамма-глутамилтрансфераза; ЛДГ, лактатдегидрогеназа; NT-proBNP, натрийуретический пептид N-конца мозга; TNF, фактор некроза опухоли.

Рисунок 3

Корреляции между обогащенными / истощенными COVID-19 кишечными микробными таксонами и концентрациями в плазме (A) CXCL10, (B) IL-10, (C) TNF-α, (D) CCL2, (E) CXCL8, (F ) ИЛ-1β и (G) ИЛ-6. Показаны только статистически значимые корреляции. Линии линейной регрессии показаны на каждом графике разброса синим цветом, а заштрихованные области представляют 95% доверительных интервалов. CCL, лиганд мотива C-C; CXCL, лиганд мотива C-X-C; TNF, фактор некроза опухоли.

Дисбактериоз кишечной микробиоты сохраняется после устранения SARS-CoV-2

Поскольку некоторые пациенты с COVID-19 сообщают о стойких симптомах после выздоровления и / или впоследствии у них развивается мультисистемное воспаление, 27 мы предположили, что дисбиотическая микробиота кишечника наблюдается у пациентов с COVID- 19 сохраняется после выздоровления и может способствовать возникновению этих состояний.Для оценки состава кишечной микробиоты после выздоровления от COVID-19 было взято 42 образца стула у 27 пациентов (от 13 женщин до 14 мужчин, возраст 45,6 ± 17,6 лет (среднее ± стандартное отклонение)) в течение 30 дней (в среднем 6 дней, IQR 14 дней. ) после того, как их аспираты или мазки из носоглотки дали отрицательный результат на SARS-CoV-2 с помощью RT-qPCR. По сравнению с субъектами, не инфицированными COVID-19, состав кишечной микробиоты 27 выздоровевших пациентов оставался значительно различающимся независимо от того, получали ли они антибиотики (p <0,05, PERMANOVA) (14 получали антибиотики, 13 - нет), хотя состав у пациентов, у которых был получавшие антибиотики были более разными по сравнению с пациентами, не получавшими COVID-19, чем пациенты, которые этого не делали (рисунок 4).Микробиота кишечника выздоровевших пациентов была обогащена видами, включая Bifidobacterium dentium и Lactobacillus ruminis , независимо от того, получали ли они антибиотики и были ли они истощены в E. rectale , R. bromii , F. prausnitzii и Bifumidobacterium (p <0,05, LEfSe) (таблица 3; онлайн-дополнительная таблица S6). Чтобы определить, были ли антибиотики связаны с улучшением исходов заболевания у пациентов с COVID-19, мы изучили их использование в когорте умеренных заболеваний, в которой количество пациентов, которые получали / не получали антибиотики, было сопоставимым (21 из 45 пациентов с умеренным заболеванием получали антибиотики. ).Представленность при других болезненных состояниях была менее сбалансированной (таблица 1). Мы не обнаружили разницы в количестве дней от появления симптомов COVID-19 до выписки из больницы с антибиотиками или без них (p> 0,05, тест Манна-Уитни). Кроме того, поскольку не было записей о бактериемии или посевах крови у 45 пациентов и у всех, кроме одного, уровень прокальцитонина во время госпитализации был <0,2 нг / мл, эти результаты показали, что антибиотики вряд ли будут связаны с улучшением результатов лечения пациентов, если предположить, что бактериальных коинфекций нет, но нет. контраст может усугубить и продлить дисбактериоз кишечной микробиоты у пациентов с COVID-19.

Рисунок 4

Анализ основных компонентов микробиоты кишечника у выздоровевших пациентов с COVID-19, которые получали или не получали антибиотики, по сравнению с субъектами, не инфицированными COVID-19. Пациенты считались выздоровевшими после отрицательных количественных тестов ПЦР с обратной транскрипцией (RT-qPCR) на РНК SARS-CoV-2 в мазках из носоглотки. Закрашенные кружки представляют собой весь стул, собранный после выписки из больницы, а крестики представляют субъектов, не инфицированных COVID-19.

Таблица 3

Виды бактерий, ассоциированные с пациентами с COVID-19 после выздоровления

Обсуждение

Патофизиология инфекции SARS-CoV-2 характеризуется агрессивными воспалительными реакциями, которые в значительной степени участвуют в возникновении полиорганной дисфункции, наблюдаемой у некоторых пациентов. и, таким образом, серьезность заболевания, вероятно, связана не только с вирусной инфекцией, но и с иммунными реакциями хозяина.1 21 28–30 Здесь мы показываем, что состав микробиоты кишечника пациентов с COVID-19 во время госпитализации коррелирует с концентрациями в плазме нескольких цитокинов, хемокинов и маркеров воспаления, предполагая, что микробиота кишечника может играть роль в модуляции иммунного ответа хозяина и потенциально влияют на тяжесть заболевания и исходы. В частности, истощение нескольких видов бактерий в когорте COVID-19 было связано с повышенными концентрациями TNF-α, CXCL10, CCL2 и IL-10 в соответствии с иммунологическими исследованиями пациентов с COVID-19,2, указывающими на то, что эти истощенные таксоны могут иметь роль в предотвращении чрезмерно агрессивного воспаления.В подтверждение этого вывода, истощенные кишечные комменсалы, такие как B. adolescentis , F. prausnitzii , E. rectale , R . ( Blautia ) obeum и D. formicigenerans были по отдельности связаны со снижением воспалительной реакции хозяина при других связанных с воспалительными заболеваниях. 24–26 Например, было показано, что F. prausnitzii индуцирует прайминг толстой кишки человека. регуляторные Т-клетки, которые секретируют противовоспалительный цитокин IL-10,31, имеют высокое относительное количество E.rectale в кишечнике связаны с уменьшением воспаления при болезни Альцгеймера 32 и B. adolescentis может подавлять активацию ядерного фактора κB, который способствует экспрессии провоспалительных цитокинов.33 Кроме того, обогащение Ruminococcus gnavus , Ruminococcus Torques , Bacteroides dorei и Bacteroides vulgatus при COVID-19 также согласуется с выводом о микробной иммунной дисрегуляции. Р.gnavus и R. крутящие моменты в кишечнике, как сообщается, одновременно возникают с воспалительным заболеванием кишечника, 34 35 и B. dorei и B. vulgatus вовлечены в несколько воспалительных заболеваний кишечника, таких как заболевание раздраженного кишечника и язвенный колит.36 Однако остается неизвестным, действительно ли ассоциированные с воспалительным процессом кишечные микроорганизмы, обогащенные COVID-19, играют активную роль в заболевании или просто развиваются оппортунистически из-за истощения других кишечных микроорганизмов.

Потенциальная роль кишечных микроорганизмов в COVID-19 может позволить использовать профиль риска на основе микробиома для выявления лиц, подверженных риску тяжелого заболевания или последующих воспалительных симптомов, таких как мультисистемное воспаление и болезнь Кавасаки у детей.4 6 37 По данным нескольких пациентов, опрошенных в этом исследовании в течение 30 дней после излечения от SARS-CoV-2, микробиота кишечника, вероятно, останется значительно измененной после выздоровления от COVID-19. В свете сообщений о том, что подгруппа выздоровевших пациентов с COVID-19 испытывает стойкие симптомы, такие как усталость, одышка и боли в суставах, у некоторых более чем через 80 дней после первоначального появления симптомов 27, 38, 39 мы полагаем, что дисбиотический микробиом кишечника может способствовать иммунной системе. -связанные с проблемами здоровья после COVID-19.Наш короткий период наблюдения не позволяет экстраполировать состав кишечной микробиоты на долгосрочные стойкие симптомы. Таким образом, необходимо более длительное наблюдение за пациентами с COVID-19 (например, от 3 месяцев до 1 года после устранения вируса), чтобы ответить на вопросы, связанные с продолжительностью дисбактериоза кишечной микробиоты после выздоровления, связью между дисбиозом микробиоты и долгосрочным устойчивым заболеванием. симптомы и то, предрасполагает ли дисбактериоз или обогащение / истощение определенных кишечных микроорганизмов выздоровевшим людям к будущим проблемам со здоровьем.

Наше исследование имеет несколько недостатков, включая неоднородное клиническое ведение пациентов, которое может искажать микробные сигнатуры, связанные с COVID-19. Для должным образом контролируемого исследования необходима однородная когорта случай-контроль с адекватным представлением в каждой группе тяжести заболевания и минимальной вариабельностью по лечению, хотя эти идеалы могут быть невозможны в реальном мире. Таким образом, неясно, в какой степени состав микробиоты кишечника в результате COVID-19 зависит от клинического ведения.Более того, наблюдаемый состав микробиоты кишечника может быть просто реакцией на состояние здоровья пациентов и иммунное состояние, а не прямым влиянием на тяжесть заболевания, как таковой, он может не иметь прямого отношения к прогнозированию предрасположенности к заболеванию у субъектов, не страдающих COVID-19. Также необходима осторожность при интерпретации результатов лечения пациентов, связанных с применением антибиотиков. Было подсчитано, что от половины до трех четвертей пациентов с COVID-19 получали антибиотики эмпирически, несмотря на то, что менее 7% имели бактериальные инфекции.40 41 Мы не обнаружили разницы в результатах с антибиотиками или без них, что поддерживает призывы к ограничению использования ненужных антибиотиков при ведении пациентов с COVID-19, но наше сравнение ограничивалось пациентами с умеренным заболеванием, поскольку количество пациентов в этой подгруппе было более сопоставимым. Хотя наши данные свидетельствуют о том, что антибиотики не улучшают исходы лечения пациентов, все же возможно, что более частое применение антибиотиков у тяжелых и критических пациентов может усугубить воспаление.42 Наконец, состав кишечной микробиоты очень неоднороден в разных популяциях людей, и изменения в составе, описанные здесь может не обязательно отражаться на пациентах с COVID-19 из других биогеографий.Тем не менее, это исследование изменений микробиоты кишечника в связи с нарушением иммунной регуляции показало, что кишечные микроорганизмы, вероятно, участвуют в модуляции воспалительных реакций хозяина при COVID-19. С растущим количеством доказательств того, что кишечные микроорганизмы связаны с воспалительными заболеваниями в кишечнике и за его пределами, 12 43 эти результаты подчеркивают насущную необходимость понимания конкретной роли кишечных микроорганизмов в иммунной функции человека и системном воспалении.

Заявление об этике

Согласие пациента на публикацию

Не требуется.

Одобрение этики

Это исследование было одобрено Объединенным комитетом по этике клинических исследований Восточного кластера Китайского университета Гонконга (ссылочный номер 2020.076). Письменное информированное согласие было получено от всех участников до сбора образцов стула.

Благодарности

Мы хотели бы поблагодарить всех медицинских работников, работающих в изоляторах больниц Принца Уэльского и Объединенных христианских больниц, САР Гонконг, Китай. Мы благодарим Miu Ling Chin, Apple CM Yeung, Wendy CS Ho, Rity Wong, Vickie Li, Ida MT Chu и других сотрудников / студентов за их технический вклад в это исследование, включая сбор образцов, инвентаризацию и обработку, а также Hui Zhan, Yating Wan, Нан Чен за помощь в извлечении ДНК.

Новое производное фенотиазина активно в отношении Clostridioides difficile и проявляет низкую цитотоксичность

Abstract

Быстрое развитие устойчивости к антибиотикам у Clostridioides difficile и последующее влияние на профилактику и лечение C . Инфекции difficile (ИКД) вызывают озабоченность в области общественного здравоохранения. Тиоридазин, соединение, принадлежащее к группе фенотиазинов, ранее демонстрировало антимикробную активность против C . difficile . Целью настоящего исследования было изучить потенциал нового производного фенотиазина, JBC 1847, в качестве перорального противомикробного средства для лечения кишечных патогенов и ИКД. Минимальная ингибирующая концентрация и минимальная бактерицидная концентрация JBC 1847 против C . difficile ATCC 43255 были определены 4 мкг / мл, и наблюдалась высокая переносимость после перорального введения мышам (до 100 мг / кг массы тела). Фармакокинетическое моделирование проводилось in silico с использованием GastroPlus TM , предсказывая низкое (<10%) системное поглощение после перорального воздействия и соответствующее низкое C max в плазме.Влияние на бактериальный состав кишечника после четырех дней лечения было определено секвенированием 16s рРНК MiSeq и выявило лишь незначительное влияние на микробиоту у неклинически затронутых мышей, и не было никакой разницы между колониеобразующими единицами (КОЕ) / грамм фекального материала. между JBC 1847 и мышами, получавшими плацебо. Цитотоксичность соединения оценивали в анализах клеточной линии Caco-2, в которых не наблюдали признаков токсичности в концентрациях, превышающих минимальную бактерицидную концентрацию до семи раз.В заключение следует отметить, что новое производное фенотиазина продемонстрировало высокую антимикробную активность в отношении C . difficile , имела низкую прогнозируемую желудочно-кишечную абсорбцию, низкую кишечную ( in vitro ) цитотоксичность и вызывала только незначительные изменения здоровой микробиоты, в целом подтверждая, что JBC 1847 может представлять собой новый кандидат в противомикробные препараты. Клиническая важность этого требует будущих экспериментальных исследований на моделях CDI.

Образец цитирования: Ronco T, Aragao FM, Saaby L, Christensen JB, Permin A, Williams AR, et al.(2021) Новое производное фенотиазина активно против Clostridioides difficile и демонстрирует низкую цитотоксичность. PLoS ONE 16 (10): e0258207. https://doi.org/10.1371/journal.pone.0258207

Редактор: Pradeep Dudeja, Иллинойский университет в Чикаго, США

Поступило: 1 июня 2021 г .; Принята к печати: 21 сентября 2021 г .; Опубликовано: 1 октября 2021 г.

Авторские права: © 2021 Ronco et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в рукописи и ее файлах с вспомогательной информацией.

Финансирование: JBC и RHO получили грант от Innovationfund Denmark (9122-0074B) (веб-сайт: https://involutionsfonden.com).dk / en) и пионерский грант фонда Novo Nordisk (NNF20OC0066116), (веб-сайт: https://novonordiskfonden.dk/da/). Спонсоры не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовка рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Clostridium difficile , недавно классифицированная как Clostridioides difficile , представляет собой грамположительный анаэробный патоген, признанный основной причиной диареи, связанной с антибиотиками в здравоохранении [1].Антибиотики, используемые для лечения всех видов инфекций, потенциально могут способствовать развитию C . Инфекция difficile (CDI) [2, 3]. После антибактериальной терапии защитная кишечная микробиота нарушается, позволяя проглотить или резидентно C . difficile для (ре) колонизации желудочно-кишечного тракта и заражения хозяина. Устойчивость к антибиотикам позволяет C . difficile для роста в присутствии лекарств, поэтому штаммы, устойчивые к нескольким агентам, могут иметь селективное преимущество для их распространения от использования этих антибиотиков [4, 5].Во всем мире CDI представляют собой серьезную проблему для общественного здравоохранения, а ранее — C . difficile считается наиболее распространенным патогеном, связанным с оказанием медицинской помощи, в США [3, 6]. Соответственно, CDC анонсировала C . difficile в качестве основного патогена [7] и в настоящее время входит в список пяти бактериальных патогенов, для которых срочно необходимы новые противомикробные препараты (https://www.cdc.gov/cdiff/index.html).

Фенотиазины, группа медицинских соединений, предназначенных для лечения психических расстройств, также обладают антимикробной активностью в отношении C . difficile и другие грамположительные возбудители [8, 9]. Ранее мы синтезировали производное фенотиазина (промазина), JBC 1847, которое, как было показано, значительно снижает минимальную ингибирующую концентрацию (МИК) против метициллин-устойчивого Staphylococcus aureus (MRSA) по сравнению с исходным соединением, промазином [10]. Кроме того, новое соединение не проникает через гематоэнцефалический барьер (ГЭБ) [10] в отличие от исходных фенотиазинов, которые быстро становятся системно доступными после перорального приема [11] и легко проходят через ГЭБ [12].Целью настоящего исследования было определение антимикробной активности JBC 1847 против C . difficile и для оценки кишечной цитотоксичности, пероральной переносимости и in vivo воздействия на кишечную микробиоту (видовой состав и количество бактерий) соединения. В целом, исследования дадут представление о потенциале JBC 1847 как кандидата для будущей пероральной антимикробной терапии против кишечных патогенов.

Материалы и методы

Характеристики соединений и бактериальные штаммы

JBC 1847 был синтезирован в Копенгагенском университете, Дания, как описано ранее, и о первоначальных исследованиях антимикробных и физико-химических свойств JBC 1847 сообщалось [10].В этом исследовании использовалась усовершенствованная модель отсеков и транзита (ACAT) с использованием программного обеспечения GastroPlus TM (Simulations Plus, Inc., Ланкастер, Калифорния). Эта модель включает физико-химические (т.е. растворимость и проницаемость), физиологические (т.е. региональный pH и время прохождения по желудочно-кишечному тракту) и фармакокинетические (т.е. клиренс и объем распределения) параметры и другие факторы (такие как доза и Р-гликопротеин. [Pgp] данные о субстрате) для прогнозирования воздействия. Ввод был установлен на 100 мг JBC 1847 в форме таблеток, вводимых человеку весом 70 кг.

С . difficile ATCC 43255, ранее выделенный из раны брюшной полости, использовали для оценки антиклостридиоидной активности JBC 1847. Штамм хранили в усиленной клостридиальной среде (Oxoid, Роскилле, Дания) в 15% глицерине при -80 ° C до использования. и выращивали анаэробно на ChromID® C . Планшеты difficile (bioMérieux, Ballerup, Дания).

Заявление об этике

Все процедуры на животных были выполнены в Statens Serum Institut (SSI), Копенгаген, Дания, и одобрены Датской экспертной комиссией по экспериментам на животных.В SSI есть Комитет по защите животных, который эквивалентен IACUC (Американской ассоциации лабораторных исследований животных) и предоставляет общие рекомендации для всех экспериментов на животных, проводимых в SSI. Поэтому мы заявляем, что все этические принципы и инструкции для экспериментов на животных неукоснительно соблюдаются.

Определение концентраций ингибиторов роста и бактерицидности

МИК JBC 1847 определяли в 96-луночных микротитровальных планшетах с использованием бактериального инокулята ∼ 10 6 Колониеобразующих единиц (КОЕ) / мл C . difficile 43255 и были определены как самые низкие концентрации соединений JBC 1847, которые подавляли видимый рост после 24 часов анаэробной инкубации. Значения минимальной бактерицидной концентрации (МИК) определялись как самые низкие концентрации тестируемых соединений, вызывающие снижение логарифмического уровня исходного инокулята клеток на ≥3 log (~ 10 5 КОЕ / мл в окончательном анализе). Вкратце, 100 мкл из каждой лунки анализа MIC (после инкубации) помещали в планшеты на планшеты ChromID®. После инкубации в течение 24 часов количество жизнеспособных клеток подсчитывали на планшетах ChromID®.И MIC, и MBC были проведены с тремя биологическими повторностями.

Цитотоксичность линии клеток Caco-2 JBC 1847

клеток Caco-2 высевали на проницаемые подложки (T12, Corning cci-3401) и культивировали в течение 21 дня. Среду для культивирования меняли через день как в апикальной, так и в базолатеральной камерах. В день транспортировки клетки уравновешивали до температуры окружающей среды и измеряли трансэпителиальное электрическое сопротивление (TEER) в монослоях клеток.Затем слои клеток дважды промывали добавлением HBSS (0,05% BSA, 10 мМ HEPES) и снова измеряли TEER. Эксперимент по экспонированию был начат с замены дополненного HBSS в апикальной камере растворами HBSS различных концентраций JBC1847.3 (0, 1, 5, 10, 25, 50 и 100 мкМ). После 2-часовой выдержки были взяты образцы для анализа лактатдегидрогеназы (LDH), и клетки дважды промыли в добавленном HBSS и измерили TEER.

Анализ пролиферации клеток (MTS / PMS; [3- (4,5-диметилтиазол-2-ил) -5- (3-карбоксиметоксифенил) -2- (4-сульфофенил) -2H-тетразолий, внутренняя соль; MTS] и анализ реагента электронного связывания (феназинметосульфат) PMS) проводили путем инкубации монослоев клеток Caco-2 с 400 мкл раствора PMS / MTS в апикальном отделении и 500 мкл дополненного HBSS в базолатеральной камере (в соответствии с инструкциями производителя) в течение 60 минут при 37 ° C и круговом вращении (50 об / мин).После инкубации из каждого монослоя отбирали 2 × 100 мкл образцов и определяли оптическую плотность при 492 нм в 96-луночном планшете.

Для анализа активности ЛДГ образцы, взятые из апикального компартмента после эксперимента по экспонированию, разбавляли в 5 раз и анализировали в анализе ЛДГ в соответствии с инструкциями производителя. Вкратце, анализ состоял из смешивания разбавленных образцов с различными реагентами для анализа с последующей инкубацией при комнатной температуре в течение 30 минут и оптической плотности при 492 нм в качестве меры активности LDH.Лизат монослоев Caco-2 (приготовленный суспендированием монослоев клеток Caco-2 в очищенной воде) был включен в качестве положительного контроля для максимального ответа в анализе.

Доза множественной токсичности для мышей

После завершения первоначального in vitro и скрининга токсичности были проведены исследования максимальной переносимой дозы (МПД) JBC 1847. MTD проводился с возрастающими дозами от 5 до 100 мг / кг массы тела (bw). Мышей оценивали по клиническим признакам дискомфорта в течение 4 часов.За мышами интенсивно наблюдали и оценивали по следующим параметрам: «0», если не было признаков клинического дискомфорта; «1», если были незначительные клинические признаки дискомфорта, например более медленные движения, легкая пилоэрекция в коже, легкий вздернутый живот; «2», если были умеренные признаки дискомфорта, например отсутствие любопытства, движения только при нажатии, пилоэрекция в коже, подтянутый живот, «3» явные признаки дискомфорта, например нет движений, пилоэрекция в коже, живот вздернут, глаза зажаты.Когда наблюдался умеренный дискомфорт, мышей умерщвляли, и дозу считали непереносимой. Мышам, у которых не было клинических показателей в течение 4 часов после перорального введения, вводили еще раз ту же дозу. Мышей оценивали еще на 2 часа после последней дозы. Вкратце, ок. За полчаса до введения дозы самкам мышей NMRI, 26-30 грамм (Taconic), перорально вводили 45 мкл нурофена (20 мг ибупрофена / мл, что соответствует примерно 30 мг / кг) в качестве обезболивающего. Дозировка была основана на среднем весе 28 г на мышь.На каждую группу дозирования использовали двух мышей, начиная с самой низкой дозы, и мышей внимательно наблюдали в течение минимум 10 минут, прежде чем перейти к более высокой дозе.

Влияние JBC 1847 на состав микробиома и количество бактерий в образцах фекалий

Исследования MTD (описанные выше) показали, что мыши переносили JBC 1847 в концентрациях до 100 мг / кг м.т. без каких-либо клинических признаков дискомфорта. Кроме того, две дозы 100 мг / кг (вводимые с интервалом в 4 часа) также хорошо переносились всеми обработанными мышами.Чтобы выяснить, было ли влияние JBC 1847 на микробиоту желудочно-кишечного тракта у неклинических мышей, и было ли возможное влияние зависимым от концентрации, было проведено второе исследование на мышах. Три группы лечения (носитель, 20 мг / кг и 100 мг / кг соответственно), каждая из которых состоит из пяти мышей (C57BL / 6, самки в возрасте 5 недель, Taconic), получали лечение один раз в день в течение 4 дней. Мышам вводили через желудочный зонд 0,2 мл JBC 1847 при уровне конечной дозы 20 мг / кг массы тела или 100 мг / кг массы тела или носитель два раза в день.Мышей взвешивали один раз в день и наблюдали за клиническими признаками дискомфорта и умерщвляли при умеренном поражении (оценка 2). Кал собирали перед началом лечения непосредственно от каждой мыши индивидуально. Подстилку в клетках меняли один раз в день после обработки. На 5 день (через день после окончания лечения) фекалии снова собирали, мышей умерщвляли, и весь тонкий кишечник каждой собирали и промывали от содержимого. Эпителиальный слой соскабливали со всей тонкой кишки каждого образца с помощью стерильного предметного стекла и собирали в стерильный контейнер.Образцы фекалий и кишечника перед экстракцией ДНК хранили при -20 ° C.

Экстракция ДНК образца

была выполнена с использованием слегка модифицированной версии стандартного протокола FastDNA Spin kit for Soil (MP Biomedicals, США) со следующими исключениями. 500 мкл образца, 480 мкл натрийфосфатного буфера и 120 мкл буфера MT добавляли в пробирку Lysing Matrix E. Отбивка валика производилась со скоростью 6 м / с в течение 4 × 40 с [13]. Гель-электрофорез с использованием лент Tapestation 2200 и геномной ДНК (Agilent, США) использовали для проверки размера продукта и чистоты подмножества экстрактов ДНК.Концентрацию ДНК измеряли с помощью набора Qubit dsDNA HS / BR Assay (Thermo Fisher Scientific, США).

Для подготовки библиотеки секвенирования, архей и бактерий, библиотеки секвенирования области гена 16S рРНК V4 были подготовлены по индивидуальному протоколу, основанному на протоколе Illumina (Illumina, 2015). До 10 нг экстрагированной ДНК использовали в качестве матрицы для ПЦР-амплификации ампликонов области V4 гена 16S рРНК архей и бактерий. Каждая реакция ПЦР (25 мкл) содержала (12,5 мкл) смеси PCRBIO Ultra и 400 нМ каждой смеси праймеров с прямым и обратным хвостом.ПЦР проводили по следующей программе: начальная денатурация при 95 ° C в течение 2 минут, 30 циклов амплификации (95 ° C в течение 15 секунд, 55 ° C в течение 15 секунд, 72 ° C в течение 50 секунд) и окончательная элонгация при 72 ° C в течение 5 минут. Повторные реакции ПЦР были выполнены для каждого образца, и дубликаты были объединены после ПЦР. Прямой и обратный хвостатые праймеры были разработаны в соответствии с (Illumina, 2015) и содержат праймеры, нацеленные на архей и бактерии, область гена 16S рРНК V4: [515FB] TGYCAGCMGCCGCGGTAA и [806RB] GGACTACNVGGGTWTCTAAT [14] Прикрепление хвостов праймера позволяет Адаптеры Nextera, необходимые для секвенирования в последующей ПЦР.Полученные библиотеки ампликонов очищали с использованием стандартного протокола для гранул CleanPCR SPRI (CleanNA, NL) с соотношением гранул к образцу 4: 5. ДНК элюировали в 25 мкл воды, свободной от нуклеаз (Qiagen, Германия). Концентрацию ДНК измеряли с помощью набора Qubit dsDNA HS Assay (Thermo Fisher Scientific, США). Гель-электрофорез с использованием скринов Tapestation 2200 и D1000 / High Sensitive D1000 (Agilent, США) использовали для проверки размера продукта и чистоты подмножества библиотек для секвенирования. Библиотеки секвенирования получали из очищенных библиотек ампликонов с использованием второй ПЦР.Каждая реакция ПЦР (25 мкл) содержала буфер PCRBIO HiFi (1 ×), полимеразу PCRBIO HiFi (1 ед. / Реакцию) (PCRBiosystems, Великобритания), смесь адаптеров (400 нМ каждого прямого и обратного направления) и до 10 нг библиотеки ампликонов. шаблон. ПЦР проводили по следующей программе: начальная денатурация при 95 ° C в течение 2 минут, 8 циклов амплификации (95 ° C в течение 20 секунд, 55 ° C в течение 30 секунд, 72 ° C в течение 60 секунд) и окончательная элонгация при 72 ° C в течение 5 минут. Полученные библиотеки секвенирования очищали с использованием стандартного протокола для гранул CleanPCR SPRI с соотношением гранул к образцам 4: 5.ДНК элюировали в 25 мкл воды, свободной от нуклеаз. Концентрацию ДНК измеряли с использованием набора Qubit dsDNA HS Assay kit. Гель-электрофорез с использованием лент Tapestation 2200 и D1000 / D1000 с высокой чувствительностью использовался для проверки размера продукта и чистоты подмножества библиотек для секвенирования. Очищенные библиотеки секвенирования объединяли в эквимолярных концентрациях и разбавляли до 2 нМ. Образцы секвенировали по парным концам (2 × 300 п.н.) на MiSeq (Illumina, США) с использованием набора реагентов MiSeq v3 (Illumina, США), следуя стандартным инструкциям по подготовке и загрузке образцов в MiSeq.> 10% контрольная библиотека PhiX была добавлена ​​для решения проблем низкой сложности, которые часто наблюдаются с образцами ампликонов. При биоинформатической обработке прямые и обратные чтения были обрезаны по качеству с помощью Trimmomatic v. 0.32 [15] с настройками SLIDINGWINDOW: 5: 3 и MINLEN: 225. Обрезанные прямые и обратные чтения были объединены с помощью FLASH v. 1.2.7 [ 16] с настройками -m 10 -M 250. Обрезанные чтения были дереплицированы и отформатированы для использования в рабочем процессе UPARSE (Эдгар, 2013). Дереплицированные чтения были кластеризованы с помощью usearch v.7.0.1090 -cluster_otus команда с настройками по умолчанию. Численность OTU оценивалась с помощью команды usearch v. 7.0.1090 -usearch_global с -id 0.97 -maxaccepts 0 -maxrejects 0. Таксономия была назначена с помощью классификатора RDP [17], реализованного в сценарии parallel_assign_taxonomy_rdp.py в QIIME [18] с использованием –Confidence 0.8 и база данных SILVA, выпуск 132 [19]. Вся биоинформатическая обработка выполнялась с помощью RStudio IDE (1.2.1335), работающей под управлением R версии 4.0.2 (2020-06-22) и с использованием пакетов R: ampvis (2.7.0) [13], tidyverse (1.3.0), seqinr (4.2.5), ShortRead (1.46.0) и iNEXT (2.0.20) [20]. Для количественной оценки КОЕ на грамм фекалий, на основе зонда кПЦР широкого диапазона и набора праймеров оценивали количество генов 16S рРНК на нг выделенной ДНК [21]. Вкратце, прямой (5’-TCCTACGGGAGGCAGCAGT-3 ’) и обратный (5’GACTACCAGGGTATCTAATCCTGTT-3’) праймеры использовали для амплификации ампликона qPCR из E . coli MG1655 с использованием ДНК-полимеразы AccuPrime Pfx (Thermo Scientific).ПЦР проводили в соответствии с рекомендациями производителя со следующей программой ПЦР: активация ПЦР (94 ° C, 2 мин) с последующими 30 циклами денатурации (94 ° C, 30 с), отжиг (60 ° C, 30 с) и удлинение (68 ° C, 90 с). с) и окончательное удлинение (68⁰C, 5 мин). Продукт ПЦР очищали на геле E-gel Clone ell (Thermo Scientific) и клонировали в вектор pCR4-TOPO с использованием набора TOPO TA CloningKit для секвенирования (Thermo Scientific) в соответствии с рекомендациями производителя. Полученная плазмида впоследствии линеаризовалась с помощью FastDigest NcoI (Fermentas), затуплялась с использованием фрагмента Кленова (Fermentas).Концентрацию исходного ампликона определяли с использованием набора для анализа дцДНК Qubit HS (Life Technologies), а затем рассчитывали число копий на основе молекулярной массы линеаризованной плазмиды. Исходный ампликон разбавляли до 108 копий / мкл в 10 мМ трис-буфере (pH 8,5) и хранили в виде аликвот при -18 ° C. Измерения образцов qPCR были выполнены в технических дубликатах с использованием системы qPCR Mx3005P (Stratagene) и EXPRESS qPCR Supermix (Life Technologies). Реакции объемом 24 мкл готовили в соответствии с инструкциями производителя с использованием 50 нМ ROX, 500 нМ каждого праймера, 200 нМ гидролизного зонда (6-FAM) -5’-CGTATTACCGCGGCTGCTGGCAC-3 ’- (BHQ-1) и 1 мкл матричной ДНК.Условия реакции qPCR были следующими: инкубация UDG (50 ° C, 2 мин) и активация ПЦР (95 ° C, 2 мин) с последующими 45 циклами денатурации (95 ° C, 15 с) и комбинированным отжигом и удлинением (60 ° C, 1 мин). Стандарты ампликона с концентрацией в диапазоне 103–107 копий / мкл были включены во все циклы КПЦР и использованы для количественной оценки. Была обнаружена четкая логарифмическая корреляция между концентрацией ампликона и значением Cq (R2> 0,99), и эффективность qPCR была приемлемой (> 90%).Все праймеры и зонды очищены с помощью ВЭЖХ (DNA Technology, Дания).

Результаты

JBC 1847 Физико-химические и фармакокинетические свойства

Смоделированные на компьютере (in silico) физико-химические и фармакокинетические свойства 100 мг JBC 1847 были предсказаны в GastroPlus TM .

Общее общее всасывание JBC 1847 прогнозировалось на уровне 6,4%, а региональное всасывание через различные сегменты (желудок, двенадцатиперстную кишку, тощую кишку-1, тощую кишку-2, подвздошную кишку-1, подвздошную кишку-2, подвздошную кишку-3, слепую кишку и восходящую кишку). толстая кишка) отличается от 0–1.5%. Модели предсказывали профили концентрации в плазме и времени JBC 1847 с C max 0,046 мкг / мл, T max 4,32 ч и AUC0-t (мкг / мл-ч / мл) (Таблица 1)

Антимикробная активность по

C . difficile жизнеспособные клетки

MIC JBC 1847 был определен как 4 мкг / мл. Культивирование C . difficile , подвергнутые этой концентрации, не выявила никаких жизнеспособных бактерий; следовательно, МБК равнялся значению МИК 4 мкг / мл.

Цитотоксичность

TEER монослоев клеток Caco-2, подвергнутых воздействию различных концентраций JBC 1847, не выявил снижения значений TEER в монослоях, подвергнутых воздействию JBC1847 в концентрациях до 14.5 мкг / мл (25 мкМ) по сравнению с буферным (отрицательным) контролем (рис. 1).

Рис. 1. Трансэпителиальное электрическое сопротивление JBC 1847.

На рисунке показано трансэпителиальное электрическое сопротивление (TEER), измеренное в монослоях клеток Caco-2 до и после воздействия различных концентраций JBC 1847. Значения на оси x представляют измеренное TEER значения для клеточных монослоев, подвергнутых воздействию либо транспортного буфера, различных концентраций JBC 1847 (0,6 мкг / мл — 58,1 мкг / мл) или очищенной воды.Данные представлены как среднее значение ± стандартное отклонение для трех повторов (n = 3). Измеренное значение TEER после воздействия 29 мкг / мл и вышеупомянутых концентраций было значительно снижено (*) по сравнению с измеренным сопротивлением до воздействия.

https://doi.org/10.1371/journal.pone.0258207.g001

Напротив, измеренные значения TEER по монослоям после 2-часового воздействия 29 мкг / мл (50 мкМ) и 58,1 мкг / мл (100 мкМ). ) были значительно снижены по сравнению со значениями TEER до воздействия (обычный двухфакторный дисперсионный анализ, α = 0.05). Значение TEER, измеренное после воздействия 58,1 мкг / мл, было на уровне лизированных контрольных образцов, что указывает на то, что барьерные свойства для этих монослоев клеток Caco-2 были полностью нарушены.

Из анализа MTS / PMS, который является мерой метаболической активности в клетках, было очевидно, что только монослои клеток Caco-2, подвергшиеся воздействию 58,1 мкг / мл JBC 1847, демонстрировали статистически значимое снижение ответа MTS / PMS (обычное односторонний дисперсионный анализ, α = 0,05) (рис. 2).

Рис 2.Анализ MTS / PMS.

На рисунке показаны результаты анализа MTS / PMS, проведенного на монослоях клеток Caco-2, подвергнутых воздействию либо транспортного буфера, либо различных концентраций JBC 1847 (0,6 мкг / мл — 58,1 мкг / мл). Данные представлены в виде аналитического отклика (значение поглощения при 490 нм) различных образцов относительно среднего отклика, измеренного для буферных контрольных образцов (среднее ± стандартное отклонение). Все образцы были проанализированы в трех экземплярах. Горизонтальная пунктирная линия указывает средний уровень отклика для буферных контрольных образцов (100%).Только ответ.

https://doi.org/10.1371/journal.pone.0258207.g002

Этот результат частично отражает данные TEER, показанные на рис. 1, но за исключением того, что ответ от монослоев клеток Caco-2, подвергнутых воздействию 29 мкг / мл JBC 1847 не был значительно снижен по сравнению с буферными контролями. Однако из фиг. 2 можно увидеть, что ответ от клеточных монослоев, подвергнутых воздействию 29 мкг / мл JBC 1847, по-видимому, немного ниже пунктирной линии, обозначающей ответ от контрольных образцов буфера.

Результаты анализа ЛДГ образцов, взятых с апикальной стороны монослоев клеток Caco-2, подвергнутых воздействию либо дополненного буфера HBSS (буферный контроль), различных концентраций JBC1 8473 или очищенной воды (контроль лизиса клеток, 100% высвобождение ЛДГ) , показали, что образцы из клеток, подвергнутых воздействию 0,0581 мкг / мл (100 мкМ) и 29 мкг / мл (50 мкМ), имели статистически значимое увеличение высвобождения ЛДГ по сравнению с контрольными образцами с буферным раствором (обычный односторонний дисперсионный анализ ANOVA, α = 0,05). (Рис 3).

Рис 3.Анализ ЛДГ.

Анализ ЛДГ проводили на образцах, взятых с апикальной стороны монослоев клеток Caco-2, подвергнутых воздействию либо транспортного буфера, либо различных концентраций JBC 1847 (0,6 мкг / мл — 58,1 мкг / мл) или очищенной воды. Данные представлены в виде отклика анализа (значение поглощения при 492 нм) различных образцов относительно среднего отклика, измеренного для образцов из монослоя клеток Caco-2, подвергнутых воздействию очищенной воды (среднее ± стандартное отклонение). Все образцы были проанализированы в трех экземплярах. Ответы измерены для монослоев клеток Caco-2, подвергнутых воздействию 58.1 мкг / мл и 29 мкг / мл были значительно выше в контрольном буфере в обычном однофакторном дисперсионном анализе.

https://doi.org/10.1371/journal.pone.0258207.g003

Пероральное введение и влияние на микробиоту

В MTD за мышами интенсивно наблюдали и оценивали в соответствии со следующими параметрами, описанными в разделе методов. Одна мышь из 10 льда получила оценку «1» после второй дозы 25 мг / кг. Все оставшиеся мыши получили «0» даже при самой высокой использованной дозе (2 × 100 мг / кг массы тела, вводимых с четырехчасовым интервалом).

Поскольку 100 мг / кг массы тела JBC 1847 хорошо переносились, эта доза была установлена ​​как максимальная в четырехдневном эксперименте по лечению. После четырех дней лечения, распределение видов микробиоты, по-видимому, отличалось только между группой лечения для видов Lactobacillus и Streptococcus , и это изменение было более выраженным в образцах кишечника по сравнению с образцами фекалий. Однако разница не была статистически значимой, скорее всего, из-за ограниченного количества мышей в группе.(Рис. 4 и 5).

Рис. 4. Микробный состав в образцах фекалий.

На рисунке показана тепловая карта 25 наиболее распространенных родов в образцах фекалий, полученных до начала лечения (предварительная обработка) и на следующий день после четырех дней лечения (после лечения). Там, где это возможно, классификация типов OTU предоставляется вместе с родом, и если классификация на уровне родов не может быть получена, дается наименьшая присвоенная таксономическая классификация. Значения показаны как нормализованная доля от общего числа последовательностей (%).

https://doi.org/10.1371/journal.pone.0258207.g004

Рис. 5. Микробный состав в образцах эпителия тонкой кишки (SIE).

На рисунке показана тепловая карта 25 наиболее распространенных родов в образцах эпителия тонкого кишечника. Там, где это возможно, классификация типов OTU предоставляется вместе с родом, и если классификация на уровне родов не может быть получена, дается наименьшая присвоенная таксономическая классификация. Значения показаны как нормализованная доля от общего числа последовательностей (%).

https://doi.org/10.1371/journal.pone.0258207.g005

Среднее количество КОЕ / г фекалий до лечения было определено как 9,6 × 10 9 , 6,2 × 10 9 и 6,6 × 10 9 для группы носителя, группы обработки 20 мг / кг и 100 мг / кг массы тела JBC 1847 соответственно. Значимых изменений в соответствующих числах после лечения не было (4,8 × 10 9 , 4,4 × 10 9 и 6,8 × 10 9 соответственно, p = 0.51).

Обсуждение

Существует острая потребность в новых противомикробных препаратах, чтобы гарантировать, что мы сможем лечить бактериальную инфекцию в будущем [22]. JBC 1847 — это новое синтетическое соединение, которое ранее было доказано как высокоэффективное в снижении бактериальной нагрузки MRSA на модели раны in vivo [10]. Поскольку JBC 1847 не проходит через ГЭБ, было высказано предположение, что он также имеет ограниченное прохождение через эпителиальную выстилку желудочно-кишечного тракта и, следовательно, может использоваться для нацеливания на патогены в желудочно-кишечном тракте, такие как C . difficile . Результаты in silico подтверждают, что системная доступность соединения после перорального введения будет ограничена (таблица 1). MTD также подтвердил, что очень высокая повторная доза JBC 1847 может переноситься без каких-либо клинических проявлений дискомфорта у мышей. Это указывает на то, что концентрация в плазме после перорального введения ограничена до концентрации, меньшей, чем концентрации, связанные с клиническим дискомфортом, что подтверждается предсказанием in silico о максимальной концентрации в плазме, равной 0.046. В тесте на цитотоксичность in vitro концентрации, превышающие МИК в семь раз, не влияли отрицательно на TEER, что указывает на высокую толерантность клеток Caco-2 как среднего значения для эпителиальных клеток кишечника к JBC 1847. Переносимость была даже выше при рассмотрении анализа MTS / PMS, в котором только клетки, подвергшиеся воздействию концентрации 58,1 мкг / мл (100 мкМ) (в 12 раз больше МИК) JBC 1847, показали статистически значимое снижение метаболической активности клеток (рис. 2). Ответ MTS / PMS является общей суррогатной мерой жизнеспособности клеток (метаболической активности), в то время как барьерные свойства монослоя клеток (измеряемые как электрическое сопротивление) и высвобождение ЛДГ отражают более ранние реакции на стресс.Это может объяснить расхождение между анализом MTS / PMS по сравнению с измерениями TEER и анализом активности LDH (рис. 3) в настоящем исследовании.

Никаких изменений консистенции фекального материала во время трехдневного испытания воздействия не наблюдалось, что указывает на то, что соединение не вызывает мгновенный дисбактериоз. Клинические данные о недисбиозе были подтверждены анализом микробиоты. Было лишь несколько изменений в составе микробиоты образцов фекалий / образцов тонкого кишечника между мышами, получавшими JBC 1847, и мышами, получавшими плацебо, после четырех дней ежедневного лечения, и ни одно из этих изменений не было статистически значимым.Однако была тенденция к зависящему от концентрации JBC 1847 увеличению содержания Lactobacillus spp, особенно выраженному в тонком кишечнике (рис. 5). Поскольку данные не указывают на абсолютное меньшее количество бактерий, увеличение относительной численности Lactobacillus spp. предполагается, что это абсолютное увеличение в обмен на более низкую численность Streptococcus spp. (Рис 5). В целом, Lactobacillus spp. признаны полезными для здоровья кишечника [23], а ряд коммерчески доступных пре- и пробиотиков направлен на увеличение численности Lactobacillus в кишечнике [24].Это также относится к некоторым видам Streptococcus , например S . термофилов [25], тогда как другие типы стрептококков часто были связаны с заболеванием [26]. Для S . halichori , который в настоящее время считается новым патогеном, кишечник считается важной нишей [27]. Взятые вместе, эти результаты не вызывают беспокойства относительно свойств JBC 1847, вызывающих дисбактериоз, и может даже привести к появлению более полезной для здоровья микробиоты с повышенным уровнем Lactobacillus .Однако клиническая важность этого наблюдения требует дальнейшего изучения, прежде чем можно будет сделать научные выводы.

В заключение, этот первоначальный скрининг JBC 1847 в качестве перорального противомикробного средства показывает многообещающие результаты против Clostridium difficile . Приветствуются дальнейшие исследования эффективности экспериментальных кишечных моделей ИКД JBC 1847.

Благодарности

Мы хотели бы поблагодарить руководителя контрактных исследований Карину В. Лундберг из отдела бактерий, паразитов и грибов, Statens Serum Institut, Копенгаген, Дания, за плодотворное сотрудничество и научное руководство.

Ссылки

  1. 1. Маллиш Б.Х., Уильямс HRT. Clostridium difficile Инфекция и диарея, связанная с антибиотиками. Clin Med J R Coll Врачи Лондон. 2018; 18: 237–241. pmid: 29858434
  2. 2. Видель Н., Гилберт Дж., Балун Б., Нельсон К. Clostridium difficile , связанная с диареей. S D Med. 2016; 63. pmid: 27156262
  3. 3. Мэджилл С.С., О’Лири Э., Джанель С.Дж., Томпсон Д.Л., Думьяти Дж., Надл Дж. И др.Изменения в распространенности инфекций, связанных с оказанием медицинской помощи, в больницах США. N Engl J Med. 2018; 379: 1732–1744. pmid: 30380384
  4. 4. Abujamel T, Cadnum JL, Jury LA, Sunkesula VCK, Kundrapu S, Jump RL и др. Определение уязвимого периода для восстановления колонизации Clostridium difficile после обработки C . difficile инфекция, вызванная пероральным приемом ванкомицина или метронидазола. PLoS One. 2013; 8: 1–12. pmid: 24098459
  5. 5.Peterfreund GL, Vandivier LE, Sinha R, Marozsan AJ, Olson WC, Zhu J, et al. Последовательность в микробиоме кишечника после лечения антибиотиками и антителами для Clostridium difficile . PLoS One. 2012; 7. pmid: 23071679
  6. 6. Balsells E, Shi T., Leese C., Lyell I., Burrows J, Wiuff C, et al. Глобальное бремя инфекций Clostridium difficile : систематический обзор и метаанализ. J Glob Health. 2019; 9. pmid: 30603078
  7. 7. Нанва Н., Сандер Б., Кран М., Данеман Н., Лу Х., Остин П.С. и др.Популяционное сопоставленное когортное исследование, посвященное изучению смертности и стоимости пациентов с внебольничной инфекцией Clostridium difficile , выявленной при посещениях отделений неотложной помощи и госпитализации. PLoS One. 2017; 12: 1–13. pmid: 28257438
  8. 8. Ву X, Cherian PT, Lee RE, Hurdle JG. Мембрана как мишень для борьбы с гипервирулентными инфекциями Clostridium difficile . J Antimicrob Chemother. 2013; 68: 806–815. pmid: 23264511
  9. 9.Йоргенсен Н.С., Сааби Л., Андерссон А.М., Кроманн С., Шейхсамани Э., Пермин А. и др. Новое производное тиоридазина проявляет низкую токсичность и эффективную активность в отношении грамположительных патогенов. Антибиотики. 2020; 9: 1–11. pmid: 32549350
  10. 10. Ронко Т., Йоргенсен Н.С., Холмер И., Кроманн С., Шейхсамани Э., Пермин А. и др. Новое производное промазина демонстрирует высокую антимикробную активность in vitro и in vivo против Staphylococcus aureus .Front Microbiol. 2020; 11: 1–12. pmid: 32082274
  11. 11. Чакраборти Б.С., Мидха К.К., Маккей Г., Хоуз Э.М., Хаббард Дж. В., Корчинский Э.Д. и др. Кинетика однократной дозы тиоридазина и двух его психоактивных метаболитов у здоровых людей: исследование пропорциональности доз. J Pharm Sci. 1989; 78: 796–801. pmid: 2600782
  12. 12. Силиг А., Готчлих Р., Девант Р.М. Метод определения способности лекарств проникать через гематоэнцефалический барьер. Proc Natl Acad Sci U S A.1994; 91: 68–72. pmid: 8278409
  13. 13. Альбертсен М, Карст С.М., Циглер А.С., Киркегор Р.Х., Нильсен PH. Назад к основам — Влияние экстракции ДНК и выбора праймера на филогенетический анализ сообществ активного ила. PLoS One. 2015; 10: 1–15. pmid: 26182345
  14. 14. Април А, Макнелли С., Парсонс Р., Вебер Л. Незначительная переработка праймера гена рРНК 806R области V4 SSU рРНК 806R значительно увеличивает обнаружение бактериопланктона SAR11. Aquat Microb Ecol. 2015; 75: 129–137.
  15. 15. Bolger AM, Lohse M, Usadel B. Trimmomatic: гибкий триммер для данных последовательности Illumina. Биоинформатика. 2014; 30: 2114–2120. pmid: 24695404
  16. 16. Магоч Т, Зальцберг С.Л. FLASH: Быстрая корректировка длины коротких чтений для улучшения сборки генома. Биоинформатика. 2011; 27: 2957–2963. pmid: 21
  17. 9
  18. 17. Ван Кью, Гроссмейстер Гаррити, Тидже Дж. М., Коул Дж. Р. Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии.Appl Environ Microbiol. 2007. 73: 5261–5267. pmid: 17586664
  19. 18. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME позволяет анализировать данные секвенирования сообщества с высокой пропускной способностью. Нат методы. 2011; 7: 335–336.
  20. 19. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T., Yarza P, et al. Проект базы данных генов рибосомных РНК SILVA: улучшенная обработка данных и веб-инструменты. Nucleic Acids Res. 2013; 41: 590–596. pmid: 23193283
  21. 20.Чао А., Готелли, штат Нью-Джерси, Се Т.С., Сандер Э.Л., Ма К.Х., Колвелл Р.К. и др. Редкость и экстраполяция с числами Хилла: основа для выборки и оценки в исследованиях видового разнообразия. Ecol Monogr. 2014; 84: 45–67.
  22. 21. Надкарни М.А., Мартин Ф.Е., Жак Н.А., Хантер Н. Определение бактериальной нагрузки с помощью ПЦР в реальном времени с использованием широкого (универсального) зонда и набора праймеров. Микробиология. 2002; 148: 257–266. pmid: 11782518
  23. 22. Певица AC, Kirchhelle C, Робертс AP.Новое изобретение противомикробных препаратов в ответ на глобальный кризис устойчивых к противомикробным препаратам инфекций. F1000 Исследования. 2019; 8: 6–11. pmid: 30

    9
  24. 23. Foysal MJ, Fotedar R, Siddik MAB, Tay A. Lactobacillus acidophilus и L. plantarum улучшают состояние здоровья, модулируют микробиоту кишечника и врожденный иммунный ответ маррона ( Cherax cainii ). Sci Rep. 2020; 10: 1–13. pmid: 312
  25. 24. Хемараджата П., Версалович Дж.Влияние пробиотиков на микробиоту кишечника: механизмы иммуномодуляции и нейромодуляции кишечника. Therap Adv Гастроэнтерол. 2013; 6: 39–51. pmid: 23320049
  26. 25. Хань Ф, Ву Г, Чжан И, Чжэн Х, Хань С., Ли Х и др. Streptococcus thermophilus Ослабляет воспаление у мышей с сепсисом, вызванное кишечной микробиотой. Front Microbiol. 2020; 11: 1–11. pmid: 32082274
  27. 26. Krzyściak W, Pluskwa KK, Jurczak A, Kościelniak D. Патогенность рода Streptococcus .Eur J Clin Microbiol Infect Dis. 2013; 32: 1361–1376. pmid: 24141975
  28. 27. Аалтонен К., Кант Р., Эклунд М., Раунио-Саарнисто М., Паулин Л., Вапалахти О. и др. Streptococcus halichoeri : Сравнительная геномика появляющегося патогена. Int J Genomics. 2020; 2020. pmid: 32149071

New Frontiers for Treatment of Metabolic Diseases

Поддержание здорового метаболизма человека зависит от симбиотического консорциума бактерий, архей, вирусов, грибов и эукариотических клеток-хозяев во всем желудочно-кишечном тракте человека.Сообщества микробов обеспечивают ферментативный механизм и метаболические пути, которые способствуют перевариванию пищи, метаболизму ксенобиотиков и производству различных биоактивных молекул. К ним относятся витамины, аминокислоты, короткоцепочечные жирные кислоты (SCFA) и метаболиты, которые необходимы для взаимосвязанных путей гликолиза, цикла трикарбоновых кислот / Кребса, окислительного фосфорилирования (OXPHOS) и метаболизма аминокислот и жирных кислот. Недавние исследования выяснили, как питательные вещества, питающие метаболические процессы, влияют на то, как иммунные клетки, в частности, макрофаги, реагируют на различные стимулы в физиологических и патологических условиях, активируются и приобретают особую функцию.Два основных воспалительных фенотипа макрофагов контролируются за счет различного потребления глюкозы, глутамина и кислорода. Фенотип M1 запускается сигналом поляризации от бактериального липополисахарида (LPS) и провоспалительных цитокинов Th2, таких как интерферон- γ , TNF- α и IL-1 β или оба, тогда как фенотип M2 запускается цитокинами Th3 такие как интерлейкин-4 и интерлейкин-13, а также противовоспалительные цитокины, IL-10 и TGF β или глюкокортикоиды.Утилизация глюкозы и производство химических медиаторов, включая АТФ, активные формы кислорода (АФК), оксид азота (NO) и НАДФН, поддерживают эффекторную активность макрофагов M1. Дисбиоз — это дисбаланс комменсальных и патогенных бактерий, а также выработка микробных антигенов и метаболитов. Теперь известно, что продукты, полученные из микробиоты кишечника, вызывают низкую воспалительную активацию тканевых макрофагов и способствуют метаболическим и дегенеративным заболеваниям, включая диабет, ожирение, метаболический синдром и рак.Здесь мы обновляем возможное взаимодействие дисбактериоза микробиома кишечника хозяина и метаболических заболеваний. Мы также обобщаем достижения в области фекальной терапии, пробиотиков, пребиотиков, симбиотиков, а также питательных веществ и низкомолекулярных ингибиторов ферментов метаболического пути в качестве профилактических и терапевтических средств при метаболических заболеваниях.

1. Введение

Микробиомы человека относятся к коллективным геномам бактерий, архей, вирусов, простейших и грибов, которые совместно обитают в нескольких экосистемах человеческого тела (Bäckhed et al.[1], Белизарио и Наполитано [2]). Взрослый мужчина весом 70 кг может содержать до 3,8 × 10 13 бактерий, что равно количеству клеток в организме взрослого человека (Sender et al. [3]). Бактерии классифицируются морфологически и биохимически на основе различных свойств, включая тип стенки, форму, потребность в кислороде (анаэробный или аэробный), продукцию эндоспор, подвижность и их метаболизм. Бактерии также классифицируются по филогенетическому разнообразию вариабельных нуклеотидных последовательностей малых субъединичных оперонов рибосомной РНК или генов 16S и 18S рРНК [1, 2].

В рамках проекта «Микробиом человека» (HMP) были определены критерии высококачественного и всестороннего метагеномного анализа генетического материала, извлеченного непосредственно из различных участков человеческого тела, для определения относительной численности микробов множества штаммов и видов разных типов в физиологических условиях. [4–6]. Достижения в области вычислительной техники позволили изучить общедоступные человеческие метагеномы на основе филогенетической кластеризации и сборки бактериальных геномов в таксономический домен, царство, тип, класс, порядок, семейство, род и виды [4–8].Анализ различных наборов данных микробиома человека выявил огромное разнообразие как популяций, так и отдельных людей на протяжении эволюции и жизни [7–9]. Микробиота кишечника здоровых людей состоит из постоянных и преходящих микробных видов и подвидов более 17 кандидатных бактериальных типов, принадлежащих Firmicutes (> 70%), Bacteroidetes (> 30%), Proteobacteria (<5%), Actinobacteria (<2%). ), Fusobacteria и Verrucomicrobia (<1%) и другие типы. Новая сборка бактериального генома и таксономическое профилирование на основе 1550 геномов, собранных из метагеномов (MAG), позволили выявить около 70 000 геномов бактерий и архей, а также новые виды, которые находятся в стадии глубокого исследования [6–8].Обычный набор преобладающих видов микробов, обнаруживаемых в нормальном стуле человека, включает видов Clostridiales , таких как Coprococcus , Ruminococcus , Eubacterium , Bacteroides dorei и fragilis 910ii23 [7, 8]. Полностью широкое таксономическое распределение, микробная эволюция и метаболизм видов бактерий в отношении калорийной нагрузки и усвоения питательных веществ послужили объединению филотипов на уровне видов в основные энтеротипы человека [9–12].Преобладающий тип 1 энтеротипа человека характеризуется высокими уровнями Bacteroides , а тип 2 — небольшим количеством Bacteroides , но высокими уровнями Prevotella . Они, соответственно, связаны с людьми, потребляющими либо большое количество животного белка (тип 1), либо углеводов (тип 2).

Желудочно-кишечный тракт (ЖКТ) обладает собственной нервной системой, известной как кишечная нервная система. Эта система взаимодействует с центральной нервной системой через нервы, такие как блуждающий нерв, нейромодуляторы и нейротрансмиттеры симпатических и парасимпатических ветвей вегетативной нервной системы [1].Бактериальное богатство и разнообразие микробиоты ЖКТ играют центральную роль в нормальных метаболических и иммунологических функциях тканей и органов [1, 2]. Здесь мы расскажем о различных исследованиях, изучающих роль микробиомов, питательных веществ и метаболитов в функции иммунных клеток, этиологии воспалительных и метаболических заболеваний, включая широкий спектр их механизмов. Мы также описываем, почему и как новые диетические и фармакологические стратегии, включая трансплантацию фекалий, пробиотики, пребиотики и малые молекулы, могут помочь лечить и модулировать типы типов на уровне видов и способствовать восстановлению микробиомов, вызывающих метаболические синдромы.

2. Микробиота кишечника контролирует метаболические физиологические состояния хозяина

Микроорганизмы в кишечнике выполняют свои функции в основном через ферментные пути, чтобы переваривать сложные пищевые углеводы и белки [13, 14]. Микробиота кишечника обеспечивает аминокислоты с разветвленной цепью лейцин, изолейцин и валин, и особенно глицин, который необходим для синтеза глутатиона — основного внутриклеточного антиоксиданта и детоксифицирующего агента, необходимого для многих биологических функций организма-хозяина.Бактерии кишечника синтезируют большое количество сигнальных молекул с низким молекулярным весом, включая метан, сероводород и неосновные метаболиты [13, 14]. Эти продукты могут включать или выключать как гены хозяина, так и гены вирулентности и метаболизма микробов. Микроорганизмы также воспринимают различные сигналы окружающей среды, включая гормоны хозяина и питательные вещества, и реагируют на них посредством дифференциальной регуляции генов и адаптации к нише [13, 14].

Поддержание стабильной ферментативной микробиоты кишечника требует диеты, богатой цельными растительными продуктами, особенно богатыми клетчаткой [13, 14].Эти субстраты обрабатываются ферментами кишечной микробиоты, такими как гликозидгидролазы и полисахаридные лиазы, с образованием полиаминов, полифенолов и витаминов B и K. В анаэробных условиях виды, принадлежащие к роду Bacteroides и к Clostridiaceae и Семейства Lactobacillaceae , в частности штаммы Citrobacter и Serratia , продуцируют короткоцепочечные жирные кислоты (SCFA), которые представляют собой летучие жирные кислоты, способные преодолевать гематоэнцефалический барьер через переносчики монокарбоксилатов.SCFAs, продуцируемые кишечными бактериями, представляют собой ацетат (2 атома углерода), пропионат (3 атома углерода) и бутират (4 атома углерода), и их молярные соотношения варьируются от 3: 1: 1 до 10: 2: 1 соответственно. Большинство SCFAs метаболизируются до CO 2 . Бутират действует на колоноциты, бокаловидные клетки и клетки Панета и обеспечивает энергию для клеточного метаболизма и регулирует апоптоз, клеточную дифференцировку и химическую модификацию ядерных белков и нуклеиновой кислоты. Ацетат и пропионат попадают в кровоток и поглощаются печенью и периферическими органами, где они могут действовать как субстраты для глюконеогенеза и липогенеза [14, 15].Рецепторы, связанные с G-белком (GPR), GPR41 и GPR43, также называемые рецепторами свободных жирных кислот 2 и 3 (FFARs 2/3), присутствующие во многих тканях, включая жировую ткань, энтероэндокринные клетки кишечника и воспалительные клетки, действуют как основные рецепторы SCFAs [14, 15]. В определенных физиологических условиях SCFAs могут индуцировать секрецию глюкагоноподобных пептидов (GLP-1 и GLP-2) и пептида YY (PYY). GLP1 стимулирует β клеток поджелудочной железы к выработке инсулина, тогда как PYY ингибирует всасывание питательных веществ в просвете кишечника, а также контролирует аппетит.Микробиота кишечника способствует отложению жира посредством регуляции ядерного рецептора фарнезоида X (FXR), рецептора желчных кислот, который отвечает за регуляцию синтеза желчных кислот и накопление триглицеридов в печени [16]. Желчные кислоты, например дезоксихолевая кислота, обладают противомикробным действием на микробы кишечника, а также индуцируют синтез антимикробных пептидов эпителиальной тканью кишечника [17]. Более того, микробиота превращает карнитин и холин в триметиламин и, таким образом, напрямую регулирует биодоступность холина и косвенно накопление триглицеридов в печени.Микробиота кишечника также способствует усвоению кальция, магния и железа. Высокая или низкая продукция SCFAs, метаболитов триптофана, ГАМК, норадреналина, дофамина, ацетилхолина и 5-гидрокситриптамина (серотонина) связана с различными воспалительными и метаболическими заболеваниями и нервно-психическими расстройствами [18]. Некоторые из этих факторов действуют как основные нейротрансмиттеры и модуляторы оси мозг-кишечник, а серотонин играет центральную роль в сексуальности, наркозависимости, аппетите, эмоциях и реакции на стресс [18].

Тысячи производных микробиоты метаболитов с известными и неизвестными функциями были идентифицированы как компоненты метаболома человека [19–21]. Микробиота ЖКТ производит большое количество эпигенетически активных метаболитов, таких как фолат и витамины A и B (включая рибофлавин (B 2 ), ниацин (B 3 ), пантотеновую кислоту (B 5 ), пиридоксин (B 6). ), фолиевой кислоты (B 9 ) и кобаламина (B 12 )), которые регулируют активность ферментов, модулирующих хроматин, и генетические ответы на сигналы окружающей среды [22].Ацетил-КоА, продуцируемый рядом метаболических процессов, является донором ацетила для модификации гистонов (ацетилирование и деацетилирование), катализируемой ацетилтрансферазами гистонов. Глицин, серин и метионин являются субстратами для ферментов метилирования и деметилирования ДНК. Следовательно, изменения микробиоты кишечника могут приводить к эпигеномным изменениям не только непосредственно в соседних клетках кишечника, но и в отдаленных клеточных клонах, таких как гепатоциты и адипоциты [22]. Наконец, бактерии могут подавлять рост своих конкурентов с помощью микробной коммуникации на большие расстояния, высвобождая метаболиты и пептиды, чувствительные к кворуму, что считается биологической стратегией для поддержания плотности комменсальных видов и устранения патогенных бактерий [23, 24].

3. Микробиота кишечника управляет иммунологическими функциями хозяина

Коллекция из 100-400 × 10 12 бактерий обитает и живет в мутуалистических отношениях в желудочно-кишечном тракте человека [3]. Двойной слизистый слой GI образован сильно O-гликозилированными белками муцина, кодируемыми геном MUC2 из семейства белков муцина. Большинство бактерий толстой кишки плотно прикреплены к внешнему слою слизи, а внутренний слой образует физический барьер, ограничивающий контакт бактерий с эпителием.Большинство видов микробов в желудочно-кишечном тракте передаются младенцам в раннем возрасте через материнское молоко, которое содержит преимущественно видов Bifidobacteria и Lactobacillus [25, 26]. По мере перехода от младенчества к взрослой жизни увеличение источников пищи стимулирует сложность и разнообразие бактериальных сообществ родов Bacteroides , Parabacteroides (Bacteroidetes) и Clostridium (Firmicutes) [1, 2, 25, 26 ]. Плотность бактерий в тонкой / подвздошной кишке (<10 5 ) и в толстой кишке прогрессивно увеличивается по сравнению с желудком и двенадцатиперстной кишкой, а самые высокие таксоны и плотность клеток присутствуют в толстой кишке, которая содержит 10 9 -10 12 колониеобразующих единиц на мл (99% от общей популяции ЖКТ).Это анаэробы, такие как Bacteroides , Porphyromonas , Bifidobacterium , Lactobacillus и Clostridium . Анаэробные бактерии и чувствительные к кислороду микробы способны продуцировать короткоцепочечные жирные кислоты, чем факультативные аэробные бактерии, такие как E. coli , в 1000 раз. Нарушение динамической взаимосвязи между хозяином и микробными сообществами вызывает дисбиоз, что представляет собой бактериальный дисбаланс между соотношениями аэробных и факультативно-анаэробных бактерий [1, 2].Гипоксия предотвращает рост патогенных факультативных анаэробов, таких как E. coli и Salmonella . Разрыв кишечного барьера, спровоцированный дисбактериозом, приводит к локальному и системному воспалению [1, 2, 27]. Исследование Byndloss et al. недвусмысленно продемонстрировано, что дисбактериоз может быть вызван высоким уровнем кислорода и нитратов, которые являются соединениями, которые способствуют росту Escherichia и видов Salmonella [28]. Многие заболевания, включая воспалительные заболевания кишечника (ВЗК), синдром раздраженного кишечника (СРК), диабет, ожирение и рак, связаны со специфическим бактериальным дисбиозом [29–31].Возможные временные изменения видов микробиоты, например, за счет уменьшения количества противовоспалительных видов, таких как Faecalibacterium prausnitzii и Akkermansia muciniphila , которые преобладают у здоровых людей, или за счет размножения потенциально провоспалительных бактерий, таких как Bacteroides и Ruminococcus gnavus , могут способствовать прогрессированию и хронизации заболевания [29–32]. Сравнительные исследования на моделях худых и страдающих ожирением животных показали, что низкое соотношение Bacteroidetes / Firmicutes является признаком ожирения [33].Firmicutes в значительной степени зависят от пищевых углеводов, тогда как Proteobacteria полагаются на белки как на источник углерода. Например, Akkermansia muciniphila — это бактерия, разлагающая муцин, в типе Verrucomicrobia , которая присутствует в большом количестве у здоровых людей, но присутствует в меньшем количестве у пациентов с воспалительными и желудочно-кишечными заболеваниями, ожирением и диабетом 2 типа. (T2D) [34]. Фактически, различные микробные сообщества и механизмы могут определять восприимчивость хозяина к заболеваниям и влиять на клинические исходы [35].

Микробиота кишечника играет важную роль в иммунной системе, контролируя развитие и функционирование лимфоидных тканей, ассоциированных с кишечником (GALT), включая пейеровы бляшки, изолированные лимфоидные фолликулы и мезентериальные лимфатические узлы [30, 31, 36, 37] . Микробы и их продукты необходимы иммунной системе, чтобы отличать себя от чужого (захватчиков) на раннем этапе жизни, а также для активации и поддержания врожденных гемолимфоидных клеток (ILC1, 2 и 3), естественных киллеров (NK), цитотоксических и нецитотоксических и лимфоидные клетки-помощники [36–39].NK-клетки и ILC1 продуцируют большие количества IFN-γ , антимикробные пептиды (AMP), гранулизин, дефенсины, лизоцим и Reg III γ , которые вместе играют критически важные функции в регуляции микробной экологии и иммунного надзора [24, 31, 39, 40]. Например, полисахарид A, α -галактозилцерамид и метаболиты триптофана, продуцируемые микробными сообществами, стимулируют иммунные клетки к выработке интерлейкина-22, Reg3 γ , IgA и интерлейкина-17 [37].IgA — один из важных компонентов врожденного ответа, предотвращающего вторжение микроорганизмов в кровообращение [30]. Т-хелперные (Th) 17-клетки и регуляторные Т-клетки (Treg) представляют собой антиген-специфические популяции, которые реагируют на трансформирующий фактор роста β и ретиноевую кислоту и контролируют иммунную толерантность [38, 39]. Этот контроль иммунной системы всего организма кишечными бактериями, по-видимому, является сложной структурой, поскольку потеря определенного вида может привести к чрезмерной реакции или подавлению врожденного иммунного ответа [27, 35, 36].

Множество мембранных и внутриклеточных рецепторов, называемых «рецепторами распознавания образов» или PRR, экспрессируемых на эпителиальных и иммунных клетках, действуют как сенсоры бактериальных и клеточных продуктов, которые называются патоген-ассоциированными молекулярными структурами (PAMP) и связанными с повреждениями молекулярными структурами. паттерны (DAMPs) [41, 42]. PAMP и DAMP, такие как липополисахариды (LPS), липид A, пептидогликаны, флагеллин, микробная РНК / ДНК, а также компоненты клетки-хозяина, такие как мочевая кислота, HMGB1 (белок группы 1 с высокой подвижностью), двухцепочечная ДНК, и митохондриальные, распознаются членами семейства Toll-подобных рецепторов (TLR) и ядерными доменами олигомеризации рецепторов семейства NOD / NLR [41, 42].Внеклеточные и внутриклеточные комплексы, образованные DAMP, PAMP и рецепторами NOD / NLR, составляют инфламмасомы [43]. Эти цитозольные комплексы связываются с адаптерным белком ASC (ассоциированный с апоптозом пятнышкообразный белок) и провоспалительными протеазами семейства каспаз: каспаза 1, каспаза 11, каспаза 4 и каспаза 5 [43]. После активации инфламмасом происходит выработка интерлейкинов IL-1, , β, и IL-18. Эти цитокины увеличивают синтез других цитокинов, таких как TNF- α , IL-6, IL-17, IL-22 и IL-23, а также некоторых активных химических медиаторов воспаления [43].

Различные исследования с использованием генно-дефицитных моделей мышей определили прямое и сложное взаимодействие бактериального дисбиоза, генетических факторов и факторов окружающей среды [35, 36, 44]. Многие воспалительные заболевания вызваны мутациями или утратой некоторых генов врожденного ответа в лимфоидных тканях и более мелких пейеровских бляшках и мезентериальных лимфатических узлах [38, 39]. Компоненты инфламмасом, такие как MyD88, TLR, NOD, NLrp3 / 6, ASC, а также каспаза 1 и каспаза 11, как известно, контролируют дисбактериоз кишечника [29, 38, 39, 45, 46].Например, трансгенные мыши NOD1 / и NOD2 / обладают повышенной восприимчивостью не только к воспалительному заболеванию кишечника, но также к диабету 1 типа и раку [38, 39, 45, 46]. Условия содержания животных и состав микробиоты, вызванный диетой, являются некоторыми примерами, которые могут быть ответственны за фенотипические различия штаммов у трансгенных животных [47, 48]. У мышей без зародышей (GF) обнаруживаются недоразвитые лимфоидные ткани, нарушение функции Т- и В-клеток и снижение выработки Т-клеток CD4 + и антител.Их клетки Th27 и Treg менее эффективны в борьбе с инфекцией. Колонизация мышей GF с ограниченным числом видов бактерий (модели мышей-гнотобиотов) может восстановить иммунологические функции [47, 48]. Фенотипы, наблюдаемые на этих моделях мышей, не всегда наблюдаются в исследованиях на людях. Важно отметить, что 85% видов микробиома мышей не были обнаружены в микробиомах человека [49, 50]. Более того, гуманизация мышиных моделей клетками человека или человеческой микробиотой не может адекватно отображать весь спектр соответствующих фенотипов болезней человека [47, 48].

На рисунке 1 показаны основные классы молекул, метаболитов и питательных веществ, продуцируемых видами бактерий, иммунными клетками, тканями и органами, которые регулируют динамическое взаимодействие между клетками-хозяевами и микробиомом кишечника, а также терапевтические стратегии для борьбы с дисбиозом и заболеваниями.


4. Иммунометаболизм и пути перепрограммирования митохондрий

Митохондрии служат двигателем клетки, производя и высвобождая критические сигналы в окружающую среду и синтезируя АТФ, энергию тела, необходимую для метаболических процессов [51].Биоэнергетические пути гликолиза, цикл трикарбоновой кислоты (TCA) (также известный как цикл Кребса и цикл лимонной кислоты), метаболизм жирных кислот и аминокислот являются центральными метаболическими процессами для полного окисления всех питательных веществ в митохондриях [51, 52 ]. Клетки используют аэробный гликолиз для производства пирувата, производного от глюкозы, который превращается в ацетилкофермент А (ацетил-КоА). Молекулы ацетил-КоА, полученные из метаболизма глюкозы, глутамина или жирных кислот, входят в цикл TCA и превращаются в CO 2 , NADH и FADH 2 во время окислительного фосфорилирования (OXPHOS). OXPHOS происходит через прохождение электронов через ряд молекулы-носители, называемые цепью переноса электронов, с помощью переносчиков электронов, таких как NAD (P) H и FADH 2 , которые служат субстратом для генерации аденозинтрифосфата (АТФ) в митохондриальном матриксе [51, 52].Электроны передаются от НАДН к О 2 через три белковых комплекса: НАДН-дегидрогеназа, цитохромредуктаза и цитохромоксидаза. Электронный транспорт между комплексами происходит через другие мобильные переносчики электронов, убихинон и цитохром c. Вновь синтезированный АТФ переносится в цитозоль транслоказой аденин-нуклеотида в обмен на АДФ. Ацетил-КоА является предшественником синтеза холестерина и жирных кислот, которые включены в клеточные плазматические мембраны.

Иммунометаболизм включает в себя центр биохимической активности иммунных клеток для модуляции профиля экспрессии генов и переключения метаболических путей и их ключевых ферментов [53]. После стимулирующего сигнала различные иммунные клетки, в частности, макрофаги, DC и Т-клетки, демонстрируют различные метаболические пути перепрограммирования, способствующие их активации, выживанию и образованию клонов [53]. Это перепрограммирование метаболических путей лучше всего охарактеризовано в макрофагах и показано на рисунке 2.Основополагающее исследование Newsholme et al. привело к открытию того, что скорость потребления глюкозы, глутамина и жирных кислот и ферментативная активность глюкозо-6-фосфатдегидрогеназы, 6-фосфоглюконатдегидрогеназы, цитратсинтазы, оксоглутаратдегидрогеназы и глутаминазы различаются в покоящихся и вызванных (воспалительных) макрофагах. [54]. Их исследование показало, что вся глюкоза, используемая воспалительными макрофагами, превращалась в лактат и очень мало ее окислялось [54, 55]. С тех пор переход от окислительного фосфорилирования (OXPHOS) к гликолизу и глутаминолизу рассматривается как путь метаболического репрограммирования воспалительных клеток.Примечательно, что макрофаги, Т-клетки и другие иммунные клетки используют гликолиз для быстрого производства радикальных форм кислорода (АФК), используемых для ограничения инфекции. Гликолиз также обеспечивает быстрое производство АТФ и промежуточных продуктов метаболизма для синтеза рибозы для нуклеотидов и аминокислот для биосинтеза РНК и ДНК белков макрофагами. Гликолиз — предпочтительный путь активации дендритных клеток, CD4 + T-хелперов 1 (Th2), Th3 и Th27 клеток, NK-клеток и цитотоксических клеток CD8 + [51, 52].Интересно, что эта метаболическая адаптация к аэробному гликолизу (в присутствии кислорода) была впервые описана как отличительный признак опухолевых клеток Warburg et al. в основополагающем отчете, опубликованном 60 лет назад [56].


Нестимулированные макрофаги, проявляющие фенотип M0 и проявляющие поверхностные маркеры дифференцировки CD68 + / CD80 / низкий / CD206 высокий приобретают и демонстрируют фенотип M1 (CD68 + + / CD80 / низкий 903 низкий ) или фенотип M2 (CD68 + / CD80 высокий / CD206 / низкий ) после переключения их метаболизма и функции в ответ на стимулы или сигналы поляризации, которые инициируют про- или противовоспалительный ответ [57].Клетки M1 проявляют Th2-ориентированные провоспалительные эффекторные свойства и способствуют повреждению тканей и противомикробной и противоопухолевой устойчивости, тогда как клетки M2 проявляют функции ремоделирования и восстановления тканей, способствуют заживлению ран, ангиогенезу и устойчивости к паразитам, а также способствуют росту опухолей. Перепрограммирующие метаболические пути в макрофагах M1 / ​​M2 изменяют их функции, включая продукцию цитокинов, фагоцитоз и презентацию антигена [58–60]. Классический путь активации или путь репрограммирования в макрофагах M1 способствует накоплению цитрата и высокой продукции NO, ROS, цитокинов и простагландинов [60, 61].Макрофаги M1 высвобождают АФК и NO в фагосомах, где они способствуют уничтожению патогенов. Цитокины Th3, такие как IL-4 и IL-13, регулируют альтернативный путь макрофагов или путь репрограммирования M2. Основная особенность путей репрограммирования M2 состоит в том, что цикл TCA связан с окислительным фосфорилированием, β -окислением жирных кислот и митохондриальным биогенезом. Кроме того, макрофаги M2 не производят NO. Важно учитывать, что макрофаги M2 проявляют различные различные формы (M2a, b и c) в зависимости от местной тканевой среды и воздействия стимулов [57].

Образование промежуточных продуктов UDP-GlcNAc способствует гликозилированию M2-ассоциированных рецепторов, таких как рецептор маннозы [60]. Таким образом, фенотипы макрофагов M1 и M2 могут контролироваться либо кислородом и питательными веществами, либо цитокинами и сигналами, опосредованными повреждениями и патогенами молекулярных паттернов (DAMP- и PAMP-) [60]. Эти события контролируются сигнальными и транскрипционными путями, индуцируемыми каноническими регуляторами клеточного метаболизма, такими как фактор транскрипции C-myc, коактиваторные белки, такие как PPAR γ и PGC-1 β (рецептор, активируемый пролиферацией пероксисом γ ). , коактиватор 1 β ) и сигнальные пути, управляемые AMPK (5-аденозинмонофосфат-активируемая протеинкиназа), mTORC1 / 2 (мишень для комплексов рапамицина у млекопитающих) и STAT6 (преобразователь сигнала и активатор транскрипции) [51, 52 ].Подробный обзор метаболических путей макрофагов, фенотипических и функциональных исходов описан в другом месте [62].

В 2013 году Tannahil et al. сообщили, что экспрессия мРНК IL-1 β в макрофагах M1, стимулированных LPS, приводит к активации фактора транскрипции, индуцированного гипоксией, фактора 1 α (HIF1 α ) зависимым от гликолиза образом [63]. HIF1 α взаимодействует с изоферментом M2 пируваткиназы (PKM2) и способствует экспрессии индуцированных HIF1 α генов, необходимых для гликолиза [64].Активация эффекта Варбурга (гликолиза) в LPS-стимулированных макрофагах вызывает накопление промежуточных продуктов цикла TCA, в частности, сукцината, малата и фумарата, из-за отклонения потока или «точки разрыва» пути цикла Кребса ( см. рисунок 2). Сукцинат выполняет множество иммунологических функций [52, 53, 63]. Окисление сукцината ферментом сукцинатдегидрогеназой (SHD), который превращает сукцинат в фумарат, стимулирует производство ROS из комплекса II в митохондриях, процесс, называемый обратным электронным транспортом (RET).Макрофаги отвечают на активацию HIF-1 α через АФК и повышают экспрессию IL-1 β [58]. Ингибирование SDH диметилмалонатом подавляет экспрессию IL-1 β , одновременно увеличивая продукцию иммуносупрессивного цитокина IL-10 [52, 63].

Итаконат — один важный метаболит, образующийся при втором отклонении потока или «точке разрыва» пути цикла Кребса во время перехода макрофагов из неактивного в провоспалительное состояние [65]. Итаконат представляет собой ненасыщенную дикарбоновую кислоту, продуцируемую экстрамитохондриальным ферментом цис-аконитат-декарбоксилазой, кодируемым иммунно-чувствительным геном 1 ( Irg1 ).Этот фермент превращает цис-аконитат (полученный из цитрата) в итаконовую кислоту. Одним из замечательных эффектов, наблюдаемых после лечения итаконатом, является снижение экспрессии цитокинов IL-1, , β, , IL-6 и iNOS [65]. Исследования с использованием макрофагов, полученных из костного мозга мыши (BMDM) и клеток RAW-264.7, стимулированных LPS и цитокинами, показали, что отсутствие (нокдаун) гена Irg приводит к нарушению субстратного фосфорилирования (SLP) митохондрий [66 ]. SLP — это метаболическая реакция, которая приводит к образованию ATP или GTP путем прямого переноса фосфатной группы на ADP или GDP от другого фосфорилированного соединения.Введение итаконата (0,5–2 мМ) обращает эту реакцию вспять [66]. Исследования с использованием трансгенных мышей и иммунных клеток, дефицитных по гену Irg 1, продемонстрировали, что итаконат действует как эндогенный ингибитор сукцинатдегидрогеназы и что такое ингибирование вызывает накопление сукцината [67]. В совокупности эти исследования подтвердили, что итаконат регулирует уровни сукцината, митохондриальное дыхание и выработку воспалительных цитокинов и, следовательно, действует как важный регулятор активации макрофагов.Кроме того, итаконовая кислота обладает антимикробной активностью и убивает непосредственно внутриклеточные Salmonella typhimurium , Legionella pneumophila и Mycobacterium tuberculosis ; таким образом, он защищает от заражения. Цитотоксический эффект связан с ингибированием фермента изоцитратлиазы [68]. Изоцитратлиаза регулирует специфический для бактерий метаболический путь, известный как глиоксилатный шунт, в котором ацетил-КоА превращается в сукцинат для синтеза углеводов.По этому пути изоцитрат расщепляется ферментом ICL (кодируемым aceA) с образованием глиоксилата и сукцината, которые повторно входят в цикл TCA после стадий окислительного декарбоксилирования. Таким образом, глиоксилатный шунт действует как путь выживания микробов [66–68].

5. Дисбиоз кишечника, связанный с метаболическими заболеваниями

Исследования взаимосвязи между кишечными микробами, ожирением, инсулинорезистентностью и метаболическим синдромом показали сложное взаимодействие между диетой хозяина, генетикой и динамикой состава микробиома [49, 69, 70] .Серия экспериментов показала, что хронический воспалительный процесс, связанный с перемещением ЛПС кишечных бактерий в кровоток, вызывает «тихую» метаболическую эндотоксемию и, в конечном итоге, расстройства, связанные с ожирением [71–73]. Признаки клинических проявлений метаболического синдрома включают центральное ожирение, высокое кровяное давление и высокий уровень сахара в крови и триглицеридов сыворотки, которые являются наиболее значительными факторами развития инсулинорезистентности, диабета 2 типа, гипертонии и жировой болезни печени.Лица, сильно колонизированные бактериями и архей родами Faecalibacterium , Bifidobacterium , Lactobacillus , Coprococcus и Methanobrevibacter , имеют значительно меньшую склонность к развитию метаболизма и нарушениям обмена веществ, а также к диабету 2 типа. сердечно-сосудистые нарушения [49, 73]. Эти виды являются более высокими продуцентами SCFAs и перекиси водорода, которые, как известно, ингибируют образование биопленок патогенными видами, включая Staphylococcus aureus и E.coli [73].

Ожирение связано с поведенческими факторами и факторами окружающей среды, такими как чрезмерное потребление высококалорийной пищи и малоподвижный образ жизни [49, 73–75]. Первые ключи к разгадке роли микроорганизмов в энергетическом гомеостазе и ожирении появились в исследованиях на стерильных животных [76]. Остается ответить на несколько важных вопросов о сложном взаимодействии между хозяином и микробами в патофизиологии ожирения [49, 74, 75]. Исследования на генетических и индуцированных диетой моделях ожирения на мышах подтвердили, что соотношение Firmicutes и Bacteroidetes увеличивается у тучных животных по сравнению с контрольными животными, не страдающими ожирением [33, 49, 77].Более высокое соотношение Firmicutes и Bacteroidetes также было обнаружено в клинических исследованиях, в которых оценивали здоровых добровольцев с избыточной массой тела и ожирением [33], при этом было обнаружено высокое общее количество SCFAs в кале [78]. Мышиные и человеческие модели продемонстрировали обратную взаимосвязь между колонизацией A. muciniphila и воспалительными состояниями. Фактически А . muciniphila присутствует в небольших количествах у людей, страдающих ожирением, диабетом и кардиометаболическими заболеваниями, что подтверждает их роль в качестве штамма против ожирения [79].

Роль оси желудочно-кишечного тракта гипоталамус-гипофиз-надпочечники в предрасположенности к ожирению до сих пор не полностью изучена [18, 70]. Недавно в одном исследовании описывалась взаимосвязь диеты с высоким содержанием жиров и уровней ацетата, продуцируемого кишечной микробиотой, на модели крыс [80]. Авторы пришли к выводу, что хронический обмен ацетата активирует парасимпатическую нервную систему, которая координирует секрецию стимулированного глюкозой инсулина, грелина и гиперфагии. Они пришли к выводу, что вместе эти факторы способствуют развитию ожирения [80].Ожирение, вызванное диетой с высоким содержанием жиров, также приводит к хроническому воспалению гипоталамуса низкой степени и активации как микроглии, так и астроцитов [81]. Исследование на мышиной модели предполагает, что ацетат накапливается в гипоталамусе. Это соединение играет центральную роль в предотвращении увеличения веса за счет аноректического эффекта [82]. Нейро-иммуно-эндокринный путь имеет решающее значение для гомеостаза глюкозы и контроля ожирения у людей с ожирением, восстанавливающихся после бариатрической хирургии [80]. После бариатрической хирургии с помощью методов обходного желудочного анастомоза по Ру (RYGB) модели людей и животных меняют пищевые предпочтения [83, 84].Обычно производное жирной кислоты, называемое олеоилэтаноламидом (OEA), образуется после приема жирной пищи. OEA может напрямую активировать рецепторы PPAR- α , которые отвечают за обеспечение насыщения через блуждающий нерв и высвобождение дофамина в головном мозге [84]. Животные с ожирением с подавлением дофамина демонстрируют низкий уровень OEA в головном мозге. После операции RYGB у этих животных повышается уровень экспрессии OEA и рецептора дофамина 1 (D1R), что способствует сдвигу в передаче сигналов оси GI-мозг. Это приводит к резкому изменению пищевого поведения животных, в том числе к предпочтению нежирной пищи [84].Известно также, что RYGB глубоко влияет на секрецию многих желудочно-кишечных гормонов, включая грелин и GLP-1 [83]. Введение экзогенного GLP-1 или аналога GLP-1 способствует снижению веса и регуляции глюкозы у пациентов с СД2. Примечательно, что метформин, лекарство, используемое для лечения СД2, может увеличивать количество бактерий, продуцирующих бутират, и тем самым способствовать восстановлению здорового микробиома [85]. Вместе эти открытия открыли новые перспективы для будущих методов лечения, направленных на улучшение здоровья за счет воздействия на основные клетки-хозяева, микробы и метаболиты, полученные из микробиома.

6. Нацеленность на дисбактериоз кишечной микробиоты и метаболические пути
6.1. Пробиотики и пребиотики

Иммунолог Эли Мечников был первым, кто заявил, что употребление ферментированного молока (т.е. йогурта), приготовленного из Bacillus bulgaricus , улучшает здоровье и продлевает продолжительность жизни. Он предвидел рациональное использование пробиотиков из живых микроорганизмов с пользой для здоровья за счет изменения микробиома кишечника [86]. Lactobacillus plantaram и Bifidobacterium — это пробиотические бактерии, способные модулировать негативные эффекты диеты с высоким содержанием жиров и даже управлять иммунологическими реакциями, опосредованными воспалительными заболеваниями [25, 38, 45]. Bifidobacterium и Lactobacillus являются продуцентами фолиевой кислоты в кишечнике. Lactobacillus rhamnosus в сочетании с Lactobacillus gasseri и Bifidobacterium lactis может снизить прибавку в весе, в частности, ожирение жировой ткани у людей [87]. Исследования эффектов A. muciniphila , живого или пастеризованного, на мышах, получавших диету с высоким содержанием жиров, показали, что небольшой белок Amuc_1100 (30 кДа) активирует TLR2, что способствует развитию иммунного ответа на здоровье кишечника [79].

Известно, что диетические пребиотики обеспечивают иммунную и метаболическую пользу хозяину [14, 86]. Плохо усваиваемые углеводы, такие как некрахмальные полисахариды, резистентный крахмал, неперевариваемые олигосахариды (NDO) и полифенолы, являются источником различных сахаров, включая глюкозу, галактозу, рамнозу и рутинозу. Ферменты микробиоты толстой кишки, гидролизующие углеводы, способствуют ферментации пребиотиков, которые производят водород, метан, диоксид углерода и SCFA. Когда они связаны, пробиотик и пребиотик могут избирательно стимулировать рост и активность полезных для здоровья бактерий [14, 86].Таким образом, пробиотики и пребиотики могут модулировать метаболические процессы, связанные с СД2 и расстройствами, связанными с ожирением [14, 86]. Прием инулина или олигофруктозы улучшает метаболические нарушения, связанные с ожирением, включая инсулинорезистентность и метаболическую эндотоксемию [34, 71, 79]. Эти эффекты могут быть связаны с восстановлением целостности кишечного барьера и снижением высвобождения ЛПС грамотрицательными бактериями [25, 88].

6.2. Фекальный микробный трансплантат (FMT)

Использование антибиотиков постоянно изменяет микробное сообщество кишечника [89].Высокие дозы и частота приема антибиотиков, особенно против анаэробов, таких как ванкомицин, могут нарушить и дестабилизировать нормальный микробиом кишечника. Антибиотик расширенного спектра действия вызывает чрезмерный рост Clostridium difficile и хронический рецидивирующий колит [89]. Фекальная бактериотерапия — это клиническая процедура, при которой жидкая суспензия стула от человека-донора (члена семьи или здорового донора) инокулируется пациентам кишечника для восстановления микробиоты кишечника в рефрактерных случаях колоректальной инфекции Clostridium difficile антибактериальная терапия [90, 91].Эти фекальные препараты могут содержать от 3,0% до 10% жизнеспособных мертвых бактерий и клеток толстой кишки и других компонентов, которые влияют на результаты трансплантации, усиливая или подавляя иммунную функцию врожденных лимфоидных клеток (ВЛК) [92]. Сегодня проводится более 150 клинических испытаний с участием FMT, в основном в США, для лечения большого количества метаболических, инфекционных и иммунологических заболеваний и осложнений, включая пациентов с трансплантированными почками и печенью, особенно с бактериальной колонизацией, устойчивой к антибиотикам или инфекция (ClinicalTrials.gov).

Исследования показали, что около 90% пациентов, получавших FMT по поводу инфекции Clostridium difficile , были излечены, по сравнению с 31% пациентов, получавших только ванкомицин (van Nood et al. [93]). Известно, что Lactobacillus , Enterococcus , Bifidobacterium и Bacteroides обладают ингибирующей активностью против роста C. difficile . Например, вместе с FMT переносятся различные вирусы, археи, грибы, паразитические виды и метаболиты [92].Таким образом, необходимы дальнейшие исследования, чтобы подтвердить их способность потенциально способствовать развитию кишечного иммунитета хозяина при оптимизации разнообразия микробиома.

Серия исследований на животных моделях показала, что микробиом кишечника играет решающую роль в увеличении веса и ожирении [49, 50, 70]. Исследования на мышах и крысах с худым и генетическим ожирением (ob / ob) выявили большие различия в их кишечной абсорбции и составе микробиома, которые связаны с 50% сокращением Bacteroidetes и пропорциональным увеличением видов Firmicutes и Archaea [74, 75].Перенос микробиоты от толстых мышей к свободным от микробов мышам-хозяевам вызывает больший набор веса, чем у тех, кто получает микробиоту от худых доноров [49, 50]. Потребление большого количества жиров увеличивает проницаемость кишечника и распространение ЛПС, связанное с ожирением. Напротив, введение Bifidobaterium infantis мышам снижает продукцию провоспалительных цитокинов, одновременно способствуя приросту белой жировой ткани [68, 71]. Результаты лечения FMT людей с различными метаболическими нарушениями неубедительны.Перенос кишечной микробиоты от худых доноров слегка повысил чувствительность к инсулину у пациентов с метаболическим синдромом [94]. Кратковременное воздействие антибиотиков может улучшить периферическую чувствительность к инсулину у небольшого числа лиц с ожирением [94]. Кроме того, в исследовании с 75 добровольцами с ожирением и предиабетом, которые прошли 8-дневную терапию антибиотиками (амоксициллин и ванкомицин), дисбиоз, вызванный антибиотиками, не повлиял на проницаемость кишечника, что подтверждается вариациями уровней ЛПС и экспрессии липидных метаболических ферментов [ 95].Такая неоднородность может отражать сложные взаимодействия между генетическими факторами, образом жизни и факторами окружающей среды, полученными из различных модельных систем.

6.3. Small Molecules

Ацетат, пропионат и бутират являются наиболее важными SCFAs, которые в конечном итоге вводятся в виде пероральных пищевых добавок. SCFAs, действующие как сигнальные молекулы, вызывают у человека различные физиологические эффекты [96]. Они связываются с рецепторами GPR41 и GPR43 (рецепторы свободных жирных кислот 2 и 3, FFARs 2/3) в L-клетках кишечника, сигнализируя о высвобождении GLP-1 и пептида YY [78].Примечательно, что инъекция пептидов GLP-1 стимулирует передачу сигналов инсулина в белых жировых тканях, тем самым уменьшая ожирение. SCFAs также увеличивают секрецию лептина и адипогенез, ингибируя липолиз жировой ткани. В печени пропионат действует как глюконеогенный фактор, а ацетат и бутират действуют как липогенные факторы [96]. SCFAs, в частности, пропионовая и масляная кислоты, могут напрямую предотвращать низкую воспалительную реакцию при ожирении, контролируя микробиоту кишечника [88]. Бутират, действующий на человеческие моноциты, ДК костного мозга и макрофаги, подавляет продукцию IL-12, снижает экспрессию костимулирующих молекул и блокирует транслокацию NF- κ B [37].Добавка бутирата, структурного аналога и кетонового тела β -гидроксибутирата (также известного как 3-гидроксибутират) может подавлять активность гистондеацетилаз (HDAC). HDACS способствует специфическим модификациям гистонов для регулирования транскрипции, репликации и репарации ДНК. Он также проявляет противовоспалительную активность, подавляя активацию NF- κ B и STAT1 [22–95]. Сукцинат является хорошо известным ингибитором гистоновых деметилаз (DNMT) и одиннадцати транслокационных (TET) метилцитозиндиоксигеназ, которые окисляют 5-метилцитозины, способствуя деметилированию ДНК [22].

Несколько низкомолекулярных ингибиторов метаболических путей, таких как 2-дезоксиглюкоза, дихроацетат, BPTES (бис-2- (5-фенилацетамидо-1,3,4-тиадиазол-2-ил) этилсульфид), диметилмалонат (DMM) , ротенон и метформин считаются многообещающими терапевтическими средствами [51, 52, 60]. Метформин — препарат первой линии для лечения СД2, который значительно улучшает метаболические параметры, такие как масса тела, уровень инсулина, глюкозы, лептина и С-реактивного белка в плазме [96]. Ингибируя комплекс I в дыхательной цепи митохондрий, метформин повышает уровень лактата в плазме.Лактоацидоз — критическая проблема в клинической практике. Метформин вызывает переключение с OXPHOS на аэробный гликолиз [97]. Таким образом, у лиц, принимающих метформин, выше риск развития метформин-ассоциированного лактоацидоза. Лечение метформином значительно увеличивает относительное количество A. muciniphila в фекальной микробиоте мышей с ожирением [34]. А . muciniphila является продуцентом ацетата и пропионата посредством деградации муцина, и у пациентов с СД2, получавших метформин, увеличивается количество бактерий, продуцирующих бутират и пропионат, что, в свою очередь, может способствовать положительному эффекту метформина [85].Интересно спросить, связаны ли эффекты метформина также с путями метаболического репрограммирования макрофагов M1 / ​​M2.

Сукцинат — сильный провоспалительный медиатор [51, 63]. DMM подавляет выработку митохондриальных АФК за счет ингибирования сукцинатдегидрогеназы (SDA), которая превращает сукцинат в фумарат. Это метаболическое изменение ограничивает продукцию IL-1 β , одновременно увеличивая синтез иммунодепрессивного IL-10 [67]. TEPP-46 и DASA-58, два низкомолекулярных ингибитора PKM2 (изофермент пируваткиназы 2), ингибируют LPS-индуцированный HIF-1 α и IL-1 β , тем самым способствуя репрограммированию макрофагов M1 в M2 [63 , 98].Таким образом, необходимы дальнейшие исследования для подтверждения этих фармакологических целей и подходов к контролю метаболических нарушений.

7. Выводы и перспективы

За последнее десятилетие секвенирование и анализ большого количества человеческих микробиомов и сборка их метаболических путей расширили наше понимание того, как бактериальные метаболиты участвуют во взаимодействиях микробов и хозяев при здоровье и болезнях. . Функциональные вариации микробиомов кишечника у разных людей показали, что анаболические и катаболические пути имеют важное значение для поддержания основных структур сообщества для гомеостаза всего тела.Появляющиеся новые биомаркеры обещают специфическое различение типов и видов, чтобы подтвердить доказательства прямого участия микробов в диабете II типа, ожирении, метаболических нарушениях, воспалительных заболеваниях кишечника и даже некоторых видах рака.

Нет сомнений в том, что дисбиоз, изменяя метаболизм микробиома и, следовательно, метаболизм хозяина, не только влияет на воспалительные реакции и адаптивный иммунитет, но также способствует метаболическим нарушениям. Использование инновационных фармацевтических и нутрицевтических продуктов для управления микробной колонизацией и развития здорового кишечного микробного сообщества в раннем детстве и во взрослом возрасте может предотвратить возникновение распространенных воспалительных и метаболических патологий.Наконец, открытие и разработка лекарств, которые нацелены на ферменты метаболических путей, а также вызывают про- и противовоспалительные реакции иммунных клеток, в ближайшем будущем обеспечат новую передовую медицину для метаболической терапии.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

JEB, JF и MGM провели процесс обзора литературы и отобрали статьи, написали рукопись и подготовили рисунки.Авторы прочитали и утвердили окончательную рукопись.

Благодарности

Мы благодарим коллег из Университета Сан-Паулу и Клинической больницы Медицинской школы за идеи и продуктивные обсуждения. Финансовая поддержка со стороны Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (2011 / 188-37), Conselho Nacional de Desenvolvimento Científico e Tecnológico (308794 / 2014-1 и 312206 / 2016-0) и Fundação de Ampaaro Estado de São Paulo (2007 / 04513-1 и 2015 / 18647-6) признателен.

Счет кишечного дисбиоза, барьерной дисфункции и бактериальной транслокации для системного воспаления, связанного с ХБП

Резюме

ХБП ассоциируется с системным воспалением, но основная причина неизвестна. Здесь мы исследовали участие кишечной микробиоты. Мы сообщаем, что у мышей с дефицитом коллагена типа 4 α 3 с прогрессирующей ХБП, связанной с синдромом Альпорта, наблюдается системное воспаление, включая повышенные уровни в плазме пентраксина-2 и активированных антигенпредставляющих клеток, Т-лимфоцитов CD4 и CD8 и Th27– или IFNγ. –Продуцирование Т-клеток в селезенке, а также подавление регуляторных Т-клеток.Системное воспаление, связанное с ХБП, у этих мышей, связанное с кишечным дисбиозом в виде цветения протеобактерий, транслокацией живых бактерий через кишечный барьер в печень и повышенными уровнями бактериального эндотоксина в сыворотке крови. Уремия не влияла на высвобождение секреторного IgA в просвет подвздошной кишки или лейкоциты слизистой оболочки. Чтобы проверить причинно-следственную связь между дисбактериозом и системным воспалением при ХБП, мы искоренили факультативную анаэробную микробиоту с помощью антибиотиков. Эта ликвидация предотвратила бактериальную транслокацию, значительно снизила уровни эндотоксина в сыворотке и полностью вернула все маркеры системного воспаления до уровня неуремического контроля.Таким образом, мы заключаем, что уремия связана с дисбиозом кишечника, дисфункцией кишечного барьера и бактериальной транслокацией, которые вызывают состояние стойкого системного воспаления при ХБП. Уремический дисбактериоз и дисфункция кишечного барьера могут быть новыми терапевтическими мишенями для вмешательства, направленного на подавление системного воспаления, связанного с ХБП, и его последствий.

ХБП связана со стойким системным воспалением, приводящим к эндотелиальной дисфункции, атерогенезу и сердечно-сосудистым заболеваниям, 1 , но основная причина системного воспаления, связанного с ХБП, все еще неясна.Считалось, что причиной этого явления являются связанные с диализом катетерные инфекции, загрязненная вода или небиосовместимые трубки и диализные фильтры. Однако уровни циркулирующего бактериального эндотоксина в сыворотке крови повышаются от 2 стадии до 5 стадии ХБП, 2 , что предполагает наличие эндогенного источника бактериального эндотоксина. Здесь мы сосредоточимся на микробиоте организма как на потенциальном триггере системного воспаления, связанного с ХБП.

Микробиота представляет собой в 10 раз больше бактериальных клеток, чем человеческих клеток, находящихся на внешней и внутренней поверхностях тела. 3 Симбионты ограничивают рост патобионтов и дисбактериозов. 4 Симбионты кишечника производят важные питательные вещества, такие как витамин К и компоненты, регулирующие многочисленные метаболические процессы в организме. 5 Исследования на стерильных мышах показали, что микробиота формирует и обучает иммунную систему в раннем возрасте. 6 Однако эпителиальные барьеры должны удерживать микробиоту вне организма, чтобы избежать бактериальной транслокации, системного воспаления и смертельных инфекций. 7,8 Дисбиоз, дисфункция кишечного барьера и бактериальная транслокация хорошо описаны как вызывающие и поддерживающие воспаление при воспалительном заболевании кишечника, 9 портальной гипертензии, 7 или сердечной недостаточности. 10 Таким образом, мы предположили, что метаболические изменения во время уремии аналогичным образом способствуют дисбактериозу кишечника и бактериальной транслокации как триггеру устойчивого состояния системного воспаления, связанного с ХБП.

Мы выбрали мышей с дефицитом коллагена 4 α 3 ( Col4a3 ), чтобы ответить на нашу гипотезу, потому что у этих мышей спонтанно развивается прогрессирующий гломерулосклероз и ХБП (нефропатия Альпорта) без каких-либо хирургических, токсических или диетических вмешательств, которые могут повлиять на микробиота за пределами метаболических изменений уремии (рис. 1, A и B). 11 Уремия у 9-недельных мышей с дефицитом Col4a3- была связана с сывороточными уровнями пентраксин-2 / амилоидного P-компонента сыворотки, который является функциональным мышиным гомологом человеческого С-реактивного белка, который служит маркером системного воспаление у мышей (рис. 1С). Кроме того, мы проанализировали фенотипирование спленоцитов на 9 неделе, поскольку селезенка удаляет антигены, передающиеся с кровью, и инициирует врожденные и адаптивные иммунные ответы против патогенов. Проточная цитометрия показала, что уремия у мышей с дефицитом Col4a3- была связана с увеличением количества активированных CD4 и CD8 Т-лимфоцитов (маркер активации CD69) и Т-клеток CD4, продуцирующих IL-17– или IFN γ (рис. 1D).Напротив, количество Foxp3 + регуляторных Т-клеток было снижено по сравнению с неуремическими контрольными мышами (рис. 1D). Кроме того, увеличилась популяция активированных (CD86 +) CD11c + антиген-презентирующих клеток (рис. 1D), что указывает на общее состояние системной иммунной активации у уремических мышей с дефицитом Col4a3 и Col4a3 .

Рисунок 1.

Системное воспаление у мышей с уремическим Col4a3-дефицитом. (A) Гломерулярная и тубулоинтерстициальная патология у 9-недельных мышей с дефицитом Col4a3 в возрасте года проиллюстрирована периодическим окрашиванием кислоты-Шиффа.Репрезентативные изображения показаны с исходным увеличением × 400. (B) ХБП иллюстрируется прогрессирующим снижением СКФ, измеренным по чрескожному клиренсу синистрина FITC у находящихся в сознании мышей. (C) Сывороточные уровни пентраксина-2 (PTX2) / сывороточного амилоида P (SAP) эквивалентны человеческому PTX1 / C-реактивному белку и указывают на системное воспаление в возрасте 9 недель. (D) Проточно-цитометрический анализ лимфоцитов и миелоидных клеток в селезенке 9-недельных неуремических мышей дикого типа и уремических мышей Col4a3 -дефицитных показывает значительное увеличение количества активированных Т-клеток и миелоидных мононуклеарных фагоцитов CD11c +.Данные представляют собой средние значения ± SEM не менее пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; ** P <0,01 по сравнению с диким типом; *** P <0,001 по сравнению с диким типом.

Предполагая, что системное воспаление при уремии связано с изменениями кишечной микробиоты, мы сначала охарактеризовали кишечную микробиоту у мышей с дефицитом Col4a3 и мышей дикого типа количественно и качественно. Хотя мы обнаружили среднее факультативное количество анаэробных бактерий 10 5 -10 6 КОЕ / г фекалий у мышей дикого типа в возрасте от 3 до 9 недель, прогрессирующая ХБП у мышей с дефицитом Col4a3 была связана с увеличением факультативного Число анаэробных бактерий в 5–10 раз по сравнению с мышами дикого типа того же возраста (рис. 2A).Ампликонное секвенирование бактериальных генов 16S рРНК было выполнено для характеристики состава фекальной микробиоты у 3- и 9-недельных уремических и неуремических мышей. α — Разнообразие, мера сложности микробиоты, было немного, но не значительно увеличено у 9-недельных мышей, что соответствует увеличению видового богатства с возрастом. Аналогичным образом не было обнаружено значительных различий между мышами дикого типа и мышами с дефицитом Col4a3 (дополнительные рисунки 1 и 2). β -Разнообразие, показатель сходства между различными микробными популяциями, определяли путем анализа невзвешенных и взвешенных матриц расстояний UniFrac.Невзвешенные расстояния UniFrac позволяют сравнивать микробные сообщества в филогенетическом контексте на основе наличия или отсутствия таксонов (членство в сообществах), тогда как взвешенные UniFrac также включают информацию об относительной численности (структура сообщества). Существенные различия были определены только с помощью невзвешенного UniFrac между мышами дикого типа и мышами с дефицитом Col4a3 в возрасте 9 недель и между мышами дикого типа в возрасте 9 недель и мышами с дефицитом Col4a3 в возрасте 3 недель (дополнительный рисунок 3).В частности, в возрасте 9 недель относительная численность протеобактерий Alcaligenaceae β (среднее ± SEM) составляла от 0,09% ± 0,03% до 0,94% ± 0,42% ( P > 0,50), относительная численность Verrucomicrobiaceae (средняя ± SEM) составляла от 0,04% ± 0,01% до 7,90% ± 6,95% ( P > 0,50), относительная численность Bacteroidetes-Bacteroidaceae (среднее ± SEM) составляла от 1,45% ± 0,72% до 10,65% ± 3,72% ( P <0,50), а относительная численность Bacteroidetes-Porphyromonadaceae (среднее ± SEM) составляла 0,92% ± 0.От 25% до 3,05% ± 1,05% ( P > 0,50) у Col4a3-дефицитных уремических мышей, тогда как Bacteroidetes-Bacteroirales были снижены у уремических мышей (от 48,05% ± 7,97% до 24,57% ± 10,46%; P <0,001) (Рисунок 2B). Связанный с уремией дисбактериоз не был связан с какими-либо изменениями подтипов иммунных клеток стенки тонкой кишки или высвобождением секреторного (-ых) IgA (таблица 1). Следовательно, мы заключаем, что прогрессирующая ХБП и сопровождающая ее уремия у мышей с дефицитом Col4a3 связаны с цветением протеобактерий и дисбиозом.

Рисунок 2.

Уремия влияет на разнообразие микробиоты и барьерную функцию кишечника. (A) Количественный дисбиоз, измеряемый в количестве КОЕ на грамм фекалий, наблюдается у мышей с дефицитом Col4a3 по сравнению с животными дикого типа. С возрастом у Col4a3 -дефицитных мышей развился еще более значительный количественный дисбиоз. (B) Относительное количество различных бактериальных таксонов, обнаруженных в образцах фекалий. Изменения в составе микробиоты кишечника, которые могут быть объяснены старением, обнаруживаются у мышей в возрасте 3 и 9 недель в обеих линиях.Сравнение мышей с дефицитом Col4a3 и дикого типа в возрасте 9 недель показывает различия в отрядах Bacteroidales, Burholderiales (семейство Alcaligenaceae), Enterobacteriales и Verrucomicrobiales. Подробная информация, включая статистику, приведена в дополнительной таблице 1. (C) Бактериальные колонии выросли из ткани печени уремических мышей с дефицитом по Col4a3 , но не из неуремических мышей дикого типа. (D) Сыворотки уремических и неуремических мышей были проанализированы с использованием анализа лизата амебоцитов limulus и показали значительно повышенные уровни бактериального эндотоксина.(E) Эксперименты ECIS демонстрируют значительное снижение средней устойчивости в одноклеточных слоях клеток Colon26 после обработки сывороткой мышей с уремическим Col4a3 -дефицитом (момент времени отмечен стрелками) по сравнению с клетками, обработанными сывороткой мышей дикого типа. . Данные представляют собой средние значения ± SEM не менее пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; *** P <0,001 по сравнению с диким типом.

Таблица 1. Проточная цитометрия лейкоцитов кишечника

у 8,5-недельных мышей с дефицитом Col4a3

Дисбиоз сам по себе может влиять на метаболические процессы или гомеостаз кишечника, но некоторая дисфункция барьера и бактериальная транслокация (продуктов) кажутся обязательными для объяснения системного активация иммунной системы отмечена у уремических мышей.Фактически, культуры печени выявили заражение культивируемыми живыми бактериями у 60% всех мышей с уремическим Col4a3-дефицитом (Рисунок 2C), что было связано с тенденцией к увеличению количества активированных макрофагов и дендритных клеток в печени (Таблица 2). Таким образом, мы перорально заражали уремических мышей комменсалом Escherichia coli , конститутивно экспрессирующим зеленый флуоресцентный белок (GFP), через желудочный зонд. Мы извлекли бактерии GFP + в 40% печени уремических мышей, но ни у одного из неуремических мышей (не показаны), что свидетельствует о транслокации даже живых бактерий из кишечного тракта.В соответствии с этими данными, у мышей с дефицитом Col4a3 в сыворотке крови наблюдалось значительное повышение уровня бактериального эндотоксина по сравнению с неуремическими мышами дикого типа (рис. 2D). Тщательный анализ стенки кишечника с помощью периодического окрашивания кислотой-Шиффом, иммуноокрашивания ZO-1 и просвечивающей электронной микроскопии не выявил структурных изменений, таких как язвы или диффузные аномалии плотного соединения, у мышей дикого типа и мышей с дефицитом Col4a3 (дополнительный рисунок). 4). Однако, когда культивируемые эпителиальные клетки толстой кишки подвергались действию сыворотки от мышей дикого типа с уремическим дефицитом Col4a3 или неуремической сыворотки, только уремическая сыворотка снижала трансэпителиальное сопротивление как маркер трансэпителиальной проницаемости (Рисунок 2E).

Таблица 2. Проточная цитометрия лейкоцитов кишечника

у 8,5-недельных мышей с дефицитом Col4a3 , получавших и не леченных антибиотиками

Чтобы проверить причинно-следственную связь между кишечной транслокацией бактерий, связанной с уремическим дисбиозом, и системным воспалением, мы обработали Col4a3 -дефицитные мыши с синергической пероральной комбинацией антибиотиков, которая уничтожила факультативную анаэробную кишечную микробиоту из кишечника и печени (рис. 3А). Истощение микробиоты значительно снизило уровни бактериального эндотоксина в сыворотке (рис. 3B) и внутрипеченочные уровни экспрессии мРНК пентраксина-2 / сывороточного амилоида P и IL-6 (рис. 3C).Соответственно, проточная цитометрия спленоцитов показала менее активированные Т-клетки и восстановление регуляторных Т-клеток (рис. 3D). Не было обнаружено влияния на функцию почек или профили внутрипочечных лейкоцитов (данные не показаны). Таким образом, мы делаем вывод, что уремический дисбиоз и бактериальная транслокация вызывают системное воспаление, связанное с ХБП.

Рисунок 3.

Уремическое системное воспаление корректируется уничтожением микробиоты. Все пунктирные линии в B и C представляют значения контрольных животных дикого типа.(A) Репрезентативные фотографии показывают полное уничтожение грамотрицательной фекальной флоры после лечения антибиотиками. График дот-блоттинга показывает КОЕ культур кала в возрасте 7 недель. На графике показаны результаты для неселективной среды, поскольку предел обнаружения (пунктирная линия) составляет 10 КОЕ / г фекалий. (B) Уровни эндотоксина в сыворотке с лечением антибиотиками и без него у мышей с дефицитом Col4a3 и без него. (C) Уровни экспрессии сывороточного амилоида P и IL-6 мРНК белка острой фазы при лечении антибиотиками и без лечения у мышей с дефицитом Col4a3 .(D) Проточная цитометрия суспензий клеток селезенки у мышей с уремическим дефицитом Col4a3 с лечением антибиотиками и без него. Данные представляют собой средние значения ± SEM не менее пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; ** P <0,01 по сравнению с диким типом.

Бактериальный эндотоксин является важным стимулом для активации иммунной системы через Toll-подобный рецептор 4 и каспазу 11 при грамотрицательном сепсисе с почечной недостаточностью или без нее. 12,13 Различные стадии ХБП и системного воспаления, связанного с ХБП, связаны с прогрессирующим увеличением циркулирующего бактериального эндотоксина, CD14 и других биомаркеров системного воспаления. 2,14,15 Кроме того, мочевина, секретируемая уремическим организмом в просвет кишечника, способствует развитию уреазообразующих бактерий, которые уже наблюдались у людей и аналогично нашим открытиям. 16,17 Некоторые типы уразуобразующих бактерий также участвуют в производстве так называемых уремических токсинов, таких как индол или п-крезол, которые, как известно, способствуют системному воспалению. В принципе, эта связь может иметь обе стороны ( например, , воспаление, связанное с ХБП, может способствовать проникновению эндотоксина, или проникновение уремического токсина / эндотоксина, связанного с ХБП, может способствовать воспалению).Наше исследование теперь подтверждает, что системная иммунная активация, связанная с ХБП, обратима при уничтожении микробиоты. Это означает, что именно микробиота является причиной системного воспаления, связанного с ХБП.

Системное введение антибиотиков влияет на микробиоту по всему телу, поэтому остается неясным, какая микробиота в каких областях больше всего способствует воспалению, связанному с ХБП. Однако кишечник содержит, безусловно, наибольшее количество бактериальных клеток, что мы также показали с помощью GFP-меченного E.coli , что транслокация бактерий через кишечный барьер происходит при ХБП. У уремических мышей даже живые бактерии достигают печени, вероятно, через кишечный эпителиальный барьер в воротную вену. Как может происходить эта транслокация, не совсем понятно. Сообщалось, что индуцированная аденином диета ХБП у крыс связана с диффузным распадом плотных контактов в эпителиальных клетках кишечника. 18-20 Поскольку Col4a3-дефицитные мыши со спонтанной CKD лишены этого феномена, возможно, что такие изменения связаны с индуцированной кристаллами аденина эпителиальной цитотоксичностью, а не с уремией per se .Фактически, кристаллы могут оказывать прямое цитотоксическое действие на эпителиальные клетки. 21 Тем не менее, мы и другие обнаружили, что уремическая (но не неуремическая) плазма увеличивает проницаемость монослоев кишечных эпителиальных клеток in vitro . 18 Следовательно, в качестве рабочей гипотезы, по крайней мере, очаговая дисфункция кишечного барьера должна способствовать бактериальной транслокации, и потенциально дисбактериоз кишечника выступает в качестве кофактора.

Связанное с ХБП увеличение кишечных протеобактерий представляет собой переход к потенциально патогенным бактериям (патобионтам), который часто ассоциируется с широким спектром заболеваний. 22 Наши результаты согласуются с несколькими предыдущими исследованиями на людях с уремией, 16 уремических крысах, 16 и уремических мышах. 23 Дисбактериоз кишечника связан со сдвигом секреторного профиля микробиоты, включая такие факторы, как триметиламин, метаболит фосфатидилхолина N –оксид, который может напрямую способствовать прогрессированию ХБП и сердечно-сосудистым заболеваниям. 24,25 Известно, что микробиота чувствительна к изменениям экосистемы, связанным с питанием или метаболизмом. 26,27 Метаболические изменения уремии, включая метаболический ацидоз и азотемию, дают многочисленные объяснения изменениям микробиоты. 26,27 Попытки исправить уремический дисбиоз с помощью пробиотических препаратов основаны на идее модулировать уремический дисбиоз с помощью целенаправленных вмешательств. 28 Вместе мы заключаем, что дисбактериоз кишечника, дисфункция барьера и бактериальная транслокация являются причиной системного воспаления при ХБП и потенциально полностью обратимы.

Краткие методы

Исследования на животных

Col4a3 –дефицитные и однопометные мыши дикого типа с идентичным генетическим фоном Sv129 были выведены в определенных условиях содержания, свободных от патогенов, размещены в одних и тех же клетках и генотипированы, как описано ранее. 29 В возрасте 6 недель группы из Col4a3 -дефицитных мышей и мышей дикого типа были рандомизированы для перорального введения 25 мг / кг неомицина, 60 мг / кг ампициллина или 25 мг / кг метронидазола один раз в день. в течение 12 дней.Некоторым мышам E.coli штамм MG1655, несущий плазмиду pM979 для конститутивной экспрессии GFP, вводили через желудочный зонд на 13 день. 30 Органы (почки, печень и селезенка) собирали в стерильных условиях перед приготовлением подвздошной кишки и толстой кишки. Все исследования на животных были одобрены этическим комитетом местного правительства.

СКФ и биотесты

СКФ

измеряли у мышей в сознании с использованием чрескожной детекторной системы для кинетики клиренса синистрина FITC (Mannheim Pharma & Diagnostics GmbH), как описано. 31 Пункцию сердца выполняли в стерильных условиях, и для количественного определения уровней LPS в плазме использовали анализ лизата амебоцитов limulus (HIT302; Hycult Biotech, PB Uden, Нидерланды). Уровни амилоида P в сыворотке определяли с помощью коммерческого набора Mouse Pentraxin 2 / SAP Quantikine ELISA Kit (R&D Systems, Миннеаполис, Миннесота).

Количественная оценка и квалификация бактерий

КОЕ Количество

Свежие фекалии растворяли в 500 мкл л PBS, разбавляли и высевали в объеме 50 мкл л на чашки с агаром MacConkey в качестве селективной среды для грамотрицательных бактерий и LB чашки с агаром в качестве неселективной среды.Планшеты инкубировали 1-2 дня при 37 ° C в аэробных условиях; 2–3 г ткани органа препарировали в стерильных условиях путем процеживания через стерильное сито с размером ячеек 70- мкм и шириной ячеек мкм и тщательно промывали 500- мкл мкл PBS, и 100 мкл мкл высевали на чашки с агаром MacConkey. Для количественной оценки устойчивости к ампициллину E. coli MG1655 pM979 мы использовали агар, содержащий ампициллин (100 мкМ мкг / мл). Все количества КОЕ были рассчитаны на вес введенного образца стула или ткани с пределом обнаружения 10 КОЕ / г для кала и 60 КОЕ / г для печени.

Выделение ДНК из стула
и секвенирование ампликона гена 16S рРНК

QIAamp DNA Stool Mini Kit (51504; Qiagen, Germantown, MD) использовали для извлечения гДНК из свежесобранных образцов фекалий обеих линий мышей. Вариабельные области V3 – V6 гена 16S рРНК амплифицировали с помощью ПЦР с использованием фекальной гДНК. ПЦР состояла из двух последовательных этапов. Были использованы праймеры, нацеленные на ген 16S рРНК (курсив), и специфические праймеры, несущие адаптеры 5’M13 / rM13 (жирный шрифт) 338F-M13 ( GTAAACGACGGCCAGTG CTCCTACGGGWGGCAGCAGT ) и 1044R-rMATAC 900CGACCTAC 900CAGCAC 900 (6 6 GGAAACACM13 (6 GGAAACAC). область V3 – V6 бактериального гена 16S рРНК.Одна реакция ПЦР содержала по 500 нМ каждого праймера (338F-M13 и 1044R-rM13), 2 × DreamTaq PCR Master Mix и 50 нг матричной гДНК. Реакцию ПЦР проводили в двух экземплярах с использованием 2-кратного градиентного термоциклера peqSTAR (Peqlab Biotechnology). Условиями ПЦР были 95 ° C в течение 10 минут, затем 20 циклов при 95 ° C в течение 30 секунд, 55 ° C в течение 30 секунд и 72 ° C в течение 45 секунд и заключительный этап элонгации при 72 ° C в течение 10 минут. Двойные реакции были объединены и загружены в 1% агарозный гель для подтверждения успешной амплификации ПЦР.После очистки продуктов ПЦР с использованием набора NucleoSpin Gel и PCR Clean-Up Kit в соответствии с инструкциями производителя, концентрацию и качество очищенных продуктов ПЦР оценивали с помощью Nanodrop (Peqlab Biotechnology). Для штрих-кодирования каждого продукта ПЦР определенной последовательностью MID и добавления тега Lib-L, специфичного для 454, была проведена вторая ПЦР с использованием специфичных для M13 / rM13 праймеров, содержащих праймеры для 454-специфичного Lib-L (подчеркнуты) A-M13 (CCATCTCATCCCTGCGTGTCTCCGACTCAG / MIDsequence / GTAAACGACGGCCAGG ) и B-rM13 ( CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGGAAACAGCTATGA CCATGA ).В таблице 3 перечислены 40 различных штрих-кодов MID с коррекцией ошибок длиной 10 п.н. для мультиплексирования. ПЦР выполняли с использованием 400 нМ каждого праймера (A-M13 и B-rM13). Ампликоны второй ПЦР объединяли и очищали осаждением этанолом. Очищенные продукты ПЦР обрабатывали на 0,8% агарозном геле, полосы, соответствующие последовательностям гена 16S рРНК со штрих-кодом, вырезали, и ДНК экстрагировали с использованием NucleoSpin Gel and PCR Clean-Up Kit. ДНК элюировали ddH 2 O, дополнительно очищали с использованием гранул AMPure Beads (Beckman Coulter, Inc., Brea, CA), и, наконец, ресуспендировали в ddH 2 О. Концентрацию и качество очищенных штрих-кодированных последовательностей оценивали с помощью Nanodrop (Peqlab Biotechnology). Образцы хранили при -20 ° C. Секвенирование ампликона выполняли в Eurofins на титановой платформе 454 GS FLX с одной стороны (Lib-L-A) в соответствии с рекомендованными процедурами для 454 Roche (Roche, Базель, Швейцария).

Таблица 3.

штрих-кодов MID для мультиплексирования 454

Биоинформатический анализ

Данные были проанализированы, как описано недавно. 32 Вкратце, необработанные последовательности были предварительно обработаны с использованием FASTX-Toolkit и UCHIME. Последовательности, прошедшие качественную фильтрацию (минимальное качество 20), были демультиплексированы и обрезаны для удаления коротких чтений (минимальная длина 100). Последовательности проверяли на химеры (UCHIME; стандартные параметры) с использованием справочной базы данных microbiomeutils (r20110519). Самописный сценарий создал файл сопоставления и файл fastA, которые использовались в качестве входных данных для количественного анализа микробной экологии (QIIME).

Обработка

Последовательности анализировали с использованием пакета QIIME. Последовательности были отнесены к рабочим таксономическим единицам с парной идентичностью uclust 97%, а затем классифицированы таксономически с использованием классификатора RDP. Диаграммы показывают относительную численность таксонов на уровне типа в наборах данных (среднее значение ± SEM; n = 5). Репрезентативный набор последовательностей был выровнен с использованием PyNAST. Выравнивание было использовано для построения филогенетического дерева с помощью FastTree. Дерево использовалось для расчета расстояний UniFrac между образцами. 33 PERMANOVA 34 использовалась для проверки статистической значимости группировок выборок на основе различных матриц расстояний UniFrac. Для измерений разнообразия α был выполнен анализ разрежения для предполагаемого количества видов в каждой выборке с использованием алгоритма наблюдаемых видов в QIIME.

Оценка ткани

Части почек, подвздошной кишки и толстой кишки фиксировали в 10% формалине в PBS и заливали парафином; Срезы размером 4- мкм и длиной мкм окрашивали периодической кислотой-реактивом Шиффа.Для ультраструктурного анализа образцы толстой кишки 8-недельных обработанных и необработанных мышей вскрывали и фиксировали в 0,1 М буфере PBS (pH 7,4) с добавлением 0,4% параформальдегида и 2% глутаральдегида. Полимеризацию (с использованием свежей смолы Epon) проводили при 60 ° C в течение 24 часов, как описано. 35 В качестве первичных антител для иммуноокрашивания использовали следующие антитела: козий анти-ZO-1 и кроличий антиокклюдин (ab1

и ab64482, соответственно; Abcam, Inc., Кембридж, Массачусетс).

Количественная ОТ-ПЦР в реальном времени

Общая РНК была выделена с использованием набора для экстракции РНК (Life Technologies, Карлсбад, Калифорния) в соответствии с инструкциями производителя, и качество РНК оценивалось с использованием агарозных гелей.После выделения РНК была создана кДНК с использованием обратной транскрипции (Superscript II; Invitrogen, Carlsbad, CA). Систему обнаружения красителя SYBR Green использовали для количественной ПЦР в реальном времени на Light Cycler 480 (Roche) с использованием 18s рРНК в качестве домашнего гена. Ген-специфические праймеры, обработанные ensemble-BLAST и NCBI primer-BLAST (Metabion, Martinsried, Germany), использовали, как указано в таблице 4. Неэлементные контроли, состоящие из всех используемых реагентов, были отрицательными для генов-мишеней и генов домашнего хозяйства. Чтобы снизить риск ложноположительных точек пересечения, был использован алгоритм высокой достоверности.Профили кривых плавления анализировали для каждого образца для обнаружения возможных неспецифических продуктов или димеров праймеров. В качестве гена домашнего хозяйства использовали 18s РНК.

Таблица 4.

праймеров, используемых для количественной ОТ-ПЦР в реальном времени

Выделение и проточная цитометрия органических лейкоцитов и стимулированных Т-клеток

Суспензии одноклеточных клеток селезенки, печени и тонкого кишечника были приготовлены и окрашены для проточной цитометрии с использованием следующие антитела: анти-CD3 ε (клон 145–2C11; Becton Dickinson, Сан-Диего, Калифорния), анти-CD4 (клон RM4-5; Becton Dickinson), анти-CD8 (клон 53-6.7; Becton Dickinson), анти-CD69 (клон h2.2F3; Becton Dickinson), анти-FOXP3 (421403; BioLegend, Сан-Диего, Калифорния), анти-CD11c (клон HL3; Becton Dickinson), анти-F4 / 80 (клон MCA ; AbD Serotec), анти-CD86 (клон GL1; Becton Dickinson) и анти-IL-17 (ebio17B7; Becton Dickinson). Внутриклеточное окрашивание на FoxP3 и IL-17 проводили с использованием набора Cytofix / Cytoperm (Becton Dickinson). Анализ стимуляции Т-клеток проводили на клетках селезенки (прибл. 10 6 ) в 200 мкл мкл буфера PBS; Добавляли 50 нг / мл форболмиристатацетата и 1 мкМ г / мл иномицина и инкубировали при 37 ° C в течение 4.За 5 часов до окрашивания.

Исследования in vitro

Индуцированные уремической сывороткой изменения сопротивления и емкости бессмертных мышиных клеток толстой кишки-26 (лот 400156–812; CLS, Eppelheim, Germany) анализировали с использованием устройства измерения импеданса субстрата электрических клеток (ECIS). (Applied Biophysics Inc., Нью-Йорк, штат Нью-Йорк). Перед посевом клетки культивировали в RPMI Glutamax (Life Sciences, Гейдельберг, Германия) плюс 10% диализованной FCS (Life Sciences Heidelberg, Германия). Следовательно, 1.0 × 10 6 замороженных клеток (в 1,0 мл криосреды и 10% ДМСО в диализованной FCS) размораживали и повторно культивировали в указанных средах до слияния. Сначала для измерения ECIS лунки за пределами экспериментальной камеры были предварительно покрыты цистеином в течение 10 минут. Во-вторых, еще одно покрытие с 0,01% коллагена (кожа теленка 1 типа) наносили в течение ночи при 4 ° C. Клетки из того же пассажа засевали плотностью 600000 клеток на лунку в объеме 400 мкл среды мкл и инкубировали в течение ночи (37 ° C и 5% CO 2 ).Среду удаляли на следующий день и осторожно добавляли 360 мкл л свежей среды. Подготовленную камеру подключили к устройству ECIS (многоканальный режим) на 1 час без каких-либо манипуляций. Впоследствии была проведена проверка частоты, а затем еще 1 час в многоканальном режиме. Для стимуляции были взяты лунки без изменений по сопротивлению. Сливающиеся монослои стимулировали 40 мкл мкл сыворотки мышей Sv129 дикого типа (BUN = 24 мг / дл) или мышей с дефицитом Col4a3 (BUN = 240 мг / дл).После стимуляции сопротивление регистрировалось в течение приблизительно 18 часов. Начальная точка временной шкалы (рис. 2E) была установлена ​​на момент времени, когда был достигнут почти постоянный наклон кривых сопротивления.

Статистический анализ

Данные представлены как средние значения ± SEM. Сравнение отдельных групп проводилось с использованием тестов t или Манна – Уитни U . Нормальное распределение проверяли с помощью теста Шапиро – Уилка. Множественные группы анализировали с помощью ANOVA с последующими пост-тестами Бонферрони.Значение P <0,05 считалось показателем статистической значимости. ПЕРМАНОВА на невзвешенных и взвешенных матрицах расстояний UniFrac выполнялась в QIIME.

Благодарности

Мы благодарим Дэна Драгановича, Яну Мандельбаум и Мауэль Дикл за квалифицированную техническую помощь.

Этот проект поддержан Медицинским факультетом Мюнхенского университета. Части этого проекта были подготовлены в качестве докторской диссертации на медицинском факультете Мюнхенского университета М.С.К.

  • Copyright © 2016 Американское общество нефрологов

RACGP — Микробиом кишечника

Майенааз Сидху

Давид ван дер Поортен

Общие сведения

Более триллиона, в основном полезных, микробов обитают в нашем желудочно-кишечном тракте и отвечают за жизненно важные метаболические, иммунные и пищевые функции. Дисбиоз, то есть неадаптивный дисбаланс микробиома, связан со многими распространенными заболеваниями и является целью лечения.

Objective / s

В этой статье представлен обзор микробиома кишечника при его здоровье и болезнях, выделяя такие состояния, как инфекция Clostridium difficile , воспалительное заболевание кишечника, синдром раздраженного кишечника, ожирение и неалкогольная жировая болезнь печени, сопровождающаяся дисбактериозом. связано. Обсуждается информация о методах лечения, влияющих на микробиом кишечника, включая пробиотики и трансплантацию фекальной микробиоты.

Обсуждение

По мере того, как наши знания о микробиоме расширяются, мы, вероятно, лучше поймем сложные взаимодействия, вызывающие заболевания, и разработаем новые и более эффективные методы лечения многих распространенных состояний.

Триллионы бактерий, вирусов, грибов, архей и эукариотических организмов живут в желудочно-кишечном тракте человека и составляют то, что в совокупности называется микробиомом кишечника. Эти организмы составляют более 50% клеток человеческого тела и весят до 2 кг в среднем у взрослого человека. 1,2 В желудке и тонком кишечнике относительно мало организмов из-за кислой среды, присутствия желчи и панкреатического сока, а также эффектов перистальтики, которые ограничивают стабильную колонизацию.Таким образом, именно в толстой кишке подавляющее большинство (10 12 ) микробиоты живет и взаимодействует с человеческим хозяином. Наши знания о микробиоме кишечника человека с точки зрения здоровья и болезней быстро расширились за последние 10 лет благодаря увеличению доступности и снижению стоимости секвенирования генов. 3 Это предоставило убедительные доказательства жизненно важной роли кишечного микробиома в нормальном метаболизме, питании, иммунной функции, физиологии и профилактике заболеваний. Помимо прямого воздействия на слизистую оболочку кишечника и кишечную нервную систему, многие химические медиаторы, вырабатываемые микробиомом кишечника, попадают в кровоток и взаимодействуют с дистальными органами, такими как мозг, сердце и печень. 4

Микробиом в здоровье

Хотя стандартного определения здорового микробиома кишечника не существует, важными характеристиками являются микробиом с высоким уровнем разнообразия, стабильности, устойчивости к изменениям, связанным со стрессом (антибиотики, инфекции, иммуносупрессия), и высоким уровнем избыточности метаболических путей. 5

Развивающийся микробиом кишечника

Исторически кишечник in utero воспринимался как стерильная среда; однако появляющиеся данные свидетельствуют о том, что контакт с микробами начинается еще до рождения с материнской микробиоты. 6 Более обширная колонизация начинается при рождении и во время родов защитными вагинальными микробами, такими как Lactobacillus . Младенцы, родившиеся с помощью кесарева сечения и дети, не находящиеся на исключительно грудном вскармливании, могут быть колонизированы кожными и больничными бактериями, такими как Staphylococcus и Acinetobacter , в результате чего микробиом изначально менее разнообразен и менее здоров. 6,7 Эти младенцы кажутся более предрасположенными к развитию астмы, аллергического ринита, диабета и целиакии. 8 Развивающийся микробиом кишечника в первый год жизни похож на микробиом матери, но вскоре на него влияет множество факторов, включая диету, привычки питания и окружающую среду. 9 Зрелый микробиом кишечника устанавливается в возрасте от одного до трех лет и после этого становится относительно стабильным. К этому времени он в основном состоит из анаэробных бактерий, представленных более чем 50 типами и 1000 видами. Несмотря на это разнообразие, большинство микробов происходят из двух типов бактерий: Bacteroidetes и Firmicutes. 10

Метаболические и сигнальные функции

Микробиом кишечника отвечает за ряд жизненно важных метаболических и сигнальных функций, многие из которых недоступны одному человеческому организму. К ним относятся синтез всех витаминов группы B (B 1 –B 12 ) и витамина K, 11 обработка пищевых продуктов, переваривание сложных полисахаридов (крахмалы, целлюлоза и камеди), синтез незаменимых аминокислот, биотрансформация желчи, способствующая метаболизму глюкозы и холестерина, а также производство метаболитов короткоцепочечных жирных кислот, таких как бутират и ацетат, которые действуют как источник энергии для бактерий толстой кишки и могут оказывать противовоспалительное действие. 12 Некоторые частично усвояемые продукты, в свою очередь, могут обогатить определенные полезные микробные популяции, хотя прямая польза для здоровья еще не установлена. Примеры этих продуктов, часто называемых пребиотиками, включают злаки, спаржу, лук-порей, артишоки, бобовые, капусту и капусту. 12 Микробиота кишечника может также взаимодействовать с центральной нервной системой через несколько путей, включая блуждающий нерв, ось гипоталамус-гипофиз-надпочечники, производство нейротрансмиттеров или их предшественников, включая серотонин, триптофан, гамма-аминомасляную кислоту, дофамин, l -допа и норадреналин, а также через гормоны, такие как кортизол, грелин, лептин и глюкагоноподобный пептид -1. 13

Защитные иммунные функции

Нормальная микробиота кишечника — наша первая внутренняя линия защиты от патогенов и токсинов, защищающая организм от болезней в тандеме с иммунной системой хозяина. Одна из ключевых функций здорового микробиома — предотвращение колонизации болезнетворными микроорганизмами за счет барьерного эффекта. Это происходит за счет производства противомикробных соединений, таких как бактериоцин, и борьбы патогенов за питательные вещества и места прикрепления за счет огромной численности. 3 Кишечные бактерии также являются неотъемлемой частью развития врожденной иммунной системы слизистых оболочек за счет прямого взаимодействия с эпителиальными клетками кишечника. Раннее воздействие различных бактерий обеспечивает своего рода тренировку иммунной системы, так что нормальные защитные реакции возникают на комменсалов, а соответствующие воспалительные реакции возникают при воздействии патогенов. И наоборот, уменьшение разнообразия микробов и воздействие на них в раннем возрасте может привести к иммунной системе, которая чрезмерно реагирует на антигены, что предрасполагает к аутоиммунным и аллергическим заболеваниям. 14

Микробиом и болезни

Многие желудочно-кишечные заболевания связаны с изменениями микробиома кишечника, равно как и метаболические нарушения, заболевания печени, некоторые неврологические расстройства и расстройства настроения, артрит и иммунологические состояния. 15 Дисбиоз, означающий дисбаланс или дезадаптивное состояние микробиома, встречается почти во всех этих состояниях, хотя в большинстве случаев не установлено, является ли это причиной или следствием. Мы рассматриваем эти состояния с наибольшим количеством доказательств и обсуждаем исследования по модуляции кишечных бактерий в качестве терапии.

Clostridium difficile Инфекция

Clostridium difficile — спорообразующий грамположительный анаэроб, продуцирующий токсины A и B; последний отвечает за воспаление толстой кишки и развитие псевдомембранозного колита. Заболеваемость и тяжесть инфекции C. difficile (CDI) в Австралии и во всем мире растет: в 2012 г. в австралийских больницах было зарегистрировано более 12 000 случаев, что привело к относительной смертности в 6–7%. 16 C. difficile редко вызывает заболевание у здоровых взрослых; скорее, это требует нарушения нормальных механизмов резистентности и флоры хозяина, что чаще всего вызывается антибиотиками широкого спектра действия, иммуносупрессией или применением ингибиторов протонной помпы. 17

Традиционным лечением ИКД является метронидазол или ванкомицин и удаление вызывающего нарушение антибиотика; однако это оказывается все более неэффективным с частотой рецидивов до 50% и увеличением заболеваемости молниеносной болезнью.После публикации 2013 года Академического медицинского центра в Амстердаме, 18 было показано, что коррекция основного дисбактериоза с помощью трансплантации фекальной микробиоты (FMT) более эффективна и долговечна, чем терапия антибиотиками при рецидивирующей ИКД. Эти результаты были воспроизведены в Австралии. 19 Непосредственное воздействие FMT при тяжелом псевдомембранозном колите показано на Рисунке 1.

Рисунок 1. Тяжелая инфекция Clostridium difficile у пациента в возрасте 79 лет.
A. Псевдомембранозный колит; Б. Пять дней после трансплантации фекальной микробиоты

Воспалительное заболевание кишечника

Язвенный колит и болезнь Крона — хронические воспалительные состояния неизвестной этиологии, основной патогенез которых, по-видимому, связан с множеством факторов, включая генетическую предрасположенность, триггеры окружающей среды, измененную иммунную функцию и аномальные реакции на микробиом кишечника. Дисбиоз присутствует у пациентов с воспалительным заболеванием кишечника (ВЗК), характеризующимся более высоким соотношением патогенных и комменсальных бактерий, сниженным количеством бактерий в областях активного воспаления и участках бактериальной инвазии слизистой оболочки, что редко, если вообще когда-либо, наблюдается у здоровых людей. частные лица. 20 Модуляция кишечных бактерий антибиотиками, такими как ципрофлоксацин и метронидазол, является общепризнанным методом лечения для уменьшения послеоперационных рецидивов болезни Крона, в то время как пробиотики могут быть эффективны при паучите, связанном с ВЗК, после колэктомии. 21,22 В ряде исследований FMT рассматривался как лечение ВЗК, но с противоречивыми результатами. Систематический обзор небольших серий случаев показал общую эффективность 36%, при этом пациенты с болезнью Крона с большей вероятностью ответят на лечение, чем пациенты с язвенным колитом. 23 Австралийское рандомизированное плацебо-контролируемое исследование показало аналогичную эффективность при язвенном колите (44% ремиссия без стероидов) с использованием интенсивного протокола FMT с помощью колоноскопии и клизм в течение восьми недель. 24 В двух дополнительных рандомизированных контролируемых испытаниях язвенного колита одно не показало преимуществ перед плацебо, 25 , в то время как в другом FMT достигла ремиссии в 24% по сравнению с 5% в группе плацебо. 26

Синдром раздраженного кишечника

Синдром раздраженного кишечника (СРК) — распространенное заболевание, характеризующееся дискомфортом в животе и изменением привычки кишечника при отсутствии основной органической причины.Патофизиология СРК остается неясной, но, вероятно, будет многофакторной, с важными изменениями моторики и обработки пищи, висцеральной гиперчувствительностью, генетической предрасположенностью и изменениями в микробиоме кишечника. 27 Лица с СРК с преобладанием диареи имеют дисбактериоз, характеризующийся более низкой экспрессией филотипа Clostridium thermosuccinogenes , 28 , тогда как у людей с СРК и запором наблюдается увеличение количества бактерий, которые производят и используют лактат, что приводит к более высокому производству сульфидов и водорода. 29 Кроме того, СРК, возникающий после гастроэнтерита, хорошо распознается (постинфекционный СРК), и у пораженных людей наблюдаются изменения в Bacteroidetes и Clostridia по сравнению со здоровыми людьми из контрольной группы. 30 Изменение кишечных бактерий с помощью антибиотиков может помочь, и рифаксимин, наиболее хорошо изученный, показал умеренное симптоматическое улучшение при СРК с преобладанием диареи. Это привело к одобрению этого показания в США, но не в Австралии. 31 Систематический обзор и метаанализ показали, что пробиотики оказывают умеренное благотворное влияние на общие показатели боли в животе, вздутие живота и метеоризм при СРК, а комбинированные схемы более эффективны. 32 Из-за неоднородности исследований не удалось выделить конкретные полезные штаммы или режимы дозирования. Было показано, что диета с низким содержанием FODMAP, направленная на снижение ферментируемых олигосахаридов, дисахаридов, моносахаридов и полиолов, эффективна при СРК, но сама по себе может ограничивать количество бактерий в фекалиях, включая полезные бактерии. 33

Нарушение обмена веществ

Мировая эпидемия ожирения и связанных с ним метаболических заболеваний в первую очередь объясняется диетой и отсутствием физических упражнений; однако теперь ясно, что микробиом кишечника также играет роль друга и врага.Микробиота кишечника необходима для набора веса, вызванного диетой (рис. 2A), при этом мыши без микробов набирают минимальный вес, несмотря на диету с высоким содержанием жиров / сахара, тогда как идентичные мыши, содержащие кишечные бактерии, становятся тучными. 34 Дисбиоз, характеризующийся снижением численности Bacteroidetes и увеличением количества Firmicutes, изменяя их нормальное соотношение, был причастен к ожирению у мышей и людей; 35 однако, два недавних метаанализа объединенных исследований на людях не смогли выявить эти изменения в бактериальных типах, с лишь незначительным сокращением микробного разнообразия и богатства. 36,37 Тем не менее, метаболические фенотипы тучных и худых мышей могут передаваться через FMT (Рисунок 2B), 38,39 процесс, более зависимый от микробиоты, чем от генетики (Рисунок 2C), поскольку FMT от однояйцевых близнецов не соответствует ожирению. по-прежнему приводил к передаче фенотипа худощавости или ожирения у мышей. 40 Совместное содержание двух групп, где мыши ели фекалии друг друга, привело к фенотипу постного мяса, предположительно из-за повторного вторжения определенных Bacteroidetes в тучных мышей. 40 В недавнем исследовании пациентов с метаболическим синдромом FMT от худощавого донора улучшил чувствительность к инсулину всего за шесть недель, что частично обусловлено увеличением количества кишечных бактерий, продуцирующих бутират. 41

Рисунок 2. Ожирение и микробиом
A. Мыши без микробов устойчивы к ожирению, вызванному диетой; B. Метаболический фенотип передается через трансплантацию микробиоты от худых доноров, производящих худых мышей, и от доноров с ожирением, производящих мышей с ожирением; С.Пересадка микробиоты от однояйцевых близнецов, дискордантных по ожирению, также передает метаболический фенотип мышам, свободным от микробов, однако при совместном размещении преобладает худой фенотип; GF, без микробов; L, тощая N, нормальная; О, ожирение

Неалкогольная жировая болезнь печени

Помимо изменений микробиоты при ожирении, изменения кишечных бактерий при неалкогольной жировой болезни печени (НАЖБП) и неалкогольном стеатогепатите (НАСГ) связаны с кишечной бактериальной транслокацией, что приводит к увеличению доставки липополисахаридов, свободных жирных кислот. кислоты и другие токсины прямо в печень из воротной вены. 42 Кроме того, пациенты с НАСГ имеют большее количество бактерий семейства Escherichia , группы, которая ферментирует углеводы и производит эндогенный этанол. 43 Это приводит к периферическому повышению уровня алкоголя, что является возможным сопутствующим фактором в патогенезе жировой болезни печени. В настоящее время проводится ряд исследований для оценки роли пробиотиков, FMT или других кишечных модулирующих процедур у пациентов с НАЖБП.

Изменение микробиома кишечника

Пересадка фекальной микробиоты

FMT был впервые использован в современной медицине в 1958 году, когда четыре пациента с псевдомембранозным колитом были излечены фекальной клизмой. 44 Существуют доказательства роли FMT в рецидивирующей ИКД, и появляются новые доказательства его роли при ВЗК и метаболических заболеваниях. 15 Процесс, лежащий в основе FMT, относительно прост. Доноры проходят скрининг на все известные патогены, передающиеся с кровью и калом, и должны быть здоровыми, худыми и не иметь заболеваний, потенциально передаваемых через кишечные бактерии. Донорский стул смешивают со стерильным физиологическим раствором / глицерином и можно давать свежим или замороженным. Стул, замороженный при –80 ° C, жизнеспособен и эффективен в течение как минимум шести-девяти месяцев. 19 Донорский стул может быть доставлен через назо-еюнальную трубку или в слепую кишку при колоноскопии. В целом процедура безопасна; Общие нежелательные явления включают вздутие живота, диарею и субфебрильную температуру, которые обычно проходят в течение 48 часов. 15 Серьезные события, связанные с эндоскопической процедурой, такие как перфорация кишечника и аспирация, возникают редко. Долгосрочные эффекты FMT неизвестны и, вероятно, могут включать в себя индукцию хронических заболеваний, связанных с изменениями в кишечных бактериях или передачей нераспознанных в настоящее время инфекционных агентов. 15 Исследователи из банка стула OpenBiome в США, среди прочих, разработали фекальную капсулу, которая может сделать эту терапию, изменяющую кишечник, более доступной в будущем.

Антибиотики

Обработка кишечных бактерий с помощью антибиотиков, таких как ципрофлоксацин и метронидазол, в течение некоторого времени использовалась для лечения кишечных расстройств, таких как болезнь Крона; однако их способность уменьшать количество патогенных грамотрицательных бактерий, паразитов и анаэробов достигается за счет снижения бактериального разнообразия и устойчивости, а также ИКД. 12 Недавно минимально абсорбируемый антибиотик широкого спектра действия рифаксимин получил признание благодаря своей эффективности при печеночной энцефалопатии и СРК, а также низкому потенциалу развития бактериальной устойчивости. 12

Пробиотики

Пробиотики определены Всемирной организацией здравоохранения как «живые бактерии или дрожжи, которые при введении в адекватных количествах приносят пользу здоровью потребителя». Однако доказательства их эффективности неоднозначны. Наиболее хорошо изученными бактериальными пробиотиками являются пробиотики видов Lactobacillus , Bifidobacterium и Lactococcus , а наиболее часто используемые дрожжи — это Saccharomyces boulardii . 12 Пробиотики временно колонизируют кишечник и могут оказывать положительное воздействие за счет усиления естественного кишечного барьера (как физического, так и слизистого), стимуляции секреции IgA, подавления выработки воспалительных цитокинов и прямого антагонизма патогенов. 45 На основе метаанализов рандомизированных контролируемых исследований пробиотики умеренно эффективны для уменьшения общих симптомов СРК (количество, необходимое для лечения [NNT] = 8), 32 и для уменьшения диареи, связанной с антибиотиками, у детей в возрасте от одного месяца до 18 лет (NNT = 10) 46 и взрослые до 64 лет (относительный риск = 0.47), но не у пожилых людей. 47 Продолжительность использования пробиотиков (5–21 день) не повлияла на пользу, и, в разной степени, результаты были специфичными для штамма; наибольшее преимущество было получено от Lactobacillus и S. boulardii . 47 Для других заболеваний результаты могут зависеть от препарата, и только дорогостоящий комбинированный пробиотик VSL # 3 (восемь видов Lactobacillus , Bifidobacterium и Streptococcus ; 130 долл. США) эффективен для профилактики и лечения паучита у ВЗК после колэктомии, 22 и Lactobacillus casei и смешанный исследовательский препарат L.acidophilus , L. delbruecki var bulgaris , Streptococcus thermphilus и B. bifidu в течение пяти дней, снижая продолжительность и тяжесть симптомов у детей с острой инфекционной диареей. 48 Доказательства того, что пробиотики помогают при внекишечных заболеваниях или помогают поддерживать общее состояние здоровья, остаются противоречивыми. Большинство коммерческих пробиотиков состоят из смеси штаммов, эффективность которых обычно приписывается конкретным штаммам и их количеству. Однако недавнее исследование показало, что только 58% имеют правильную маркировку. 49 Кроме того, существуют проблемы с поддержанием жизнеспособности пробиотиков во время хранения и их способности противостоять кислоте и желчи, чтобы достичь толстой кишки, где может произойти колонизация. 50 В то время как пробиотики кажутся безопасными для большинства людей, сообщения о случаях заболевания повышают вероятность оппортунистической инфекции из-за воздействия на комменсальную микрофлору, особенно у тяжелобольных взрослых и новорожденных, у которых после приема препарата иногда наблюдались бактериемия и фунгемия. Lactobacillus rhamnosus и S.boulardii . 51 Крупные рандомизированные испытания не подтвердили повышенный риск; Однако при использовании пробиотиков рекомендуется оценка риска и пользы.

Заключение

Микробиом кишечника — сложная и важная часть нашего тела, которая обеспечивает жизненно важную поддержку нормального обмена веществ и защиту от болезней. Дисбактериоз связан с множеством болезненных состояний и является целью лечения и будущих исследований.

Благодарности

Авторы выражают благодарность г-ну Эндрю Барнсу за его помощь в оформлении рисунка 2.

Авторы

Майенааз Сидху, бакалавр наук, магистр гастроэнтерологии, больница Вестмид, Сидней, Новый Южный Уэльс

Дэвид ван дер Поортен Бакалавр медицинских наук, MBBS (с отличием) FRACP, доктор философии, штатный специалист-гастроэнтеролог больницы Вестмид, Сидней, Новый Южный Уэльс, и клинический доцент Сиднейского университета, Сидней, Новый Южный Уэльс. [email protected]

Конкурирующие интересы: Нет

Происхождение и экспертная оценка: заказано, внешняя экспертная оценка.

Ссылки

  1. Sender R, Fuchs S, Milo R. Пересмотренные оценки количества человеческих и бактериальных клеток в организме. PLoS Biol 2016; 14 (8): e1002533.
  2. Кларк Дж., Стиллинг Р. М., Кеннеди П. Дж., Стэнтон К., Крайан Дж. Ф., Динан Т. Г.. Мини-обзор: Микробиота кишечника: запущенный эндокринный орган. Мол Эндокринол 2014 Авг; 28 (8): 1221−38.
  3. Bull MJ, Plummer NT. Часть 1. Микробиом кишечника человека в условиях здоровья и болезней. Integr Med (Encinitas) 2014; 13 (6): 17–22.
  4. Эванс Дж. М., Моррис Л. С., Марчези младший. Микробиом кишечника: роль виртуального органа в эндокринологии хозяина. J Endocrinol 2013; 218 (3): R37–47.
  5. Bäckhed F, Fraser CM, Ringel Y, et al. Определение здорового микробиома кишечника человека: современные концепции, будущие направления и клиническое применение. Клеточный микроб-хозяин 2012; 12 (5): 611–22.
  6. Collado MC, Rautava S, Isolauri E, Salminen S. Микробиота кишечника: источник новых инструментов для снижения риска заболеваний человека? Педиатр Res 2015; 77 (1-2): 182–88.
  7. Хурре А., Каллиомяки М., Раутава С., Ринне М., Салминен С., Исолаури Э. Способ доставки — Влияние на микробиоту кишечника и гуморальный иммунитет. Неонатология 2008; 93 (4): 236–40.
  8. Neu J, Rushing J. Кесарево сечение по сравнению с вагинальными родами: долгосрочные результаты для младенцев и гигиеническая гипотеза. Clin Perinatol 2011; 38 (2): 321–31.
  9. Маки Р.И., Сгир А., Гаскинс Х.Р. Микробная экология развития желудочно-кишечного тракта новорожденных. Am J Clin Nutr 1999; 69 (5): 1035S – 45S.
  10. Schloss PD, Handelsman J. Статус микробной переписи. Microbiol Mol Biol Rev 2004; 68 (4): 686–91.
  11. LeBlanc JG, Milani C, de Giori GS, Sesma F, van Sinderen D, Ventura M. Бактерии как поставщики витаминов для своего хозяина: перспектива микробиоты кишечника. Curr Opin Biotechnol 2013; 24 (2): 160–68.
  12. Галло А., Пассаро Г., Гасбаррини А., Ландольфи Р., Монтальто М. Модуляция микробиоты как лечение воспалительных заболеваний кишечника: обновление. Мировой журнал J Gastroenterol 2016; 22 (32): 7186–202.
  13. Scheperjans F. Кишечная микробиота, 1013 новых элементов в головоломке «Болезнь Паркинсона». Curr Opin Neurol 2016; 29 (6): 773–80.
  14. Björkstén B, Sepp E, Julge K, Voor T., Mikelsaar M. Развитие аллергии и кишечная микрофлора в течение первого года жизни. J Allergy Clin Immunol 2001; 108 (4): 516–20.
  15. Choi HH, Cho Y-S. Трансплантация фекальной микробиоты: текущие применения, эффективность и перспективы на будущее. Clin Endosc 2016; 49 (3): 257–65.
  16. Slimings C, Armstrong P, Beckingham WD, et al.Рост заболеваемости инфекцией Clostridium difficile, Австралия, 2011-2012 гг. Med J Aust 2014; 200 (5): 272–76.
  17. Bartlett JG. Описательный обзор: новая эпидемия кишечного заболевания, ассоциированного с Clostridium difficile . Энн Интерн Мед 2006; 145 (10): 758–64.
  18. van Nood E, Vrieze A, Nieuwdorp M, et al. Дуоденальная инфузия донорских фекалий для рецидивирующей Clostridium difficile . N Engl J Med 2013; 368 (5): 407–15.
  19. Costello SP, Conlon MA, Vuaran MS, Roberts-Thomson IC, Andrews JM.Пересадка фекальной микробиоты при рецидивирующей инфекции Clostridium difficile с использованием длительного замороженного стула эффективна: данные о клинической эффективности и жизнеспособности бактерий. Aliment Pharmacol Ther 2015; 42 (8): 1011–18.
  20. Лопес Дж., Гринспан А. Трансплантация фекальной микробиоты при воспалительном заболевании кишечника. Гастроэнтерол Hepatol 2016; 12 (6): 374–79.
  21. Rutgeerts P, Hiele M, Geboes K, et al. Контролируемое испытание лечения метронидазолом для профилактики рецидива Крона после резекции подвздошной кишки.Гастроэнтерология 1995; 108 (6): 1617–21.
  22. Сингх С., Страуд А.М., Голубар С.Д., Сандборн В.Дж., Парди Д.С. Лечение и профилактика поучита после анастомоза подвздошно-анальный мешок при хроническом язвенном колите. Кокрановская база данных Syst Rev 2015; (11): CD001176.
  23. Colman RJ, Rubin DT. Трансплантация фекальной микробиоты как терапия воспалительного заболевания кишечника: систематический обзор и метаанализ. J. Crohns Colitis 2014; 8 (12): 1569–81.
  24. Paramsothy S, Kamm M, van den Bogaerde J, Samuel D, Leong R.Трансплантация интенсивной фекальной микробиоты от нескольких доноров — эффективное лечение резистентного язвенного колита: рандомизированное плацебо-контролируемое исследование. J Gastroenterol Hepatol 2016; 150 (4): S122–23.
  25. Россен Н.Г., Фуэнтес С., ван дер Спек М.Дж. и др. Результаты рандомизированного контролируемого исследования трансплантации фекалий пациентам с язвенным колитом. Гастроэнтерология 2015; 149 (1): 110–14.
  26. Моайеди П., Суретт М.Г., Ким П.Т. и др. Трансплантация фекальной микробиоты вызывает ремиссию у пациентов с активным язвенным колитом в рандомизированном контролируемом исследовании.Гастроэнтерология 2015; 149 (1): 102–06.
  27. Камиллери М. Периферические механизмы при синдроме раздраженного кишечника. N Engl J Med 2013; 368 (6): 578–79.
  28. Lyra A, Rinttilä T, Nikkilä J, et al. Синдром раздраженного кишечника с преобладанием диареи, различимый по количественной оценке филотипа гена 16S рРНК. Мировой журнал J Gastroenterol 2009; 15 (47): 5936–45.
  29. Chassard C, Dapoigny M, Scott KP и др. Функциональный дисбактериоз микробиоты кишечника у пациентов с синдромом раздраженного запора кишечника.Алимент Фармакол Тер 2012; 35 (7): 828–38.
  30. Jalanka-Tuovinen J, Salojärvi J, Salonen A, et al. Состав фекальной микробиоты и перекрестный диалог между хозяином и микробом после гастроэнтерита и постинфекционного синдрома раздраженного кишечника. Gut 2014; 63 (11): 1737–45.
  31. Cremonini F, Lembo A. Рифаксимин для лечения синдрома раздраженного кишечника. Экспертное мнение Pharmacother 2012; 13 (3): 433–40.
  32. Ford AC, Quigley EMM, Lacy BE и др. Эффективность пребиотиков, пробиотиков и синбиотиков при синдроме раздраженного кишечника и хронических идиопатических запорах: систематический обзор и метаанализ.Am J Gastroenterol 2014; 109 (10): 1547–61 – quiz1546–1562.
  33. Tuck CJ, Muir JG, Barrett JS, Gibson PR. Ферментируемые олигосахариды, дисахариды, моносахариды и полиолы: роль в синдроме раздраженного кишечника. Exp Rev Gastroenterol Hepatol 2014; 8 (7): 819–34.
  34. Bäckhed F, Manchester JK, Semenkovich CF, Gordon JI. Механизмы, лежащие в основе устойчивости к ожирению, вызванному диетой, у стерильных мышей. Proc Natl Acad Sci USA 2007; 104 (3): 979–84.
  35. Каллус С.Дж., Брандт Л.Дж.Микробиота кишечника и ожирение. J Clin Gastroenterol 2012; 46 (1): 16–24.
  36. Sze MA, Schloss PD. Ищем сигнал в шуме: возвращаемся к ожирению и микробиому. MBio 2016; 7 (4): e01018–16.
  37. Walters WA, Xu Z, Knight R. Мета-анализ кишечных микробов человека, связанных с ожирением и ВЗК. FEBS Lett 2014; 588 (22): 4223–33.
  38. Лиу А.П., Пазюк М., Лювано Дж.М., Машинени С., Тернбо П.Дж., Каплан Л.М. Сохраненные сдвиги в микробиоте кишечника из-за обходного желудочного анастомоза снижают вес хозяина и ожирение.Sci Transl Med 2013; 5 (178): 178ra41.
  39. Turnbaugh PJ, Bäckhed F, Fulton L, Gordon JI. Ожирение, вызванное диетой, связано с заметными, но обратимыми изменениями в микробиоме дистального отдела кишечника мыши. Клеточный микроб-хозяин 2008; 3 (4): 213–23.
  40. Ридаура В.К., Фейт Дж. Дж., Рей Ф. Е., Ченг Дж., Дункан А. Э., Кау А. Л. и др. Микробиота кишечника близнецов, не согласных с ожирением, модулирует метаболизм у мышей. Наука 2013; 341 (6150): 1241214.
  41. Vrieze A, van Nood E, Holleman F, Salojärvi J, Kootte RS, Bartelsman JFWM, et al.Перенос кишечной микробиоты от худых доноров увеличивает чувствительность к инсулину у людей с метаболическим синдромом. Гастроэнтерология 2012; 143 (4): 913–17.
  42. Виланд А., Франк Д. Н., Харнке Б., Бамбха К. Систематический обзор: микробный дисбиоз и неалкогольная жировая болезнь печени. Aliment Pharmacol Ther 2015; 42 (9): 1051–63.
  43. Чжу Л., Бейкер С.С., Гилл С. и др. Характеристика микробиомов кишечника у пациентов с неалкогольным стеатогепатитом (НАСГ): связь между эндогенным алкоголем и НАСГ.Гепатология 2013; 57 (2): 601–09.
  44. Eiseman B, Silen W, Bascom GS, Kauvar AJ. Фекальная клизма как вспомогательное средство при лечении псевдомембранозного энтероколита. Хирургия 1958; 44 (5): 854–59.
  45. Вандерпул С, Ян Ф, Полк ДБ. Механизмы действия пробиотиков: значение для терапевтического применения при воспалительных заболеваниях кишечника. Воспаление кишечника 2008; 14 (11): 1585–96.
  46. Джонстон BC, Голденберг JZ, Parkin PC. Пробиотики и профилактика диареи, связанной с антибиотиками, у младенцев и детей.JAMA 2016; 316 (14): 1484−85.
  47. Джафарнеджад С., Шаб-Бидар С., Спикман Дж. Р., Парастуи К., Данеши-Маскуни М., Джафариан К. Пробиотики снижают риск диареи, связанной с антибиотиками, у взрослых (18–64 лет), но не пожилых людей (> 65 лет): Метаанализ. Nutr Clin Pract 2016; 31 (4): 502–13.
  48. Canani RB, Cirillo P, Terrin G и др. Пробиотики для лечения острой диареи у детей: рандомизированное клиническое испытание пяти различных препаратов. BMJ 2007; 335 (7615): 340.
  49. Морович В., Хибберд А.А., Забель Б., Баррангу Р., Шталь Б. Генотипирование с помощью ПЦР и высокопроизводительное секвенирование коммерческих пробиотических продуктов выявляют систематические ошибки в составе. Front Microbiol 2016; 7: 1747.
  50. Сандерс М.Э., Ленуар-Вейнкооп И., Салминен С. и др. Пробиотики и пребиотики: перспективы для рекомендаций по общественному здоровью и питанию. Ann N Y Acad Sci 2014; 1309 (1): 19–29.
  51. Дидари Т., Солки С., Мозаффари С., Никфар С., Абдоллахи М. Систематический обзор безопасности пробиотиков.Мнение эксперта Drug Saf 2014; 13 (2): 227–39.

Переписка [email protected]

Открытие или сохранение файлов

Файлы на веб-сайте можно открывать или загружать и сохранять на свой компьютер или устройство.

Чтобы открыть, щелкните ссылку, ваш компьютер или устройство попытается открыть файл с помощью совместимого программного обеспечения.

Чтобы сохранить файл, щелкните ссылку правой кнопкой мыши или щелкните ссылку и выберите «Сохранить как …». Следуйте подсказкам, чтобы выбрать место.

Типы файлов

PDF Большинство документов на веб-сайте RACGP имеют формат Portable Document Format (PDF). Эти файлы будут иметь «PDF» в скобках вместе с размером файла для загрузки. Чтобы открыть файл PDF, вам потребуется совместимое программное обеспечение, такое как Adobe Reader. Если у вас его нет, вы можете бесплатно загрузить Adobe Reader.

DOC Некоторые документы на этом сайте представлены в формате Microsoft Word. Они будут иметь «DOC» в скобках вместе с размером файла для загрузки.Для просмотра этих документов вам понадобится программа, которая может читать формат Microsoft Word. Если у вас ничего нет, вы можете бесплатно скачать MS Word Viewer.

MP3 Большинство веб-браузеров воспроизводят аудио в формате MP3 в браузере

Микробиота кишечника в патогенезе воспалительных заболеваний кишечника

  • 1.

    Касер А., Цейссиг С., Блумберг Р.С. Воспалительное заболевание кишечника. Анну Рев Иммунол. 2010. 28: 573–621.

    CAS PubMed PubMed Central Статья Google ученый

  • 2.

    Хор Б, Гардет А, Ксавье RJ. Генетика и патогенез воспалительного заболевания кишечника. Природа. 2011. 474 (7351): 307–17.

    CAS PubMed PubMed Central Статья Google ученый

  • 3.

    Каплан Г.Г. Глобальное бремя ВЗК: с 2015 по 2025 год. Nat Rev Gastroenterol Hepatol. 2015; 12 (12): 720–7.

    PubMed Статья Google ученый

  • 4.

    Kaplan GG, Ng SC.Понимание и предотвращение глобального роста воспалительных заболеваний кишечника. Гастроэнтерология. 2017; 152 (2): 313–321.e2.

    PubMed Статья Google ученый

  • 5.

    Лю Дж. З., ван Соммерен С., Хуанг Х и др. Анализ ассоциаций идентифицирует 38 локусов восприимчивости к воспалительным заболеваниям кишечника и подчеркивает общий генетический риск в разных популяциях. Нат Жене. 2015; 47 (9): 979–86.

    CAS PubMed PubMed Central Статья Google ученый

  • 6.

    Goldsmith JR, Sartor RB. Роль диеты в метаболизме кишечной микробиоты: последующее влияние на иммунную функцию и здоровье хозяина, а также терапевтические последствия. J Gastroenterol. 2014. 49 (5): 785–98.

    CAS PubMed PubMed Central Статья Google ученый

  • 7.

    Шихан Д., Моран С., Шанахан Ф. Микробиота при воспалительном заболевании кишечника. J Gastroenterol. 2015; 50 (5): 495–507.

    CAS PubMed Статья Google ученый

  • 8.

    Honda K, Littman DR. Микробиом при инфекционных заболеваниях и воспалениях. Анну Рев Иммунол. 2012; 30: 759–95.

    CAS PubMed PubMed Central Статья Google ученый

  • 9.

    Цинь Дж., Ли Р., Раес Дж. И др. Каталог микробных генов кишечника человека, созданный путем метагеномного секвенирования. Природа. 2010. 464 (7285): 59–65.

    CAS PubMed PubMed Central Статья Google ученый

  • 10.

    Eckburg PB, Bik EM, Bernstein CN, et al. Разнообразие микробной флоры кишечника человека. Наука. 2005. 308 (5728): 1635–8.

    PubMed PubMed Central Статья Google ученый

  • 11.

    Ley RE, Hamady M, Lozupone C и др. Эволюция млекопитающих и их кишечных микробов. Наука. 2008. 320 (5883): 1647–51.

    CAS PubMed PubMed Central Статья Google ученый

  • 12.

    Андох А. Физиологическая роль микробиоты кишечника в поддержании здоровья человека. Пищеварение. 2016; 93 (3): 176–81.

    CAS PubMed Статья Google ученый

  • 13.

    Sartor RB. Влияние микробов при воспалительных заболеваниях кишечника. Гастроэнтерология. 2008. 134 (2): 577–94.

    CAS PubMed Статья Google ученый

  • 14.

    Андох А., Саката С., Коидзуми Ю. и др.Анализ полиморфизма длины терминального рестрикционного фрагмента разнообразия фекальной микробиоты у пациентов с язвенным колитом. Воспаление кишечника. 2007. 13 (8): 955–62.

    PubMed Статья Google ученый

  • 15.

    Фудзимото Т., Имаеда Х., Такахаши К. и др. Снижение численности Faecalibacterium prausnitzii в кишечной микробиоте при болезни Крона. J Gastroenterol Hepatol. 2013; 28 (4): 613–9.

    CAS PubMed Статья Google ученый

  • 16.

    Nishino K, Nishida A, Inoue R, Kawada Y, Ohno M, Sakai S, Inatomi O, Bamba S, Sugimoto M, Kawahara M, Naito Y, Andoh A. Анализ образцов эндоскопической щетки выявил дисбактериоз слизистой оболочки воспалительного кишечника болезнь. J Gastroenterol. 2017. https://doi.org/10.1007/s00535-017-1384-4.

    Google ученый

  • 17.

    Sartor RB, Wu GD. Роль кишечных бактерий, вирусов и грибов в патогенезе воспалительных заболеваний кишечника и терапевтических подходах.Гастроэнтерология. 2017; 152 (2): 327–339.e4.

    CAS PubMed Статья Google ученый

  • 18.

    Такахаши К., Нишида А., Фудзимото Т. и др. Снижение численности видов бактерий, продуцирующих бутират, в фекальном микробном сообществе при болезни Крона. Пищеварение. 2016; 93 (1): 59–65.

    CAS PubMed Статья Google ученый

  • 19.

    О’Хара А.М., Шанахан Ф.Флора кишечника как забытый орган. EMBO Rep. 2006; 7 (7): 688–93.

    PubMed PubMed Central Статья CAS Google ученый

  • 20.

    ЛеБлан Дж. Г., Лайно Дж. Э., дель Валле М. Дж. И др. Производство витаминов группы B молочнокислыми бактериями — современные знания и потенциальные области применения. J Appl Microbiol. 2011. 111 (6): 1297–309.

    CAS PubMed Статья Google ученый

  • 21.

    Марчези Дж. Р., Адамс Д.Х., Фава Ф. и др. Микробиота кишечника и здоровье хозяина: новый клинический рубеж. Кишечник. 2016; 65 (2): 330–9.

    PubMed Статья Google ученый

  • 22.

    Sun M, Wu W., Liu Z, et al. Короткоцепочечные жирные кислоты метаболитов микробиоты, GPCR и воспалительные заболевания кишечника. J Gastroenterol. 2017; 52 (1): 1–8.

    CAS PubMed Статья Google ученый

  • 23.

    Pomare EW, филиал WJ, Cummings JH. Ферментация углеводов в толстой кишке человека и ее связь с концентрацией ацетата в венозной крови. J Clin Invest. 1985. 75 (5): 1448–54.

    CAS PubMed PubMed Central Статья Google ученый

  • 24.

    Machiels K, Joossens M, Sabino J, et al. Уменьшение количества видов, продуцирующих бутират Roseburia hominis и Faecalibacterium prausnitzii , определяет дисбактериоз у пациентов с язвенным колитом.Кишечник. 2014. 63 (8): 1275–83.

    CAS PubMed Статья Google ученый

  • 25.

    Фальк П.Г., Хупер Л.В., Мидтведт Т. и др. Создание и поддержание экосистемы желудочно-кишечного тракта: что мы знаем и должны знать из гнотобиологии. Microbiol Mol Biol Rev.1998; 62 (4): 1157–70.

    CAS PubMed PubMed Central Google ученый

  • 26.

    Round JL, Mazmanian SK.Микробиота кишечника формирует иммунные реакции кишечника во время здоровья и болезни. Nat Rev Immunol. 2009. 9 (5): 313–23.

    CAS PubMed PubMed Central Статья Google ученый

  • 27.

    Камада Н., Нуньес Г. Регулирование иммунной системы резидентными кишечными бактериями. Гастроэнтерология. 2014. 146 (6): 1477–88.

    CAS PubMed PubMed Central Статья Google ученый

  • 28.

    Бускра Д., Брезильон С., Берард М. и др. Генезис лимфоидной ткани, индуцированный комменсалами через NOD1, регулирует гомеостаз кишечника. Природа. 2008. 456 (7221): 507–10.

    CAS PubMed Статья Google ученый

  • 29.

    Аябе Т., Сатчелл Д.П., Пезендорфер П. и др. Активация альфа-дефензинов клеток Панета в тонком кишечнике мышей. J Biol Chem. 2002. 277 (7): 5219–28.

    CAS PubMed Статья Google ученый

  • 30.

    Cash HL, Whitham CV, Behrendt CL, et al. Симбиотические бактерии направляют экспрессию кишечного бактерицидного лектина. Наука. 2006. 313 (5790): 1126–30.

    CAS PubMed PubMed Central Статья Google ученый

  • 31.

    Hooper LV, Stappenbeck TS, Hong CV, et al. Ангиогенины: новый класс микробицидных белков, участвующих в врожденном иммунитете. Nat Immunol. 2003. 4 (3): 269–73.

    CAS PubMed Статья Google ученый

  • 32.

    Пуцеп К., Аксельссон Л.Г., Боман А. и др. Свободные от зародышей и колонизированные мыши производят одни и те же продукты из кишечных продефенсинов. J Biol Chem. 2000. 275 (51): 40478–82.

    CAS PubMed Статья Google ученый

  • 33.

    Hapfelmeier S, Lawson MA, Slack E, et al. Обратимая микробная колонизация стерильных мышей позволяет выявить динамику иммунных ответов IgA. Наука. 2010. 328 (5986): 1705–9.

    CAS PubMed PubMed Central Статья Google ученый

  • 34.

    Макферсон А.Дж., Харрис Н.Л. Взаимодействие между комменсальными кишечными бактериями и иммунной системой. Nat Rev Immunol. 2004. 4 (6): 478–85.

    CAS PubMed Статья Google ученый

  • 35.

    Umesaki Y, Okada Y, Matsumoto S, et al. Сегментированные нитчатые бактерии — это местные кишечные бактерии, которые активируют интраэпителиальные лимфоциты и индуцируют молекулы MHC класса II и фукозилированные гликолипиды GM1 на эпителиальных клетках тонкого кишечника у бывших стерильных мышей.Microbiol Immunol. 1995. 39 (8): 555–62.

    CAS PubMed Статья Google ученый

  • 36.

    Gaboriau-Routhiau V, Rakotobe S, Lecuyer E, et al. Ключевая роль сегментированных нитчатых бактерий в скоординированном созревании ответов Т-хелперных клеток кишечника. Иммунитет. 2009. 31 (4): 677–89.

    CAS PubMed Статья Google ученый

  • 37.

    Иванов И.И., Атараши К., Манель Н. и др.Индукция кишечных клеток Th27 сегментированными нитчатыми бактериями. Клетка. 2009. 139 (3): 485–98.

    CAS PubMed PubMed Central Статья Google ученый

  • 38.

    Умесаки Ю., Сетояма Х., Мацумото С. и др. Различная роль сегментированных нитчатых бактерий и клостридий в развитии иммунной системы кишечника. Заражение иммунной. 1999. 67 (7): 3504–11.

    CAS PubMed PubMed Central Google ученый

  • 39.

    Chung H, Pamp SJ, Hill JA и др. Созревание иммунитета кишечника зависит от колонизации специфической микробиотой хозяина. Клетка. 2012. 149 (7): 1578–93.

    CAS PubMed PubMed Central Статья Google ученый

  • 40.

    Cebra JJ. Влияние микробиоты на развитие иммунной системы кишечника. Am J Clin Nutr. 1999; 69 (5): 1046s – 51s.

    CAS PubMed Google ученый

  • 41.

    Шанахан Ф. Интерфейс «хозяин-микроб» в кишечнике. Лучшие Практики Рес Клин Гастроэнтерол. 2002. 16 (6): 915–31.

    PubMed Статья Google ученый

  • 42.

    Литтман Д.Р., Руденский А.Ю. Th27 и регуляторные Т-клетки опосредуют и сдерживают воспаление. Клетка. 2010. 140 (6): 845–58.

    CAS PubMed Статья Google ученый

  • 43.

    Сакагучи С., Ямагути Т., Номура Т. и др.Регуляторные Т-клетки и иммунная толерантность. Клетка. 2008. 133 (5): 775–87.

    CAS PubMed Статья Google ученый

  • 44.

    Атараси К., Тануэ Т., Осима К. и др. Индукция Treg рационально подобранной смесью штаммов Clostridia из микробиоты человека. Природа. 2013. 500 (7461): 232–6.

    CAS PubMed Статья Google ученый

  • 45.

    Франк Д.Н., Сент-Аманд А.Л., Фельдман Р.А. и др.Молекулярно-филогенетическая характеристика дисбаланса микробного сообщества при воспалительных заболеваниях кишечника человека. Proc Natl Acad Sci USA. 2007. 104 (34): 13780–5.

    CAS PubMed PubMed Central Статья Google ученый

  • 46.

    Уокер А.В., Сандерсон Дж. Д., Черчер С. и др. Высокопроизводительный анализ библиотеки клонов микробиоты, связанной со слизистой оболочкой, выявляет дисбактериоз и различия между воспаленными и невоспаленными участками кишечника при воспалительном заболевании кишечника.BMC Microbiol. 2011; 11: 7.

    PubMed PubMed Central Статья Google ученый

  • 47.

    Атараси К., Тануэ Т., Андо М. и др. Индукция клеток Th27 за счет адгезии микробов к эпителиальным клеткам кишечника. Клетка. 2015; 163 (2): 367–80.

    CAS PubMed PubMed Central Статья Google ученый

  • 48.

    Секиров И., Рассел С.Л., Антунес Л.С. и др. Микробиота кишечника в здоровье и болезнях.Physiol Rev.2010; 90 (3): 859–904.

    CAS PubMed Статья Google ученый

  • 49.

    Buffie CG, Pamer EG. Устойчивость к колонизации, опосредованной микробиотой, против кишечных патогенов. Nat Rev Immunol. 2013. 13 (11): 790–801.

    CAS PubMed PubMed Central Статья Google ученый

  • 50.

    Камада Н., Ким Ю.Г., Шам ХП и др. Регулируемая вирулентность контролирует способность патогена конкурировать с кишечной микробиотой.Наука. 2012. 336 (6086): 1325–9.

    CAS PubMed PubMed Central Статья Google ученый

  • 51.

    Хуанг Т., Чжан Х, Пан Дж. И др. Очистка и характеристика нового протеиноподобного бактериоцина холодового шока, синтезированного Bacillus thuringiensis . Научный доклад 2016; 6: 35560.

    CAS PubMed PubMed Central Статья Google ученый

  • 52.

    Киннебрю М.А., Убеда С., Зеневич Л.А. и др. Бактериальный флагеллин стимулирует Toll-подобный рецептор 5-зависимую защиту от устойчивой к ванкомицину инфекции Enterococcus . J Infect Dis. 2010. 201 (4): 534–43.

    CAS PubMed PubMed Central Статья Google ученый

  • 53.

    Brandl K, Plitas G, Mihu CN, et al. Устойчивые к ванкомицину энтерококки используют вызванный антибиотиками врожденный иммунный дефицит. Природа. 2008. 455 (7214): 804–7.

    CAS PubMed PubMed Central Статья Google ученый

  • 54.

    Talham GL, Jiang HQ, Bos NA, et al. Сегментированные нитчатые бактерии являются мощными стимулами физиологически нормального состояния иммунной системы слизистой оболочки кишечника мышей. Заражение иммунной. 1999. 67 (4): 1992–2000.

    CAS PubMed PubMed Central Google ученый

  • 55.

    Петерсон Д.А., Франк Д.Н., Пейс Н.Р. и др.Метагеномные подходы к определению патогенеза воспалительных заболеваний кишечника. Клеточный микроб-хозяин. 2008. 3 (6): 417–27.

    CAS PubMed PubMed Central Статья Google ученый

  • 56.

    Manichanh C, Rigottier-Gois L, Bonnaud E, et al. Уменьшение разнообразия фекальной микробиоты при болезни Крона, выявленное с помощью метагеномного подхода. Кишечник. 2006. 55 (2): 205–11.

    CAS PubMed PubMed Central Статья Google ученый

  • 57.

    Варела Е., Маничан С., Галларт М. и др. Колонизация Faecalibacterium prausnitzii и поддержание клинической ремиссии у пациентов с язвенным колитом. Алимент Pharmacol Ther. 2013. 38 (2): 151–61.

    CAS PubMed Статья Google ученый

  • 58.

    Сокол Х., Пиньер Б., Уоттерлот Л. и др. Faecalibacterium prausnitzii — это противовоспалительная комменсальная бактерия, идентифицированная анализом кишечной микробиоты пациентов с болезнью Крона.Proc Natl Acad Sci USA. 2008. 105 (43): 16731–6.

    CAS PubMed PubMed Central Статья Google ученый

  • 59.

    Баумгарт М., Доган Б., Ришнив М. и др. Независимый от культуры анализ слизистой оболочки подвздошной кишки показывает избирательное увеличение инвазивной Escherichia coli новой филогении по сравнению с истощением Clostridiales при болезни Крона с вовлечением подвздошной кишки. ISME J. 2007; 1 (5): 403–18.

    CAS PubMed Статья Google ученый

  • 60.

    Котловски Р., Бернштейн С.Н., Сепери С. и др. Высокая распространенность Escherichia coli , принадлежащего филогенетической группе B2 + D, при воспалительном заболевании кишечника. Кишечник. 2007. 56 (5): 669–75.

    CAS PubMed Статья Google ученый

  • 61.

    Мартин Х.М., Кэмпбелл Б.Дж., Харт Калифорния и др. Повышенная приверженность и инвазия Escherichia coli при болезни Крона и раке толстой кишки. Гастроэнтерология. 2004. 127 (1): 80–93.

    CAS PubMed Статья Google ученый

  • 62.

    Мартинес К., Антолин М., Сантос Дж. И др. Нестабильный состав фекальной микробиоты при язвенном колите в период клинической ремиссии. Am J Gastroenterol. 2008. 103 (3): 643–8.

    PubMed Статья Google ученый

  • 63.

    Милонаки М., Реймент Н.Б., Рэмптон Д.С. и др. Молекулярная характеристика бактериальной флоры слизистой оболочки прямой кишки при воспалительном заболевании кишечника.Воспаление кишечника. 2005. 11 (5): 481–7.

    PubMed Статья Google ученый

  • 64.

    Neut C, Bulois P, Desreumaux P, et al. Изменения бактериальной флоры нетерминальной подвздошной кишки после илеоколонической резекции по поводу болезни Крона. Am J Gastroenterol. 2002. 97 (4): 939–46.

    PubMed Статья Google ученый

  • 65.

    Свидсински А., Ладхофф А., Пернталер А. и др.Флора слизистой оболочки при воспалительном заболевании кишечника. Гастроэнтерология. 2002. 122 (1): 44–54.

    PubMed Статья Google ученый

  • 66.

    Darfeuille-Michaud A, Boudeau J, Bulois P, et al. Высокая распространенность адгезивно-инвазивной Escherichia coli , связанной со слизистой оболочкой подвздошной кишки, при болезни Крона. Гастроэнтерология. 2004. 127 (2): 412–21.

    PubMed Статья Google ученый

  • 67.

    Ахмед I, Рой BC, Хан С.А. и др. Микробиом, метаболом и воспалительное заболевание кишечника. Микроорганизмы. 2016; 4 (2): 20.

    PubMed Central Статья Google ученый

  • 68.

    van der Waaij LA, Harmsen HJ, Madjipour M, et al. Бактериальный популяционный анализ биопсий толстой кишки и подвздошной кишки человека с помощью флуоресцентных зондов на основе 16S рРНК: комменсальные бактерии живут в суспензии и не имеют прямого контакта с эпителиальными клетками.Воспаление кишечника. 2005. 11 (10): 865–71.

    PubMed Статья Google ученый

  • 69.

    Шульц К., Ван Ден Берг Ф.М., Тен Кейт Ф.В. и др. Слой слизи кишечника пациентов с воспалительным заболеванием кишечника содержит большое количество бактерий по сравнению с контрольной группой. Гастроэнтерология. 1999. 117 (5): 1089–97.

    CAS PubMed Статья Google ученый

  • 70.

    Png CW, Linden SK, Gilshenan KS и др. Муколитические бактерии с повышенной распространенностью в слизистой оболочке IBD увеличивают использование муцина in vitro другими бактериями. Am J Gastroenterol. 2010. 105 (11): 2420–8.

    CAS PubMed Статья Google ученый

  • 71.

    Loubinoux J, Bronowicki JP, Pereira IA, et al. Сульфатредуцирующие бактерии в кале человека и их связь с воспалительными заболеваниями кишечника. FEMS Microbiol Ecol. 2002. 40 (2): 107–12.

    CAS PubMed Статья Google ученый

  • 72.

    Зинкевич В.В., Бук И.Б. Скрининг сульфатредуцирующих бактерий в образцах колоноскопии здоровой и колитической слизистой оболочки кишечника человека. FEMS Microbiol Ecol. 2000. 34 (2): 147–55.

    CAS PubMed Статья Google ученый

  • 73.

    Роуэн Ф., Дочерти Н.Г., Мерфи М. и др. Количество видов бактерий Desulfovibrio увеличивается при язвенном колите.Dis Colon Rectum. 2010. 53 (11): 1530–6.

    PubMed Статья Google ученый

  • 74.

    Эндрюс С.Н., Гриффитс Т.А., Кауфман Дж. И др. Месалазин (5-аминосалициловая кислота) изменяет бактериальный профиль фекалий, но не влияет на протеолитическую активность слизистых оболочек при синдроме раздраженного кишечника с преобладанием диареи. Алимент Pharmacol Ther. 2011. 34 (3): 374–83.

    CAS PubMed Статья Google ученый

  • 75.

    Swidsinski A, Weber J, Loening-Baucke V, et al. Пространственная организация и состав флоры слизистой оболочки у пациентов с воспалительными заболеваниями кишечника. J Clin Microbiol. 2005. 43 (7): 3380–9.

    PubMed PubMed Central Статья Google ученый

  • 76.

    Насер С.А., Саграмсинг С.Р., Насер А.С. и др. Подвид Mycobacterium avium paratuberculosis вызывает болезнь Крона у некоторых пациентов с воспалительными заболеваниями кишечника. Мир Дж. Гастроэнтерол.2014. 20 (23): 7403–15.

    PubMed PubMed Central Статья Google ученый

  • 77.

    Гринштейн Р.Дж., Су Л., Шахиди А. и др. О действии 5-амино-салициловой кислоты и сульфапиридина на M. avium , включая подвиды paratuberculosis. PLoS One. 2007; 2 (6): e516.

    PubMed PubMed Central Статья CAS Google ученый

  • 78.

    Кауфман Дж., Гриффитс Т.А., Суретт М.Г. и др.Влияние месаламина (5-аминосалициловой кислоты) на экспрессию бактериальных генов. Воспаление кишечника. 2009. 15 (7): 985–96.

    PubMed Статья Google ученый

  • 79.

    Gradel KO, Nielsen HL, Schonheyder HC, et al. Повышенный краткосрочный и долгосрочный риск воспалительного заболевания кишечника после гастроэнтерита, вызванного сальмонеллой или кампилобактерией. Гастроэнтерология. 2009. 137 (2): 495–501.

    PubMed Статья Google ученый

  • 80.

    Schultz BM, Paduro CA, Salazar GA, et al. Потенциальная роль сальмонеллезной инфекции в возникновении воспалительных заболеваний кишечника. Фронт Иммунол. 2017; 8: 191.

    PubMed PubMed Central Статья Google ученый

  • 81.

    Питчер М.С., Битти Э.Р., Каммингс Дж. Х. Вклад сульфатредуцирующих бактерий и 5-аминосалициловой кислоты в сульфид фекалий у пациентов с язвенным колитом. Кишечник. 2000. 46 (1): 64–72.

    CAS PubMed PubMed Central Статья Google ученый

  • 82.

    Эдмонд Л.М., Хопкинс М.Дж., Маги Е.А. и др. Влияние препаратов, содержащих 5-аминосалициловую кислоту, на продукцию сульфидов сульфатредуцирующими и ферментирующими аминокислоты бактериями. Воспаление кишечника. 2003. 9 (1): 10–7.

    PubMed Статья Google ученый

  • 83.

    Магнуссон М.К., Стрид Х., Сапнара М. и др. Ответ на терапию анти-TNF у пациентов с язвенным колитом связан с экспрессией антимикробного пептида толстой кишки и составом микробиоты.Колит Дж. Крона. 2016; 10 (8): 943–52.

    PubMed Статья Google ученый

  • 84.

    Бускетс Д., Мас-де-Ксаксарс Т., Лопес-Силес М. и др. Лечение адалимумабом против фактора некроза опухолей вызывает изменения микробиоты при болезни Крона. Колит Дж. Крона. 2015; 9 (10): 899–906.

    PubMed Статья Google ученый

  • 85.

    Swidsinski A, Loening-Baucke V, Bengmark S, et al.Воздействие азатиоприна и месалазина на флору слизистой оболочки у пациентов с колитом ВЗК. Воспаление кишечника. 2007. 13 (1): 51–6.

    PubMed Статья Google ученый

  • 86.

    Шин С.Дж., Коллинз М.Т. Тиопуриновые препараты азатиоприн и 6-меркаптопурин подавляют рост Mycobacterium paratuberculosis in vitro. Антимикробные агенты Chemother. 2008. 52 (2): 418–26.

    CAS PubMed Статья Google ученый

  • 87.

    Гринштейн Р.Дж., Су Л., Арутюнян В. и др. О действии метотрексата и 6-меркаптопурина на M. avium подвид паратуберкулеза. PLoS One. 2007; 2 (1): e161.

    PubMed PubMed Central Статья CAS Google ученый

  • 88.

    Wills ES, Jonkers DM, Savelkoul PH, et al. Микробный состав кала пациентов с язвенным колитом и болезнью Крона в стадии ремиссии и последующего обострения. PLoS One.2014; 9 (3): e

  • .

    PubMed PubMed Central Статья CAS Google ученый

  • 89.

    Хуанг Е.Ю., Иноуэ Т., Леоне В.А. и др. Использование кортикостероидов для изменения микробиома кишечника: последствия для воспалительных заболеваний кишечника. Воспаление кишечника. 2015; 21 (5): 963–72.

    PubMed PubMed Central Статья Google ученый

  • 90.

    Игараси Х., Маеда С., Оно К. и др.Влияние перорального приема метронидазола или преднизолона на микробиоту фекалий у собак. PLoS One. 2014; 9 (9): e107909.

    PubMed PubMed Central Статья CAS Google ученый

  • 91.

    Шрезенмейр Дж., Де Врезе М. Пробиотики, пребиотики и синбиотики — приближаясь к определению. Am J Clin Nutr. 2001; 73 (2 доп.): 361с – 4с.

    CAS PubMed Google ученый

  • 92.

    Kruis W, Fric P, Pokrotnieks J, et al. Поддержание ремиссии язвенного колита с помощью пробиотика Escherichia coli Nissle 1917 так же эффективно, как и стандартного месалазина. Кишечник. 2004. 53 (11): 1617–23.

    CAS PubMed PubMed Central Статья Google ученый

  • 93.

    Суд А., Мидха В., Махария Г.К. и др. Пробиотический препарат VSL # 3 вызывает ремиссию у пациентов с легким или умеренно активным язвенным колитом.Clin Gastroenterol Hepatol. 2009; 7 (11): 1202–1209.e1.

    PubMed Статья Google ученый

  • 94.

    Tursi A, Brandimarte G, Giorgetti GM, et al. Низкие дозы бальсалазида в сочетании с сильнодействующим пробиотическим препаратом более эффективны, чем один бальсалазид или месалазин при лечении острого язвенного колита легкой и средней степени тяжести. Med Sci Monit. 2004; 10 (11): Pi126–31.

    CAS PubMed Google ученый

  • 95.

    Mardini HE, Григорян А.Ю. Смесь пробиотиков VSL # 3 — эффективная дополнительная терапия при язвенном колите легкой и средней степени активности: метаанализ. Воспаление кишечника. 2014. 20 (9): 1562–7.

    PubMed Статья Google ученый

  • 96.

    Zocco MA, dal Verme LZ, Cremonini F, et al. Эффективность Lactobacillus GG в поддержании ремиссии язвенного колита. Алимент Pharmacol Ther. 2006. 23 (11): 1567–74.

    CAS PubMed Статья Google ученый

  • 97.

    Мэллон П., Маккей Д., Кирк С. и др. Пробиотики для индукции ремиссии при язвенном колите. Кокрановская база данных Syst Rev.2007; 4: Cd005573.

    Google ученый

  • 98.

    Марто П., Леманн М., Сексик П. и др. Неэффективность Lactobacillus johnsonii LA1 для профилактики послеоперационного рецидива болезни Крона: рандомизированное двойное слепое плацебо-контролируемое исследование GETAID. Кишечник. 2006; 55 (6): 842–7.

    CAS PubMed PubMed Central Статья Google ученый

  • 99.

    Malchow HA. Болезнь Крона и Escherichia coli . Новый подход в терапии для поддержания ремиссии болезни Крона толстой кишки? J Clin Gastroenterol. 1997. 25 (4): 653–8.

    CAS PubMed Статья Google ученый

  • 100.

    Guslandi M, Mezzi G, Sorghi M, et al. Saccharomyces boulardii в поддерживающем лечении болезни Крона. Dig Dis Sci. 2000. 45 (7): 1462–4.

    CAS PubMed Статья Google ученый

  • 101.

    Баттерворт AD, Thomas AG, Akobeng AK. Пробиотики для индукции ремиссии при болезни Крона. Кокрановская база данных Syst Rev.2008; 3: Cd006634.

    Google ученый

  • 102.

    Кураиши М.Н., Видлак М., Бхала Н. и др. Систематический обзор с метаанализом: эффективность трансплантации фекальной микробиоты для лечения рецидивирующей и резистентной инфекции Clostridium difficile. Алимент Pharmacol Ther. 2017; 46 (5): 479–93.

    CAS PubMed Статья Google ученый

  • 103.

    van Nood E, Vrieze A, Nieuwdorp M, et al. Дуоденальная инфузия донорских фекалий при рецидиве Clostridium difficile. N Engl J Med. 2013; 368 (5): 407–15.

    PubMed Статья CAS Google ученый

  • 104.

    Моайеди П., Суретт М.Г., Ким П.Т. и др. Трансплантация фекальной микробиоты вызывает ремиссию у пациентов с активным язвенным колитом в рандомизированном контролируемом исследовании. Гастроэнтерология. 2015; 149 (1): 102–109.e6.

    PubMed Статья Google ученый

  • 105.

    Россен Н.Г., Фуэнтес С., ван дер Спек М.Дж. и др. Результаты рандомизированного контролируемого исследования трансплантации фекалий пациентам с язвенным колитом. Гастроэнтерология. 2015; 149 (1): 110–118.e4.

    PubMed Статья Google ученый

  • 106.

    Paramsothy S, Kamm MA, Kaakoush NO, et al. Многодонорная интенсивная трансплантация фекальной микробиоты при активном язвенном колите: рандомизированное плацебо-контролируемое исследование. Ланцет. 2017; 389 (10075): 1218–28.

    PubMed Статья Google ученый

  • 107.

    Costello SP, Waters O, Bryant RV, et al. Кратковременная трансплантация объединенной фекальной микробиоты низкой интенсивности вызывает ремиссию у пациентов с легким или умеренно активным язвенным колитом: рандомизированное контролируемое исследование. Гастроэнтерология. 2017; 152 (5): S198–9. https://doi.org/10.1016/S0016-5085(17)30989-1.

    Артикул Google ученый

  • 108.

    Paramsothy S, Paramsothy R, Rubin DT и др. Трансплантация фекальной микробиоты при воспалительном заболевании кишечника: систематический обзор и метаанализ. Колит Дж. Крона. 2017; 11 (10): 1180–99.

    PubMed Статья Google ученый

  • 109.
    Препараты для кишечника от дисбактериоза: Средства от дисбактериоза купить по низкой цене в Москве в интернет аптеке
  • Добавить комментарий

    Ваш адрес email не будет опубликован.