Содержание

причины, симптомы, диагностика и методы лечения на сайте «Альфа-Центр Здоровья»

Патологические состояния, которые проявляются изменением частоты и силы сердечных сокращений. Проявляются болью в сердце, учащенным сердцебиением, перебоями в сердцебиении, одышкой и головокружением.

Нарушения проводимости сердца (блокады) — частая находка при электрокардиографическом (ЭКГ) исследовании. Чаще всего они никак не проявляются клинически, но некоторые блокады требуют имплантации (установки) постоянного электрокардиостимулятора (водителя ритма). 

Многие разновидности внутрисердечных блокад (например, неполная блокада правой ножки пучка Гиса) являются вариантом нормы.

Кардиологическое обследование при нарушениях проводимости сердца призвано не только определить вид блокады, но и установить, не служит ли она проявлением органического поражения сердца. Кроме того, далеко не во всех случаях блокады надо лечить. Главные показания к установке электрокардиостимулятора — обмороки и предобморочные состояния, но необходимо быть уверенным, что обмороки вызваны именно нарушениями проводимости сердца.

Проводящая система сердца

В общих чертах проводящая система сердца (система, ответственная за проведение электрических импульсов в сердце) устроена следующим образом. Импульсы генерируются синусовым узлом, расположенным в правом предсердии. По внутрипредсердным путям проведения эти импульсы достигают атриовентрикулярного (АВ) узла, где происходит некоторая задержка импульсов: предсердия и желудочки должны сокращаться неодновременно. Затем импульс идет по ножкам пучка Гиса к клеткам (кардиомиоцитам) желудочков. Пучок Гиса состоит из двух ножек — правой и левой. Левая ножка пучка Гиса состоит из двух ветвей — передней и задней.    

Основные методы диагностики нарушений проводимости сердца

1. ЭКГ (электрокардиограмма) 

Стандартная ЭКГ в 12 отведениях в покое позволяют выявить все основные виды нарушений проводимости сердца: синоатриальную и атриовентрикулярную блокады, блокады ножек пучка Гиса. Медикаментозные пробы в сочетании с ЭКГ в настоящее время почти не используют.

2. Холтеровский мониторинг (мониторирование) ЭКГ

Этот вид исследования позволяет записать ЭКГ на протяжении суток и более. Он позволяет установить, нет ли у пациента значимых пауз (остановок сердца). Значимыми считают паузы дольше 3 секунд. В случае, если значимых пауз нет, установка электрокардиостимулятора почти никогда не показана.

3. Электрофизиологическое исследование сердца (ЭФИ)

Это самый надежный, но сложный и дорогостоящий метод диагностики аритмий. Выполняется ЭФИ только в стационаре, и требует установки нескольких катетеров в вены рук и ног. Через эти катетеры в сердце проводят электроды и выполняют электрокардиостимуляцию — вызывают и устраняют аритмии, исследуют их параметры. 

Для обнаружения самых частых видов нарушений проводимости сердца существует более простая разновидность ЭФИ — чреспищеводное ЭФИ. При этом через рот или через нос в пищевод заводят тонкую проволоку (зонд-электрод) и через него стимулируют левое предсердие. Этот вид исследования выполняют амбулаторно. В частности чреспищеводное ЭФИ позволяет определить, за какое время после прекращения стимуляции, восстанавливается функция синусового узла (то есть собственного водителя ритма) — это нужно для того, чтобы поставить диагноз синдрома слабости синусового узла, одного из самых распространенных видов нарушений проводимости у пожилых. 

Отдельные виды блокад

Атриовентрикулярная (АВ-) блокада

Различают АВ-блокады 1-й, 2-й и 3-й степеней. АВ-блокада 1-й степени никак клинически не проявляется, диагноз ставят по ЭКГ (когда интервал PQ на ЭКГ превышает 0,20 секунд). АВ-блокада 1-й степени нередко встречается в норме, например у спортсменов. При ней противопоказаны некоторые препараты, которые могут перевести ее в АВ-блокаду более высоких степеней.

При АВ-блокаде 2-й степени наблюдаются выпадения отдельных сокращений сердца. Различают два типа АВ-блокады 2-й степени, их называют Мобитц I и Мобитц II. Блокада типа Мобитц I носит более доброкачественный характер, имплантация кардиостимулятора при ней почти никогда не показана. АВ-блокада типа Мобитц II указывает на более серьезное поражение проводящей системы сердца, при ней иногда ставят кардиостимулятор из-за риска полной АВ-блокады.

АВ-блокада 3-й степени — это полная АВ-блокада. Импульсы от предсердий к желудочкам не проводятся, желудочки работают за счет того, что АВ-узел генерирует собственные импульсы, частота их, однако, ниже, чем та, которую способен создать синусовый узел, и ритм этот в целом менее надежен. Поэтому полная АВ-блокада, даже бессимптомная, нередко служит показанием для установки кардиостимулятора.

Блокады ножек пучка Гиса

Блокады ножек пучка Гиса тоже диагностируют по ЭКГ. Неполная блокада правой ножки пучка Гиса — вариант нормы. Из всего разнообразия блокад ножек пучка Гиса особого внимания заслуживает только полная блокада левой ножки пучка Гиса. Во-первых, она может указывать на перенесенный передний инфаркт миокарда, во-вторых, она сама по себе приводит к асинхронному (неодновременному) сокращению стенок левого желудочка и может привести к сердечной недостаточности. В последние годы разработан особый вид электрокардиостимуляции, его называют бивентрикулярной (двухжелудочковой) электрокардиостимуляцией (см. ниже).

Синдром слабости синусового узла

Это заболевание проводящей системы сердца обычно встречается у пожилых людей. Оно проявляется обмороками и предобморочными состояниями (нередко во время физической нагрузки), и так называемым синдромом тахи-бради: редкий пульс сменяется частым, когда у пациента возникает мерцательная аритмия. При этом лечить саму мерцательную аритмию (фибрилляцию предсердий) трудно, поскольку большинство антиаритмических препаратов урежают ритм сердца. При синдроме слабости синусового узла показана имплантация электрокардиостимулятора.

Электрокардиостимуляторы

В настоящее время существует множество вариантов постоянной электрокардиостимуляции. Общее у них одно: под кожу передней грудной стенки (обычно возле ключицы) имплантируют электрокардиостимулятор  — металлическую коробочку небольших размеров, провода от которой (электроды) — идут через вены к правым отделам сердца. Эти провода улавливают собственную электрическую активность сердца (чтобы синхронизировать свою работу с ней) и передают в сердце импульсы. Современные электрокардиостимуляторы почти всегда стимулируют и предсердия, и желудочки. Кроме того, они настроены таким образом, чтобы частота сердечных сокращений увеличивалась при нагрузке и уменьшалась в покое. Противопоказаний для электрокардиостимуляции в сущности нет: имплантация кардиостимулятора — это несложная и неопасная процедура, которую можно выполнять в любом возрасте.

Отдельный вид электрокардиостимуляции — так называемая бивентрикулярная стимуляция. Ее выполняют не по поводу собственно нарушений проводимости, а чтобы добиться синхронного сокращения всех стенок левого желудочка. Поэтому установку бивентрикулярного стимулятора называют также ресинхронизационной терапией. Электроды от стимулятора идут к правому желудочку и к коронарному синусу (который непосредственно прилежит к левому желудочку). Этот вид лечения сильно помогает некоторым больным с сердечной недостаточностью.

Некоторые электрокардиостимуляторы также обладают функцией дефибриллятора: они распознают угрожающие жизни аритмии и автоматически дают разряд, чтобы их устранить. 

Пациенты с электрокардиостимуляторами ведут обычный образ жизни. Им надо лишь избегать действия сильного магнитного поля. Так, больным с имплантированными кардиостимуляторами противопоказана магнитно-резонансная томография (МРТ). 

Время от времени пациентам с имплантированными кардиостимуляторами надо показываться специалистам: чтобы проверять исправность стимулятора (в частности, запас его аккумулятора), регулировать параметры стимуляции. 

Задать вопрос врачу кардиологу – МО «Здоровье»

21 ноября 2014 | 14:17Анастасия

Добрый вечер. Меня зовут Анастасия. Мне 21. С 11го класса, при сдаче ЕГЭ, я обнаружила жгучую боль в груди, с левой стороны, иррадиирующую в левое плечо. Обратилась к врачу, сделали ЭКГ, все в норме, никаких более процедур не делали.

Объяснили данное явление как защитная реакция организма на стресс. И все благополучно об этом забыли. включая меня. В первую сессию, я стала ощущать подобные симптомы, но, опять объяснила себе словами врача — защитная реакция организма на стресс. Затем боли возникали, но уже локально в области левой груди, которым особого внимания не придавалось. После 2го курса летом, У меня случился, будем называть его «приступ», только помимо болей я почувствовала жуткую нехватку в кислороде, словно моя грудная клетка на расширяется,чтобы набрать воздух и он мечется где-то по ходу носовых путей. Секунд через 6-7 меня отпустило. К доктору попасть не получилось, было лето и все почти в отпуска, да и самой с дня на день надо было уезжать. На 3ем курсе, в конце зимы, приступ описанный выше повторился, чрез недельку — опять..Как говорится: «Петух жаренный клюнул и я побежала к врачу.» Я пришла на приём, все рассказала и в ответ услышала громкий смех со словами:» Хахаха, напугалась за себя, ох как же мы себя любим, чуть прихватило и уже бежим — сердечко болит!! Молодая.
ничего с тобой не случится!!» После этого демонстративно и с издёвкой кинули направление на ЭКГ и сказали:»раздевайся, послушаю!». Но я, испытав столь оскорбительное отношение, разревелась, как малыш и убежала, с тех пор не обращалась к врачам вообще ни по каким причинам. Приступы повторялись, но говоря себе, что я здорова и все хорошо, они проходили и я о них забывала. Плацебо действовало, и я уже на 4ом курсе. буквально с 2е недели назад я почувствовала покалывания, через какое-то время теплое, но неприятное жжение, и тяжесть все в том же грудном отделе с левой стороны, в плечо не отдаёт, и дыхание не перехватывает, но словно не отпускает, и глубокий вдох делаю с небольшим натягом, вчера спала не спокойно, оно колотилось подобно стуку дятла по дереву. Препаратов никаких не принимаю, разве, что витамины. Но к вам я обратила не с просьбой пожалеть меня. оправдать или поругать, что не иду к врачу.А в надежде. что вы мне скажете, какие процедуры мне лучше сделать, что бы хотя-бы понять, что со мной?

28 ноября 2014 | 12:07Заподовников Сергей Константинович | Врач -кардиолог, КМН

Уважаемая Анастасия!

В подобной ситуации, безусловно, требуется консультация кардиолога. Симптомы, которые Вы подробно описали, относятся не только к заболеваниям сердечно-сосудистой системы. Но, поскольку это — самая «грозная» категория болезней, обследоваться необходимо, прежде всего, именно в этом направлении. Обследование быстрое и безболезненное — осмотр врача, электрокардиограмма, ультразвуковое исследование сердца и специальный метод исследования его ритма — суточное холтеровское мониторирование (с Вами постоянно будет небольшой прибор). На сновании результатов вышеперечисленных исследований врач-кардиолог делает вывод о наличии или отсутствии заболевания сердца. В любом случае, даже если заболевание сердца отсутствует, в результате обращения к врачу формулируется диагноз и рекомендуется лечение. К примеру, симптомы, подобные описанным Вами, могут иметь место при нейроциркуляторной дистонии.

Блокада ножки пучка Гиса, полная и неполная, правой и левой ножки — опасность заболевания и лечение

Что такое пучок Гиса

Пучком Гиса (ПГ) называют скопление клеток проводящей системы сердца, расположенное под атриовентрикулярным узлом и межжелудочковой перегородкой. ПГ состоит из правой и левой ножек. Ножки ПГ— это элементы, которые отвечают за передачу электрического возбуждения к сердечным желудочкам. Они, в свою очередь, разделябтся на ветви и располагаются по обе стороны межжелудочковой перегородки. В миокарде желудочков ножки разъединяются на проводящие пучки сердечных миоцитов (волокна Пуркинье).

Опасность блокадыпучка Гиса

Плохая проводимость пучка Гиса — это опасная патология, которая отражается на функциональной работе сердечной мышцы. Неполная блокада правой ножки ПГ приводит к частичным нарушениям передачи импульсов справа. Опасность для жизни представляет полная блокада правой ножки, при которой полностью прекращается передача возбуждения к сердцу.

В клинической практике блокада правой ножки ПГ нехарактерна для молодых людей (не более 0,1%). Данное заболевание развивается с возрастом и чаще поражает сердечно-сосудистый аппарат мужчин.

Причины развития блокады ножки пучка Гиса

Основными причинами заболевания являются кардиальные отклонения:

Среди врожденных дефектов особого внимания заслуживают такие опасные аномалии, как деформация межпредсердной и межжелудочковой перегородок, стеноз устья артерии легкого, недоразвитие сегмента ножки ПГ и другие пороки, вызывающие перегрузки правого желудочка.

Сбои в работе сердца способны спровоцировать и приобретенные заболевания:

  • опухоли сердца;
  • патологии миокарда;
  • травмы грудной клетки;
  • передозировку тяжелыми медикаментами;
  • гиперкалиемии с повышенным уровнем калия;
  • прогрессирующие типы мышечной дистрофии;
  • хроническиезаболевания дыхательных путей, которые осложнены обструкцией.

На развитие отклонений в проводящей системе сердца также влияют:

  • токсические отравления;
  • гормональные нарушения — поджелудочная железа играет важную роль в обменных процессах;
  • нарушения вегетативной системы — дисбаланс нервных функций влияет на состояние всего организма;
  • электролитные нарушения — недостаточное содержание в крови калия, натрия и магния может вызвать серьезные сбои в работе всех органов и систем.

Характерная симптоматика блокады ножки пучка Гиса

Сложность диагностики неполных изолированных блокад правой ножки пучка Гиса заключается в отсутствии явных симптомов. Как правило, патология выявляется при аускультации миокарда или на плановом ЭКГ.

Явные клинические отклонения при органическом заболевании характерны для полной блокады правой ножки ПГ. У трети пациентов с сердечной аномалией при аускультации отчетливо слышны изменения сердечных тонов. Наглядный сбой сердечного ритма при блокаде правой ножки пучка Гиса можно увидеть на ЭКГ.

Виды блокады ножки пучка Гиса

Любая блокада ножки пучка Гиса характеризуется замедлением или полной остановкой передачи электрических импульсов по двум или трем ветвям соответственно.

Исходя из анатомического строения проводящей системы сердца различают следующие блокады:

1. Однопучковые — поражению подвергается одна из ветвей пучка.

При любой разновидности однопучковой блокады наблюдается незначительное расширение комплекса QRS (0,08-0,11 с). Для полной блокады правой ножки Гиса этот параметр может увеличиться до 0,12 с или выше. Однопучковые блокады, в свою очередь, подразделяются на:

  • блокады правойножки;
  • блокады левой передней ножки;
  • блокады левой задней ножки.

2. Двухпучковые — когда поражены две или три ветви пучка Гиса.

Две основные ветви ПГ могут блокироваться последовательно или параллельно. Двухпучковые блокады вызывают высокую степень патологии проводниковой системы внутри сердечных желудочков и провоцируют значительно большую площадь поражения миокарда, чем блокада одной ножки. Выделяют следующие виды двухпучковых блокад:

  • блокада двух левых ветвей;
  • блокада передних левой и правой ветвей;
  • блокада задних левой и правой ветвей.

3. Трехпучковые — это блокады, при которых одновременно поражаются все три ветви пучка.

При неполной трехпучковой блокаде электрический импульс передается из предсердий к желудочкам по наименее пораженной ветви ПГ. Атриовентрикулярная проводимость при этом замедляется или блокируется полностью. На ЭКГ неполной трехпучковой блокады видна деформация и область расширения комплекса QRS, по виду схожие с блокадой двух ветвей ПГ с полным отсутствием проводимости импульса.

Неполная блокада— что это такое?

О неполной блокаде кардиологи говорят в случае нарушения передачи импульса в одной из ветвей Гиса, остальные же ветви должны функционировать нормально. При такой клинической картине по физиологически здоровым ветвям возбуждение передается к миокарду обоих желудочков, но отличается некоторым замедлением или отключением определенных комплексов желудочковых сокращений.

Выделяют два вида неполной блокады сердца:

  • Первой степени— при замедлении передачи возбуждения по ветвям между желудочками и предсердиями.
  • Второй степени— возникает, когда не все импульсы поступают из предсердий в желудочки.

Если ни один импульс не проходит из предсердий в желудочки, речь идет о полной блокаде сердца (опасной третьей степени). В случае такой патологии желудочки начинают самостоятельно сокращаться со скоростью 25-40 ударов в минуту, и это представляет опасность для сердечно-сосудистой системы пациента.

Блокада передней ветви левой ножки пучка Гиса

Заболевание может развиться на фоне:

На ЭКГ блокады передней ветви левой ножки пучка Гиса фиксируется глубокий зубец (S), высокий зубец (R) и отклонение в левую верхнюю часть суммарного вектора QRS. При данной патологии возбуждение к предсердиям и желудочкам передается по правой и задней ветвям левой ножки.

Последствиями заболевания являются:

  • гипертрофии левых желудочков и предсердий;
  • рубцы на переднебоковых поверхностях левого желудочка;
  • блокада соустьев сосудов (анастомозов) среди левых ветвей.

Блокада задней ветви левой ножки пучка Гиса

Для данной патологии характерно распространение импульсов к левому желудочку по передней ветви ПГ. Это тип блокады, который в большинстве случаев возникает при инфаркте миокардалевого желудочка или в случае острой закупорки легочной артерии (тромбоэмболии).

На фоне блокады могут развиться следующие заболевания:

  • коронарная недостаточность;
  • перегрузка левого предсердия;
  • гипертрофическая кардиомиопатия левого желудочка.

При блокаде задней ветви левой ножки пучка Гиса на ЭКГ явно выражен направленный вектор QRS, который стремится вверх, затем вперед и вправо. Через несколько секунд конечный и средний векторы QRS отклоняются вправо и вниз. На полученной ЭКГ фиксируется высокий зубец (R) и глубокий зубец (S).

Блокада правой ножки пучка Гиса

При патологии правой ножки ПГ возбуждение в проводящей системе сердца к левой части межжелудочковой перегородки и на желудочек проходит по левым ветвям. Передача импульсов к правому желудочку происходит с опозданием на 0,04-0,06 с. Вследствие перенесенного заболевания часто возникает гипертрофия левого желудочка.

Данная сердечная аномалия возникает при:

На ЭКГ блокады правой ножки пучка Гиса фиксируется увеличенная амплитуда расширенного высокого зубца (R) и увеличенный зубец (S). При этом комплекс QRS расширяется до 0,12 с и выше и приобретает форму rSR или qRS.

Блокада левой ножки пучка Гиса

В результате заболевания возбуждение к миокарду поступает только по правой ветви пучка Гиса. Левые же ветви получают импульс ниже области блокирования и с задержкой в 0,04-0,06 с.

Причины развития патологии:

На ЭКГ блокады левой ножки пучка Гиса комплекс QRS в ответвлениях повторяет форму зубца R (с уплощенной вершиной или зазубренной), электрическая ось сердца при этом расположена горизонтально и сильно отклонена влево. Период комплекса QRS составляет 0,12 с и выше.

Атриовентрикулярная блокада дистального уровня

При нарушении всех трех путей передачи импульсов в системе сердца говорят о дистальной атриовентрикулярной блокаде или блокаде правой ножки и обеих ветвей левой ножки ПГ.

Характерными признаками заболевания являются:

  • мерцания желудочков;
  • аритмичность сокращений;
  • асистолия различной длительности;
  • малая частота сокращений желудочков;
  • рубцовые изменения в задней стенке левого желудочка;
  • другие серьезные нарушения физиологических показателей сердца.

Если Вы обнаружили у себя схожие симптомы, незамедлительно обратитесь к врачу. Легче предупредить болезнь, чем бороться с последствиями.

Диагностика блокад

Кардиолог составляет анамнез заболевания на основании опроса и аускультативного исследования грудной клетки пациента. Для уточнения диагноза «блокада ножек пучка Гиса», выяснения причины патологии и назначения комплексной терапии дополнительно назначают:

Прогнозы и опасность при блокаде ножек пучка Гиса

При отсутствии прогрессирующей блокады правой ножки ПГ типичная симптоматика не представляет опасности и не требует терапевтической коррекции. Пристальный контроль кардиолога и лечение требуется в случае расширения границ заболевания и ухудшения состояния проводящей системы сердца.

Как показывает клиническая практика, если у пациента нет других усугубляющих патологий органов и систем, прогноз лечения всегда благоприятный. Прецедентов перерастания изолированной блокады правой ножки ПГ в полную блокаду не зафиксировано.

При блокадах правой ножки ПГ существует опасность прогрессирующего течения заболевания и перерастания в осложненную предсердно-желудочковую блокаду второй или третьей степени. Когда патология развивается на фоне гипертонической болезни, сердечной недостаточности и кардиомегалии, прогноз достаточно неблагоприятный (в разы увеличивается возможность летального исхода).

Блокада левой ножки пучка Гиса — это атипичное состояние проводящей системы сердца, которое ведет к тяжелым атриовентрикулярным осложнениям или сердечной недостаточности. Заболевание протекает бессимптомно, поэтому диагностика и лечение патологии на ранних сроках в клинической практике встречается достаточно редко. Опасный прогноз — если заболевание развилось на фоне острого инфаркта миокарда. В таком случае параллельно появляется желудочковая аритмия, пароксизмальная тахикардия и мерцание желудочков, что неминуемо приводит к летальному исходу.

Лечение блокад ножек пучка Гиса

При подозрении на патологию элементов проводящей системы сердца необходимо пройти консультацию у врачей: аритмолога, кардиолога и в некоторых случаях кардиохирурга. В случае неполной блокады ветвей пучка Гиса основное лечение должно быть направлено на орган или систему органов, которые спровоцировали аномальную работу сосудистого русла и стали причиной развития блокады.

Общей схемы терапии при блокадах ножек пучка Гиса не существует. Если нарушения передачи импульсов вызваны стенокардией, гипертензией или сердечной недостаточностью, то базовое лечение строится на приеме гипотензивных и антиаритмических средств, а также сердечных гликозидов. Для блокад проксимального типа наиболее эффективным считается лечение симпатомиметическими средствами: изадрином или подкожными инъекциямиатропина.

При неполной блокаде, если пациент не испытывает дискомфорт и может вести нормальный образ жизни, требуется исключительно контрольная диагностика и общеукрепляющая терапия.

В случае генетических отклонений или врожденных пороков лечение блокад проводится хирургическим путем. Основаниями к проведению операции являются частые обмороки и угрожающие жизни аномалии работы сердца. В современной кардиохирургии для коррекции работы сосудистых ветвей проводящей системы сердца устанавливают электрокардиостимулятор — прибор, генерирующий сокращения и обеспечивающий заданный сердечный ритм.

При неполной блокаделевой ножки пучка Гисаширина комплекса больше нормы, поэтому для заболевания характерен замедленный импульс. Как правило, такая блокада диагностируется на электрокардиограмме. Опытный кардиолог может при аускультации услышать расщепление тона на верхушке. Частичные нарушения передачи импульса в ветвях пучка Гиса способствуют развитию хронической сердечной недостаточности. Чтобы блокада не переросла в полную, при таком диагнозе противопоказан прием сердечных гликозидов.

Блокады дистального типа плохо поддаются медикаментозному лечению. Самым эффективным средством считаются электростимуляции сердца. Для острых блокад, которые были спровоцированы инфарктом миокарда, показана временная электростимуляция. При стойкой форме блокад назначается постоянная электростимуляция.

Если внезапно возникла полная блокада, снять острое состояние больного поможет инъекция «Эуспирана» или «Изупрела» с раствором глюкозы (5%), можно использовать эти же препараты в форме таблеток. При длительном воздействии медикаментов на нервно-сосудистое заболевание, полная сердечная блокада может переходить в частичную.

Опасность для жизни пациента представляет полная блокада сердца на фоне дигиталисной интоксикации. В таком случае для нормализации состояния отменяют прием гликозидов. Если полная блокада с ритмом в 30-40 ударов в минуту сохраняется, назначают инъекции «Атропина»внутривенно и «Унитола»внутримышечно (2-4 раза в день), можно дополнить терапию временной электростимуляцией.

Профилактика блокады ножек пучка Гиса

Для предотвращения развития блокад и других сердечно-сосудистых патологий рекомендуется соблюдать общие правила:

  • продолжительный сон;
  • активный образ жизни;
  • отсутствие самолечения;
  • отказ от курения и алкоголя;
  • сбалансированное питание по режиму;
  • исключение стрессов и нервных потрясений;
  • регулярная диагностика и лечение сердечных заболеваний.
Данная статья размещена исключительно в познавательных целях и не является научным материалом или профессиональным медицинским советом.

Диагностика нарушений проводимости сердца (часть 3) | Ялымов А.А., Шехян Г.Г., Щикота А.М., Задионченко В.С.

4.10. Билатеральная блокада ножек пучка Гиса (двусторонняя блокада, библокада, двойная блокада ножек) – сочетанное поражение правой ножки и ствола левой ножки. Блокада левой и правой ножек может быть полной и неполной, постоянной или преходящей. Возможен переход одной блокады в другую (альтернирующая блокада) или их сочетание. При одновременном развитии полной билатеральной блокады полностью прекращается проведение импульсов от предсердий к желудочкам и формируется полная поперечная блокада.

На ЭКГ характерны признаки БПНПГ (комплекс QRS более 0,1 с, с преобладающим зубцом R в отведениях V1–V2, III, aVF) в сочетании с признаками БЛНПГ (комплекс QRS более 0,1с, с преобладающим зубцом R в отведениях V5–V6, I, aVL), они представлены на рисунке 27.
4.11. Трехпучковая блокада – это нарушение проводимости по правой ножке в сочетании с перемежающейся блокадой передней и задней ветвей левой ножки.
ЭКГ-признаки:
1. Блокада правой ножки пучка Гиса в сочетании с блокадой передней и задней ветвей левой ножки пучка Гиса (БПНПГ + БПВЛНПГ/БЗВЛНПГ).
2. Блокада правой ножки пучка Гиса в сочетании с блокадой передней ветви левой ножки пучка Гиса и АВ-блокадой I–II степени (БПНПГ + БПВЛНПГ + АВ-блокада I–II ст.).
3. Блокада правой ножки пучка Гиса в сочетании с блокадой задней ветви левой ножки пучка Гиса и АВ-блокадой I–II степени (БПНПГ + БЗВЛНПГ + АВ-блокада I–II ст.) (рис. 28).
4.12. Арборизационная блокада – нарушение проводимости по волокнам Пуркинье. Комплекс QRS низкоамплитудный, расширенный (больше 0,12 с), зазубренный (рис. 29).
4.13. Преходящие блокады ножек пучка Гиса и ветвей левой ножки (транзиторная блокада ножек и ветвей левой ножки) – это обратимое нарушение проводимости, возникшее вследствие органического поражения миокарда либо функциональных нарушений проводимости. При преходящих блокадах ветвей пучка Гиса во время исчезновения блокады регистрируются отрицательный зубец Т и/или депрессия сегмента ST в отведениях, где комплекс QRS во время внутрижелудочковой блокады был отрицательным – «постблокадный синдром», вариант «постдеполяризационного синдрома» (рис. 30–32).
4.14. Блокада на выходе (exit block) – это местная блокада, не позволяющая импульсу возбуждения (синусовому, эктопическому или искусственно вызванному электрокардиостимулятором) распространиться в окружающем миокарде, несмотря на то, что последний находится во внерефрактерном периоде. Блокада на выходе является результатом заторможенной проводимости около очага образования импульсов или пониженной интенсивности импульса возбуждения. Первый механизм встречается значительно чаще второго. Блокада на выходе в результате нарушения проводимости миокарда около очага образования импульсов может быть типа I с периодикой Самойлова–Венкебаха или типа II – внезапно наступающего, без постепенного углубления нарушения проводимости. Блокада на выходе – частый феномен, он встречается при различной локализации автоматического центра (рис. 33).

Заключение
Многообразие нарушений проводимости сердца значительно затрудняет их диагностику. Тем не менее, актуальность адекватной оценки дисфункции проводящей системы сердца не вызывает сомнений. Данная публикация предназначена в помощь в первую очередь практикующему врачу-кардиологу, а также другим специалистам.

* Часть 1 см. РМЖ. 2013, № 4. С. 237–240.
Часть 2 см. РМЖ. 2013, № 12. С. 647–650.



Литература
1. Аритмии сердца / Под ред. В. Дж. Мандела. М.: Медицина, 1996. С. 512.
2. Джанашия П.Х., Шевченко Н.М., Шлык С.В. Нарушение ритма сердца. М.: Издательство «Оверлей», 2006. С. 320.
3. Исаков И.И., Кушаковский М.С., Журавлева Н.Б. Клиническая электрокардиография. Л.: Медицина, 1984.
4. Кардиология в вопросах и ответах / Под ред. Ю.Р. Ковалева. Спб.: ООО «Издательство Фолиант», 2002. С. 456.
5. Кушаковский М.С. Аритмии сердца. Спб.: Гиппократ, 1992.
6. Кушаковский М.С., Журавлева Н.Б. Аритмии и блокады сердца (атлас электрокардиограмм). Л.: Медицина, 1981.
7. Мурашко В.В., Струтынский А.В. Электрокардиография: Учеб. пособие. 3-е изд., перераб. и доп. М.: ООО «Медпресс»; Элиста: АПП «Джангар», 1998. С. 313.
8. Орлов В.Н. Руководство по электрокардиографии. М.: ООО «Медицинское информационное агентство», 1999. 528 с.
9. Томов Л., Томов И. Нарушения ритма сердца. София: Медицина и физкультура, 1976.
10. Циммерман Ф. Клиническая электрокардиография. М.: Бином, 1997.
11. Щикота А.М., Снеткова А.А., Шехян Г.Г., Ялымов А.А.Клиническая задача по теме: дифференциальная диагностика заболеваний сопровождающихся подъемом сегмента ST, № 3 (синдром Бругада) // Справочник поликлинического врача. 2012. № 5. С. 14–15, 38.
12. Яковлев В.Б., Макаренко А.С., Капитонов К.И. Диагностика и лечение нарушений ритма сердца. М.: Бином. Лаборатория знаний, 2003. С.168.
13. Ялымов А.А., Шехян Г.Г., Щикота А.М. Руководство по электрокардиографии / Под ред. Задионченко В.С. Saarbrucken, Germany. Издатель: LAP LAMBERT Academic Publishing GmbH&Co. KG, 2011.
14. Brugada P., Brugada J. Right bundle branch block, persisten ST segment elevation and sudden cardiac death: a distinct clinical and electrocardiographic syndrome. A multicenter report // J. Am. Coll. Cardiol. 1992. Vol. 20. P. 1391–1396.
15. Rosenbaum M.B., Elizari M.V., Lazzari J.O. The Hemiblocks: New Concepts of intraventricular Conduction Based on Human Anatomical, Physiological and Clinical Studies. Florida, 1970.

.

Порекомендуйте статью вашим коллегам

Блокада ножек пучка Гиса: причины, варианты, методы лечения

Нарушение проведения импульса по ножкам пучка Гиса — следствие органического поражения внутри миокарда. Оно проявляется в виде изменения движения электрических разрядов по одной или нескольким веткам поводящей системы, расположенной в желудочках. Как отдельная нозология в МКБ-10 не выделяется.

Причины

Пучок Гиса – это скопление специфических нейронов, расположенных в соединительнотканной перегородке между желудочками. Дойдя до верхушки сердца, он разделяется на ножки, а они – на отдельные волокна. Эти нюансы анатомии важно знать для дальнейшего понимания патогенеза заболевания.

Причины блокады правой ножки:

  • Митральный стеноз.
  • Крупный дефект межпредсердной перегородки.
  • Недостаточность трехстворчатого клапана.
  • Ишемическая болезнь.
  • Гипертония.

Все эти патологии сопровождаются утолщением правых отделов сердца за счет перегрузки камер давлением и/или объемом.

Причины блокады левой ножки:

  • Атеросклеротический кардиосклероз.
  • Нарушение строения клапана аорты.
  • Кардиомиопатия.
  • Миокардиты.
  • ТЭЛА.
  • Повышенный уровень калия в крови.

Сочетанная блокада встречается, как правило, при коарктации аорты, недостаточности или стенозе ее клапана.

Варианты

Блокада волокон пучка Гиса – это симптом органического поражения сердца. Она не имеет собственных специфических проявлений, однако пациенты могут предъявлять жалобы на головокружение, урежение сердцебиения и синкопальные состояния.

Какие бывают варианты блокады?

  1. Поражение правой ножки. Если оно неполное, то импульс по волокнам проходит, хоть и с замедлением, что ведет к рассинхронизации сокращения желудочков. Иногда выявляется у абсолютно здоровых людей.
  2. Поражение левого пучка. Возбуждение передается на желудочки за счет правой ножки и волокон Пуркинье, что чревато большой задержкой между сокращениями предсердий и желудочков. Есть такое явление, как неполная блокада. В таком случае мышечные волокна левого желудочка частично получают импульс от правой ножки, частично – от нитей Пуркинье и с задержкой – непосредственно от левой ножки. За счет этого разные участки миокарда сокращаются неодновременно.
  3. Сочетанная патология. Она разделяется на следующие подвиды:
  • Прерывание импульса на правой и задней левой ножках. Тогда возбуждение сначала идет к верхушке сердца, затем на левый желудочек, а после – на правый.
  • Блокада правой и передней левой ножки. Импульс распространяется по задней стенке сердца, охватывает верхушку и только потом достигает обоих желудочков.
  • Полная поперечная блокада. Распространение импульса невозможно. Электрические разряды генерируются одновременно в двух нервных узлах, поэтому предсердия сокращаются в нормальном ритме, а желудочки – в замедленном.

Все эти изменения специалист может определить в процессе записи электрокардиографии.

Диагностика

Ведущий метод – ЭКГ в стандартных и дополнительных отведениях. Имеются вариации этой диагностической процедуры, позволяющие уточнить степень и распространенность изменений в миокарде:

  • чрезпищеводная,
  • ритмокардиография,
  • холтеровское мониторирование.

Для выявления основного заболевания используют УЗИ, МРТ, КТ, ПЭТ и другие способы визуализации. Обязательна консультация кардиолога и кардиохирурга.

Специфического лечения блокад не разработано. Терапия направлена на лечение основного заболевания, но в случае полной поперечной блокады возможна имплантация автономного водителя ритма. Прогноз заболевания благоприятный, но основывается на течении первичной патологии.

Детский Клинико Диагностический центр в Домодедово

04.02.2021 Ксения

Здравствуйте, проходили с ребёнком ЭКГ, он очень сильно плакал, дёргался, присоски снимал, то есть еле еле экг сделали, она сказала может показать плохой результат, и нам в заключение написали. Синусовая тахикардия с чсс=158-142 в 1! Вертикальное положение ЭОС. Нарушение проводимости по правой ножке, ручка Гиса. Регистрируется эпизод выраженной синусовой тахиардии с чсс=176 в 1!. Нам педиатр сказала что у всех детей так которые плачут на экг,. В год когда проходили экг все было хорошо, потому что он и не плакал. А в этот раз сделали экг показали плохое потому плакал ужасно. У нас полидактилия обоих кистей, поэтому сказали проходить экг для госпиталазии, я им показала сказали мы не можем сделать операцию потому что ЭКГ плохое, сказали кардиологу нужно чтоб он сделал хорошее заключение…..ведь у ребёнка симптомов не каких нету .. Я очень переживаю.

Ксения,добрый день! Поводов для переживания нет никаких. Любое волнение ребёнка отражается на экг. Чтобы получить заключение для операции, необходимо посетить кардиолога,который после осмотра,даст необходимое заключение. Приходите в наш центр!!

03.02.2021 Александр

Здравствуйте. Ребенку 7 лет. Занимается спортивным плаванием. Зделали ЭКГ,в заключении написано нестабильный синусовый ритм.Два года назад делали УЗИ сердца,все в норме.

Александр, добрый день! В плановое обследование ребёнка спортсмена входит экг проба с физической нагрузкой и эхокардиография(1 раз в год). По представленному экг заключению непонятно, что значит ритм нестабильный и не указана ЧСС. Рекомендуется обратиться к детскому кардиологу,если у педиатра есть какие-то сомнения по допуску к спорту.

03.02.2021 Людмила

Здравствуйте.Сыну 17 лет.Был диагноз ПМК.Проходил мед комиссию в школе и на ЭКГ обратили внимание:синус.брадикардия.чсс105.эос верикал.Нарушение процессов реполеризации неспецифического характера.нельзя исключить гипертрофию ЛЖ.Это может быть?Всегда занимались спортом и ни чего не было.

Людмила,добрый день! В случае регулярного занятия спортом возникают изменения в миокарде,которые могут быть физиологическими,т.н «Спортивное сердце», либо являться признаками патологических отклонений. Поэтому очень важно ежегодно проходить медосмотр спортсмену,который включает в себя экг пробу с физической нагрузкой, эхокардиографию,возможно и дополнительные методы обследования. Только по результату всех обследований можно поставить диагноз и определиться с тактикой дальнейшего наблюдения.

03.02.2021 Шилова Елена

Здравствуйте. Девочка 10 ле 11 месяцев. Сделали ЭКГ с нагрузкой, занимается фигурным катанием. Результат….ритм синусовый, брадиаритмия ЭОС вертикальная. Нарушения процессов реполяризации желудочков. Нестандартная реакция на физ нагрузку, после 20 приседаний ЧСС с 63 уд упало до 53 уд. АД с 107/60 упало до101/47 мм рт. Полное восстановление показателей на5 минуте после нагрузки ЧСС 64, АД 109/56 мм рт. Ребенка ничего не беспокоит, сердце не болит. Занимаемся спортом 5 лет, тренировки 5 р в нед по 2 часа в день. В ноябре переболела ковидом в лёгкой форме. Может ли это быть из за этого. И можно ли заниматься спортом дальше? Рекомендовано сделать УЗИ сердца.

Елена,добрый день! Такие изменения на ЭКГ после физической нагрузки могут быть связаны с избыточными физическими нагрузками (синусовый узел неадекватно работает), также причиной может быть перенесённый COVID. Рекомендуется пройти лабораторные обследования для исключения воспалительных изменений в синусовом узле,эхокардиографию и суточное мониторирование ЭКГ. Перечень обследований даст кардиолог,которого необходимо посетить.

02.02.2021 Мария

Здравствуйте. Ребенку 9 месяцев, планируется оперативное вмешательство по поводу паховой грыжи. Подскажите является ли наше ЭКГ вариантом возрастной нормы: синусовая аритмия, ЧСС 104-126, вертикальное положение ЭОС, нарушение проводимости по ПНПГ, повышение эл.активности правого желудочка. ЭхоКГ в три месяца без особенностей.

Мария,добрый день! Результат ЭКГ исследования является вариантом нормы для ребёнка вашего возраста,но решение допуска к оперативному лечению (наркозу) решает педиатр,если необходимо кардиолог после осмотра ребёнка. Разные клиники предоставляют перечень необходимых обследований и заключений.

02.02.2021 Ксения

Подскажите у ребенка 10лет ритм синусовый чсс 80в минуту нарушение реполяризации это страшно мы спорьсмены раньше не было такого недпвно болел орз

Ксения,добрый день! Нарушение процессов реполяризации(питание миокарда) может быть связано с перенесённой ОРВИ,низким гемоглобином или плохим аппетитом ребёнка. Если врач педиатр не может назначить лечение,то рекомендуется плановое посещение кардиолога. Для ребёнка,занимающегося спортом в стандарт обследования входит экг проба с физической нагрузкой и эхокардиография.

01.02.2021 Анжелика

Здравствуйте! Моей дочери 16 лет, сейчас учится в 11 классе, собирается поступать в Академию МВД. Делали УЗИ сердца, которое показало ДХЛЖ. В ноябре после ОРВИ сдала ЭКГ, которое показало правопредсердный ритм. Кардиолог назначила сдать биохимию крови (результат хороший) и пропить 30 дней магний. Через 3 недели сдали опять ЭКГ — ритм правопредсердный. После этого был назначен элеутеррококк и нейромед форте, после двух недель ЭКГ — ритм правопредсердный, с физической нагрузкой и ортоскопическая проба — синусовый. Подскажите, почему такое может быть? В июне ЭКГ было хорошим.

Анжелика,добрый день! Причиной нарушения ритма сердца может быть дисбаланс нервной системы(воспалительные изменения я так понимаю были исключены после проведения лабораторных исследований). Восстановление синусового ритма на фоне физической нагрузки говорит также в пользу функциональных изменений. Необходимо провести курсы кардиометаболической терапии,а также добавить препараты для улучшения работы нервной системы. Желательно сделать суточное мониторирование ЭКГ, чтобы оценить прогноз и сориентироваться в объёме и длительности терапии.

01.02.2021 Анна

Здравствуйте! Ребёнок 8 лет,регулярно занимается плаванием,периодически футболом,по результатам ЭКГ ритм синусовый,правильный с частотой 76 уд.,нормальное положение ЭОС,НБПНПГ,выявлена впервые.По результатам ЭХОКГ паталогий не выявлено,но имеются ложные диагональные хорды,никак не влияющие на гемодинамику.Жалоб нет.Подскажите,пожалуйста,можно ли ребенку заниматься спортом без ограничений? И может ли НБПНПГ возникнуть из-за имеющихся дополнительных хорд?

Анна,добрый день! Неполная блокада правой ножки пучка Гиса является особенностью проводимости у детей,занимающихся спортом более 2-х лет,т.н «Спортивное сердце». Для оценки гемодинамики и допуска к спорту рекомендуется ЭКГ проба с физической нагрузкой и эхокардиография. Имеющиеся хорды по данным эхокардиографии никак не влияют на проводимость и считаются вариантом нормы.

31.01.2021 Анна

Добрый день! Ребёнок 5 лет, результат ЭКГ: ритм синусовый правильный 100 уд. в мин. РQ 0,12, QRS 0,08, QT 0,36. Эос-полувертикальное положение, неполная блокада правой ножки п. Гиса. Что это такое, нужно ли беспокоиться? Спасибо за ответ!

Анна,добрый день! Неполная блокада правой ножки пучка Гиса является вариантом нормы в случае,если ранее проводимая эхокардиография не выявляла никакой патологии и у ребёнка нет никаких жалоб. Рекомендуется в таком случае экг контроль через 6 месяцев.

30.01.2021 Ольга

Здравствуйте. Подскажите пожалуйста, на ЭКГ ритм синусовый чсс 87 уд. в мин. ЭОС вертикальная. Неполная блокада ПНПГ. PQ 0,19. Ребёнку 11 лет занимается спортом профессионально 6 лет. Беспокоит значение PQ 0,19 что это такое, на что влияет и не помешает ли для продолжения спортивной деятельности.

Ольга,добрый день! Замедление атрио-вентрикулярной проводимости до 0,19 сек для ребёнка 11 лет расценивается как АВ блокада 1 степени. Чаще всего такое замедление проводимости связано с функциональными изменениями(влиянием нервной системы на регуляцию сердечного ритма и проводимости). Чтобы допустить ребёнка к занятию спортом необходимо провести экг пробу с физической нагрузкой, если на нагрузку проводимость улучшается, значит это функциональная АВ блокада. Если результат эхокардиографии хороший,то спортом заниматься можно. Рекомендуется планово посетить кардиолога с результатами обследований.

ПЕРВЫЕ РЕЗУЛЬТАТЫ ИЗУЧЕНИЯ НАРУШЕНИЙ В ПРОВОДЯЩЕЙ СИСТЕМЕ СЕРДЦА ПОСЛЕ ТРАНСАПИКАЛЬНОЙ ИМПЛАНТАЦИИ КЛАПАНА «МЕДЛАБ-КТ» В РАННЕМ ПОСЛЕОПЕРАЦИОННОМ ПЕРИОДЕ | Попылькова

1. Евдокимов С.В., Базылев В.В., Россейкин Е.В и др. Протез аортального клапана сердца для транскатетерной имплантации; патент на изобретение RUS 2634418 21.06.2016

2. Евдокимов С.В., Базылев В.В., Евдокимов А.С. Шприц для создания давления в баллонном катетере; патент на изобретение RUS 173451 27.01.2017

3. Базылев В.В., Воеводин А.Б., Захарова А.С., Россейкин Е.В. Средне-отдаленные результаты транскатетерной имплантации протеза аортального клапана «МЕДЛАБ-КТ». Бюллетень НЦССХ им. А.Н. Бакулева РАМН Сердечно-сосудистые заболевания. 2018; 19(6):163.

4. Базылев В.В., Воеводин А.Б., Захарова А.С., Россейкин Е.В. Непосредственные клинические и гемодинамические результаты транскатетерной имплантации протеза аортального клапана «МедЛабКТ». Патология кровообращения и кардиохирургия. 2018;22(3):17-24.

5. Sundt T.M., Bailey M.S., Moon M.R. et al. Quality of life after aortic valve replacement at the age of >80 years. Circulation. 2000; 102 (19 Suppl. 3): III70-4.

6. Safian R.D., Berman A.D., Diver D.J. et al. Balloon aortic valvuloplasty in 170 consecutive patients. N. Engl. J. Med. 1988; 319 (3): 125-30.

7. Letac B., Cribier A., Koning R., Bellefleur J.P. Results of percutaneous transluminal valvuloplasty in 218 adults with valvular aortic stenosis. Am. J. Cardiol. 1988; 62 (9): 598-605.

8. Otto C.M., Mickel M.C., Kennedy J.W. et al. Three-year outcome after balloon aortic valvuloplasty. Insights into prognosis of valvular aortic stenosis. Circulation. 1994; 89 (2): 642-50.

9. Siontis G., Jüni P., Pilgrim T. et al. Predictors of perma nent pacemaker implantation in patients with severe aortic stenosis undergoing TAVR: a metaanalysis. J. Am. Coll. Cardiol. 2014; 64 (2): 129-40.

10. Базылев В.В., Гальцева Н.В. Физическая реабилитация больных после кардиохирургических вмешательств в отделении реанимации и интенсивной терапии. Бюллетень НЦССХ им. А.Н. Бакулева РАМН Сердечно-сосудистые заболевания. 2017; 18(6):216.

11. Макарова Н.В., Дурманов С.С., Козлов А.В. и др. Влияет ли ранняя активизация пациентов после имплантации электрокардиостимуляторов на частоту послеоперационных осложнений // Вестник аритмологии. 2013; 74: 40-44.

12. Глумсков А.Б., Дурманов С.С., Базылев В.В. Является ли правожелудочковый электрод электрокардиостимулятора независимым фактором риска в развитии трикуспидальной регургитации в раннем послеоперационном периоде? Одноцентровое проспективное исследование. Анналы аритмологии. 2017;14(1):21-28.

13. Stewart BF, Siscovick D, Lind BK et al. Clinical factors associated with calcific aortic valve disease. Cardiovascular Health Study. J Am Coll Cardiol. 1997;29:630-4.

14. O’Brien S., Shahian D., Filardo G. et al. The Society of Thoracic Surgeons 2008 cardiac risk models: part 2 — isolated valve surgery. Ann. Thorac. Surg. 2009; 88 (1 Suppl.): S23-42.

15. Никитина Т.Г., Акишбая М.О., Скопин И.И., Бокерия Л.А. Непосредственные и отдаленные результаты хирургической коррекции аортального стеноза. Грудная и сердечно-сосудистая хирургия. 2007; 49 (3): 12-8. [Nikitina T.G., Akishbaya M.O., Skopin I.I., Bockeria L.A. Immediate and lateresults of surgical correction of aortic stenosis. Russian Journal of Thoracic and Cardiovascular Surgery. 2007; 3: 12-8 (in Russ.).]

16. Gehlot A., Mullany C.J., Ilstrup D. et al. Aortic valve replacement in patients aged eighty years and older: early and long-term results. J. Thorac. Cardiovasc. Surg. 1996; 111 (5): 1026-36.

17. Cribier A, Eltchaninoff H, Bash A et al. Percutaneous transcatheter implantation of an aortic valve prosthesis for calcific aortic stenosis: first human case description. Circulation. 2002;106:3006-8.

18. Smith CR, Leon MB, Mack MJ et al. PARTNER Trial Investigators: Transcatheter versus surgical aortic-valve replacement in high-risk patients. N Engl J Med. 2011;364:2187-98.

19. Leon MB, Smith CR, Mack M et al. PARTNER Trial Investigators: Transcatheter aortic-valve implantation for aortic stenosis in patients who cannot undergo surgery. N Engl J Med. 2010;363:1597-607.

20. Gilard M, Eltchaninoff H, Iung B et al. Registry of transcatheter aortic-valve implantation in high-risk patients. N Engl J Med. 2012;366:1705-15.

21. Medtronic CoreValve ® System Demonstrates Positive Clinical Performance at Two Years in “Real World” ADVANCE Study.

22. Iung B., Baron G., Butchart E.G et al. A prospective survey of patients with valvular heart disease in Europe: the Euro Heart Survey on Valvular Heart Disease. Eur. Heart J. 2003; 24 (13): 1231-43.

23. Lee M., Yeshwant S.C., Chava S., Lustgarten D.L. Mechanisms of heart block after transcatether aortic valve replacement — cardiac anatomy, clinical predictors and mechanical factors that contribute to permanent pacemaker implantation. Arrhytm.Electrophysiol. Rev. 2015; 4 (2): 81-5.

24. Kawashima T, Sato F. Visualising anatomical evidences on atrioventricular conduction system for TAVI. Int J Cardiol. 2014;174:1-6.

25. Holmes D.R. Jr, Mack M.J., Kaul S. et al. 2012 ACCF/ AATS/SCAI/STS expert consensus document on transcatheter aortic valve replacement. J. Am. Coll. Cardiol. 2012; 59 (13): 1200-54.

Новый метод скрининга ингибиторов бета-глюкозидазы | BMC Microbiology

Ингибиторы глюкозидазы ответственны за нарушение активности глюкозидазы, фермента, расщепляющего гликозидную связь. Эти ингибиторы сыграли жизненно важную роль в раскрытии функций глюкозидаз в живой системе, изменяя или блокируя определенные метаболические процессы; и это открытие привело к нескольким применениям этих химических соединений в сельском хозяйстве и медицине [1].

Поиск новых ингибиторов глюкозидазы чрезвычайно важен из-за их терапевтического потенциала в лечении диабета, инфекции, вызванной вирусом иммунодефицита человека, метастатического рака, лизосомальной болезни накопления и т. Д.[2]. Микроорганизмы, особенно морские микроорганизмы, обладают уникальной способностью продуцировать ценные соединения. Таким образом, скрининг экстрактов микробных культур на предмет обнаружения новых структур, которые могут ингибировать глюкозидазы, представляет огромный интерес.

Сообщений об ингибиторах глюкозидазы, особенно о ингибиторах β-глюкозидазы из микроорганизмов, крайне мало, возможно, из-за отсутствия эффективных высокопроизводительных методов обнаружения присутствия ингибиторов β-глюкозидазы в экстрактах микробных культур.Наиболее часто используемый метод включает p, -нитрофенил- β -D-глюкопиранозид (PNPG) в качестве субстрата либо в скрининговом тесте на микропланшетах, либо в автографическом методе ТСХ [3-5]. В этом методе активность глюкозидазы измеряется косвенно, в колориметрическом анализе путем визуальной или спектрофотометрической оценки нитрофенильного хромофора (желтый), высвобождаемого из PNPG в отсутствие ингибитора. Желтая окраска, возникающая при использовании этого глюкопиранозида в положительной реакции на глюкозидазу, слишком слабая и не контрастирует с окружающей средой для четкого визуального различия на пластине для ТСХ или в другом месте [5-7].Методы микропланшетов являются быстрыми, но многие факторы, такие как протеаза в ферментационных бульонах, микробное загрязнение экстрактов, биологические пигменты или соли в неочищенных экстрактах, могут повлиять на показания [8].

Автографический метод ТСХ — с использованием эскулина в качестве субстрата — Салазара и Фурлана [7] был наиболее убедительным методом в качестве альтернативы методам с использованием PNPG. В этом автографическом методе ТСХ иммобилизация фермента β-глюкозидаза осуществляется путем захвата геля в агаре и выполняется автография ТСХ.Ферментативная активность тестируется на эскулине (6,7-дигидроксикумарин-6-глюкозид) в качестве субстрата, который расщепляется на эскулетин (6,7-дигидроксикумарин) и глюкозу; высвободившийся эскулетин реагирует с FeCl 3 с образованием черновато-коричневого осадка. Подавление этой активности наблюдается в виде бледно-желтой зоны вокруг пятна положительных образцов.

Во многих предыдущих исследованиях использовался автографический метод ТСХ, который может не подходить для высокопроизводительного скрининга, поскольку он более трудоемок и требует много времени.Более того, однородное разделение соединений во всех экстрактах не может быть достигнуто с помощью единой системы растворителей; следовательно, нанесение всех экстрактов на один планшет для ТСХ для быстрого проведения анализа было бы неприятным. Для скрининга большого количества натуральных экстрактов автография ТСХ была проведена без проявления планшета, так что активность, возникающая в результате синергетического действия нескольких компонентов экстрактов, была обнаружена [9]. В этом контексте мы считаем ненужным использование пластин для ТСХ; более того, потому что зона ингибирования на белом фоне пластинки для ТСХ была не очень четкой и, следовательно, есть вероятность потери некоторых многообещающих природных экстрактов.Короче говоря, этими традиционными методами трудно точно оценить активность ингибирования глюкозидазы в нескольких экстрактах одновременно.

Таким образом, мы разработали новый метод нанесения раствора фермент-агар тонким слоем на чашку Петри и точечного посева образцов на поверхность агара для достижения четкого определения ингибиторов β-глюкозидазы в экстрактах микробных культур.

Идентификация и характеристика новой β-глюкозидазы посредством метагеномного анализа Bursaphelenchus xylophilus и его микробной флоры

Создание и скрининг метагеномной библиотеки

Метагеномная библиотека, содержащая 4699 клонов, была сконструирована из общей ДНК сообщества, выделенной из Bx и связанные с ним микробные сообщества.Анализ рестрикционных эндонуклеаз показал, что клоны вставляются в диапазоне от 1,5 до 5,5 т.п.н., при среднем размере ~ 3,0 т.п.н. Вставки также демонстрировали отчетливые узоры рестрикции. Клоны переносили на планшеты для скрининга для оценки активности β-глюкозидазы. Всего было выделено пять клонов (Cen95, Cen107, Cen228, Cen499, Cen502), которые экспрессировали β-глюкозидазную активность. Был получен единственный клон Cen502, который проявлял относительно сильную активность β-глюкозидазы, на что указывало образование самого большого черного ореола при скрининге β-глюкозидазы (рис.1). Поэтому Cen502 был выбран для дальнейшего анализа.

Рисунок 1

Скрининг активности β-глюкозидазы в метагеномной библиотеке на планшетах для скрининга. Было получено пять клонов, экспрессирующих относительно сильную β-глюкозидазную активность: Cen95, Cen107, Cen228, Cen499 и Cen502. Стрелки указывают имена клонов. Клон Cen502 проявил наибольшую активность и был выбран для дальнейшего исследования.

Последовательность и структурный анализ гена β-глюкозидазы

cen502

Длина вставки ДНК Cen502 составляла 2670 п.н.Анализ BLAST выявил наличие открытой рамки считывания (ORF), состоящей из 1398 п.н. ORF содержала полноразмерный ген β-глюкозидазы ( cen502 ), который кодировал белок, состоящий из 465 аминокислот. Последовательность гена cen502 была представлена ​​в GenBank (номер доступа KX095398, данные не опубликованы), и на этот ген был успешно получен национальный патент на изобретение (патент № 201410014799.X).

На основе расчетов с использованием программы ExPASy http: // cn.expasy.org/tools/pi_tool.html, теоретическая молекулярная масса Cen502 составляет 52,8 кДа, а pI составляет 8,7. Анализ последовательности с помощью программного пакета SMART показал, что предполагаемый белок имел один домен гликозилгидролазного семейства 1 (простирающийся от аминокислотных положений 111 до 454; рис. 2А). Поиск консервативных доменов в NCBI подтвердил результаты анализа SMART, показывающие, что Cen502 представляет собой вероятную β-глюкозидазу Gh2. Белок имел 62% аминокислотную идентичность с β-глюкозидазой A из Bacillus polymyxa и 47% аминокислотной идентичности с β-глюкозидазой из Paenibacillus amylolyticus .

Рисунок 2

Анализ аминокислотной последовательности Cen502. ( A ) Прогнозируемая модульная архитектура Cen502. ( B ) Соседнее филогенетическое дерево, основанное на 27 последовательностях β-глюкозидазы от различных организмов. Анализ отображает эволюционные отношения между Cen502 и родственными белками. На узлах показаны значения начальной загрузки 60% или выше. Масштабная полоса соответствует генетическому расстоянию 0,2 замены / сайт.

Затем был проведен филогенетический анализ, чтобы поместить Cen502 в известное семейство Gh2 и разнообразие β-глюкозидаз (рис.2Б). Двадцать два белка β-глюкозидазы из различных организмов были выбраны из базы данных CAZY для филогенетического анализа. Набор данных включал пять белков β-глюкозидазы из бактерий, три из грибов, три из нематод, четыре из других эукариот, три из архей, один из вируса и три из неклассифицированных организмов. Сравнительный анализ показал, что Cen502 демонстрировал от 47% до 62% идентичности последовательностей с гомологичными бактериальными белками (например, B. polymyxa ) и от 19% до 22% идентичностей последовательностей с гомологичными белками нематод (например, B. polymyxa ).грамм. C. elegans ). Однако Cen502 не был тесно связан с другими белками семейства β-глюкозидаз, что позволяет предположить, что это потенциально новая изоформа.

Анализ множественного выравнивания последовательностей с другими β-глюкозидазами показал, что Cen502 является типичной β-глюкозидазой Gh2 (дополнительный рис. 1). Остатки Cen502 E161 и E369 соответствуют консервативным остаткам глутаминовой кислоты, которые участвуют в каталитической активности ферментов Gh2. Эти результаты согласуются с предсказаниями функционального домена и предполагаемого активного сайта в холодной активной β-глюкозидазе BglMKg 19 .Более того, предполагается, что остатки D244, R340, K351 и h488 образуют водородные связи с гидроксилами субстрата сахаров.

Структура Cen502 состояла из восьмикратной β / α-архитектуры, которая типична для гликозидгидролаз семейства 1 (рис. 3). Остатки глутаминовой кислоты E156, E161 и E174 были предполагаемыми активными сайтами среди консервативных аминокислот. Остатки Q21, H75, Y292, E369 и W445 также были предсказаны как консервативные и образующие типичный карманный домен распознавания субстрата 20 .Следовательно, эти остатки определяют распознавание субстрата. В структуре имеется широкая и протяженная полость, окружающая полость активного центра, которая, кажется, совпадает с размещением широкого диапазона подложек.

Рисунок 3

Структурная модель β-глюкозидазы Cen502.

Экспрессия и очистка Cen502

Чтобы охарактеризовать биохимические свойства Cen502, он был гетерологично экспрессирован как N-концевой слитый белок His-tag с использованием системы экспрессии pET-30a (t) под контролем промотора T7 lac. в г.coli BL21. Активность β-глюкозидазы была обнаружена после того, как клетки были собраны и разрушены обработкой ультразвуком, что позволяет предположить, что рекомбинантный Cen502 секретируется и экспрессируется в растворимой форме. SDS-PAGE анализ фермента слияния до и после очистки, в дополнение к Вестерн-блот-анализу после диализа, представлен на фиг.4 и дополнительном рисунке 2. Чистота полученного элюирования подтверждается наличием одной полосы после окрашивание на 12% геле SDS-PAGE (фиг. 4A). Молекулярная масса очищенного фермента составила приблизительно 52 кДа с помощью SDS-PAGE, что согласуется с предсказанным значением MW.Вестерн-блоттинг выявил полосу белка массой 52 кДа для IPTG-индуцированного неочищенного экстракта BL21 (DE3), несущего pET-Cen502, элюированного белка Cen502 после очистки и обессоленного белка Cen502 (фиг. 4B, дорожки 2, 3 и 5, соответственно). Сигнал гибридизации не был обнаружен для отрицательных контролей, включая неиндуцированный IPTG неочищенный экстракт BL21 (DE3), несущий pET-Cen502, и неочищенный экстракт BL21 (DE3), несущий вектор pET30a (+) (фиг. 4B, дорожки 1 и 4, соответственно).

Фигура 4

( A ) SDS-PAGE анализ очищенного рекомбинантного белка Cen502.М — белки-маркеры; полоса 1, неиндуцированный IPTG неочищенный экстракт BL21 (DE3), несущий pET-Cen502; полоса 2, индуцированный IPTG неочищенный экстракт BL21 (DE3), несущий pET-Cen502; дорожка 3, элюированный белок Cen502 после очистки; полоса 4, неочищенный экстракт BL21 (DE3), несущий вектор pET30a (+); дорожка 5, обессоленный белок Cen502. ( B ) Характеристика Cen502 вестерн-блоттингом. М — белки-маркеры; Дорожки 1–5 такие же, как в A.

Характеристика Cen502

Исследования температурной зависимости показали, что оптимальная температура для Cen502 составляла 38 ° C.Только 25% и 8% исходной активности Cen502 было восстановлено при анализе при 50 ° C и 60 ° C, соответственно, в течение 24 часов, что указывает на слабую термическую стабильность (рис. 5). Исследования по оптимизации pH при 38 ° C показали, что очищенный Cen502 имел максимальную гидролитическую активность при pH 8,0 (фиг. 6). Фермент показал сравнительно хорошую pH-стабильность, сохраняя 97% и 90% своей активности при pH 7,0 и pH 9,0, соответственно, в течение 12 часов. После 24 часов инкубации относительная активность Cen502 составляла 62%, 51% и 56% при pH 7.0, 8.0 и 9.0 соответственно.

Рис. 5

Влияние температуры на активность и стабильность Cen502. ( A ) Влияние температуры на активность Cen502; ( B ) Влияние температуры на стабильность Cen502.

Рисунок 6

Влияние pH на активность и стабильность Cen502. ( A ) Влияние pH на активность Cen502; ( B ) Влияние pH на стабильность Cen502.

Влияние ионов металлов на активность Cen502 показано на рис.7А. Добавление 0,05 моль / л Fe 2+ и Mn 2+ увеличивало активность β-глюкозидазы на ~ 60% и 50% соответственно. Mg 2+ , Zn 2+ и Cu 2+ также усиливали активность Cen502 на 14-40%. Напротив, добавление Pb 2+ и K + снижает активность β-глюкозидазы на 10% и 25% соответственно. Na + мало влиял на активность Cen502.

Рисунок 7

Влияние ионов металлов на активность Cen502.

Субстратная специфичность Cen502 определялась в оптимальных условиях после добавления различных полисахаридов в концентрации 1% (таблица 1). Cen502 был максимально активен в отношении pNPG с удельной активностью 101,7 ± 5,2 Ед / мг. Целлобиоза (β-1,4-связанная) и лактоза (β-1,4-связанная) были наиболее предпочтительными субстратами, за ними следовали салицин (β-связанный), лихенан (β-1,3, β-1,4- связанный), ламинарин (β-1,3, β-1,6-связанный) и софороза (β-1,2-связанный). Очищенные ферменты практически не проявляли активности по отношению к субстратам карбоксиметилцеллюлозы (КМЦ), ксилану или авицелу.Взятые вместе, результаты показали, что Cen502 имел самую высокую активность в отношении β-1,4-связанных сахаридов. Кроме того, было обнаружено, что фермент эффективен при гидролизе β-1,3, β-1,6 и β-1,2-связанных полисахаридов. Таким образом, Cen502 может иметь потенциальное применение в различных процессах деградации сахаридов, которые важны в различных областях биотехнологии.

Таблица 1 Активность гидролиза Cen502 на различных полисахаридных субстратах.

Активность Cen502 в отношении pNPG усиливалась глюкозой при концентрациях ниже 50 мМ (рис.7Б). В присутствии 50 мМ глюкозы активность Cen502 увеличивалась до максимального значения на 10% больше, чем у контроля без глюкозы. Активность фермента постепенно подавлялась с увеличением концентрации глюкозы.

Затем была рассчитана ферментативная кинетика (сродство к субстрату и максимальная скорость) Cen502 для дальнейшей характеристики его активности. На основании уравнения 1 / ѵ = K кв.м · 1/ В макс. · 1 / [с] + В макс. прямая линия была получена путем рисования 1 / ѵ ~ 1 / [с].Пересечения осей x и y тогда равны −1 / K кв.м и 1/ V макс. соответственно, что позволяет рассчитать максимальную скорость ( В, макс. ) и сродства к субстрату ( K кв.м ).Используя эти расчеты, K кв.м и В макс. рекомбинантного Cen502 по отношению к pNPG составляло 2,334 моль / мл и 9,017 мкмоль / мин, соответственно (фиг. 8).

Фигура 8

Кинетические константы, определенные для активности Cen502 в отношении pNPG с использованием анализа Lineweaver-Burk.

pNPG, субстрат бета-галактозидазы (CAS 3150-24-1) (ab146393)

Обзор

  • Название продукта

    pNPG, субстрат бета-галактозидазы

  • Описание

    Субстрат β-галактозидазы.

  • Альтернативные названия

    • 4-нитрофенилгалактозид
    • 4-нитрофенилгалактозид
    • п-Нитрофенил-бета-D-галактозид
  • Биологическое описание

    Хромогенный субстрат β-галактозидазы, дающий желтый конечный продукт при расщеплении.

  • Чистота

    > 98%

  • Номер CAS

    3150-24-1

  • Химическая структура

Недвижимость

  • Химическое название

    4-нитрофенил-β-D-галактопиранозид

  • Молекулярный вес

    301.25

  • Молекулярная формула

    C 12 H 15 НЕТ 8

  • Инструкции по хранению

    Хранить при -20 ° C. Хранить при обезвоживании. Срок хранения до 12 месяцев.

  • Погрузочно-разгрузочные работы

    По возможности, вы должны готовить и использовать растворы в тот же день.Однако, если вам необходимо заранее приготовить исходный раствор, мы рекомендуем хранить раствор в виде аликвот в плотно закрытых флаконах при -20 ° C. Как правило, их можно использовать до одного месяца. Перед использованием и перед открытием флакона мы рекомендуем дать вашему продукту уравновеситься до комнатной температуры в течение как минимум 1 часа.

    Нужна дополнительная информация о растворимости, использовании и обращении? Посетите нашу страницу часто задаваемых вопросов (FAQ) для получения более подробной информации.

  • Источник

Протоколы

Насколько нам известно, для этого продукта не требуются индивидуальные протоколы.Пожалуйста, попробуйте стандартные протоколы, перечисленные ниже, и сообщите нам, как у вас дела.

Щелкните здесь, чтобы просмотреть общие протоколы

Листы данных и документы

  • SDS скачать

    Страна / регион Выберите страну / регион

    Язык Выбор языка

  • Скачать брошюру

Список литературы (0)

ab146393 еще не упоминался в каких-либо публикациях.

Отзывы клиентов и вопросы и ответы

Молекулярная характеристика высокоактивной термофильной β-глюкозидазы из Neosartorya fischeri P1 и ее применение в гидролизе изофлавоновых гликозидов сои

Образец цитирования: Yang X, Ma R, Shi P, Huang H, Bai Y, Wang Y, и другие. (2014) Молекулярная характеристика высокоактивной термофильной β-глюкозидазы из Neosartorya fischeri P1 и ее применение в гидролизе изофлавоновых гликозидов сои.PLoS ONE 9 (9): e106785. https://doi.org/10.1371/journal.pone.0106785

Редактор: Спенсер Дж. Уильямс, Мельбурнский университет, Австралия

Поступило: 28 апреля 2014 г .; Одобрена: 1 августа 2014 г .; Опубликовано: 4 сентября 2014 г.

Авторские права: © 2014 Yang et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Авторы подтверждают, что все данные, лежащие в основе выводов, полностью доступны без ограничений. Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

Финансирование: Эта работа была поддержана Национальной программой Китая по исследованиям и развитию высоких технологий (2012AA022208), Национальным научным фондом выдающихся молодых ученых Китая (31225026), Национальной программой поддержки науки и технологий (2013BAD10B01-2 ) и Китайской современной системы сельскохозяйственных исследований (CARS-42).Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

Введение

Изофлавоны растений являются важными вторичными метаболитами, которые в основном распространены в зернобобовых растениях с высокими уровнями [1]. Это может происходить в гликозидном и свободном типах. Большинство изофлавонов существует в природных материалах в виде гликозидов, которые представляют собой один из антипитательных факторов, которые снижают использование питательных веществ и / или потребление растительных или растительных продуктов в качестве пищи для человека или кормов для животных [2], в то время как их свободная форма играет важную роль. основные полезные функции для предотвращения некоторых видов рака, остеопороза и сердечно-сосудистых заболеваний [3] — [5].Таким образом, способ превращения изофлавоновых гликозидов в свободные изофлавоны является ключом к широкому использованию изофлавона в пищевой и кормовой промышленности.

β-глюкозидазы (EC3.2.1.21) катализируют гидролиз β-глюкозидных связей различных олигосахаридов и гликозидов с высвобождением глюкозы и разветвленных олигосахаридов. Согласно базе данных CAZy (http://www.cazy.org) [6], эти ферменты сгруппированы в 6 из 133 семейств гликозилгидролаз (GH), то есть 1, 3, 5, 9, 30 и 116.β-Глюкозидаза играет жизненно важную роль в биологическом превращении целлюлозы путем разложения целлоолигосахаридных продуктов, высвобождаемых эндоглюканазой и целлобиогидролазой, с образованием глюкозы и разветвленного олигосахарида. Чтобы избежать ингибирования продукта, в этих полях нагревают β-глюкозидазу с высокой толерантностью к глюкозе [7]. В последнее время бета-глюкозидаза вызывает большой интерес из-за ее важной роли в гидролизе изофальвоновых гликозидов. Те из Dalbergia sp. [8], Paecilomyces thermophila [9], Dictyoglomus turgidum [10], Sulfolobus solfataricus [11] и Rhizopus spp.[12] показали способность разлагать изофальвоновые гликозиды. Однако эти β-глюкозидазы обладают низкой ферментативной активностью и низкой коммерческой ценностью. Более того, их эффективность преобразования глюкозидных изофлавонов была дополнительно снижена из-за их чувствительности к ингибированию глюкозы. Таким образом, срочно требуется высокоэффективная и толерантная к глюкозе β-глюкозидаза, обладающая способностью к гидролизу изофальвоновых гликозидов.

Термофильные / термостабильные ферменты благоприятны для гидролиза изофлавоновых гликозидов, поскольку высокие температуры увеличивают скорость массопереноса, снижают вязкость субстрата и снижают риск загрязнения [13].Настоящее исследование направлено на получение новой термофильной β-глюкозидазы для эффективного гидролиза изофлавоновых гликозидов и других сахаридов. Β-глюкозидаза семейства 3, обозначенная как NfBGL1, была идентифицирована в термофильном штамме гриба Neosartorya fischeri P1 и сверхэкспрессирована в Pichia pastoris . Этот фермент характеризовался как термофильный и высокоактивный, обладал широкой субстратной специфичностью и высокой способностью к гидролизу изофлавоновых гликозидов сои. Его добавка значительно усилила превращение изофлавоновых гликозидов в агликоны.

Методы

2.1. Материалы

Экстракт соевой муки был приготовлен по методике, описанной в предыдущем отчете, с некоторыми изменениями [14]. Соевую муку обезжиривали в трех объемах n -гексана в течение 30 минут при перемешивании при комнатной температуре, центрифугировали при 13000 г в течение 20 минут и сушили на воздухе до мелкого порошка.

Субстраты целлобиоза, карбоксиметилцеллюлоза натрия (CMC-Na), авицел, ламиниарин, лихенин, амигдалин, даидзин, генистин, глицитин, даидзеин, генистеин, глицитеин, ксилан березового дерева, ксилан бука, софорцеза, гентиобактоза, сальтиобактоза, 9033 -нитрофенил-β-d-глюкопиранозид ( p NPG) и другие p -нитрофенилгликозиды и Novozyme 188 (целлобиаза из Aspergillus niger ) были приобретены у Sigma-Aldrich (St.Луис, Миссури). Другие субстраты, включая β-глюкан ячменя и ксилоглюкан, были получены от Megazyme (Wicklow, Ирландия). ДНК-лигаза Т4 и эндонуклеазы рестрикции были приобретены у Promega (Мэдисон, Висконсин).

Набор для выделения ДНК грибов и мини-набор RNeasy Plant были получены от Omega Bio-tek (Норкросс, Джорджия) и QIAGEN (Хильден, Германия), соответственно. Набор для очистки ДНК, ДНК-полимераза LA Taq и эндонуклеазы рестрикции были приобретены у TaKaRa (Otsu, Япония). Все остальные химические вещества были аналитической чистоты и коммерчески доступны.

2.2. Штаммы

N. fischeri P1 CGMCC 3.15369 [15] выращивали в среде, индуцирующей β-глюкозидазу, содержащей 10 г / л пшеничных отрубей, 10 г / л CMC-Na, 5 г / л (NH 4 ) 2 SO 4 , 1 г / л KH 2 PO 4 , 0,5 г / л MgSO 4 · 7H 2 O, 0,2 г / л CaCl 2 и 10 мг / л FeSO 4 · 7H 2 O при 45 ° C и pH 5,0 в течение 4 дней. Общая активность β-глюкозидазы в супернатантах культур N. fischeri составляла 11.9 ± 0,2 Ед / мл.

Escherichia coli Trans1-T1 (TransGen, Пекин, Китай) культивировали в среде Лурия-Бертани (LB) со 100 мкг / мл ампициллина при 37 ° C для клонирования и секвенирования генов. P. pastoris GS115 (Invitrogen, Carlsbad, CA), культивированный в среде дрожжевой пептон-декстрозы (YPD) при 30 ° C, использовали для экспрессии гетерологичного белка. Плазмиды pEASY-T3 (TransGen) и pPIC9 (Invitrogen) использовали в качестве векторов клонирования и экспрессии соответственно.

2.3. Клонирование и анализ последовательности гена β-глюкозидазы (

Nfbgl1 )

Мицелий штамма P1 собирали после 4 дней роста в среде, продуцирующей β-глюкозидазу, как описано выше. Тотальную ДНК и РНК экстрагировали и очищали согласно инструкциям производителя соответственно. КДНК были синтезированы в vitro с использованием набора ReverTra Ace-α- Kit (TOYOBO, Осака, Япония) с суммарной РНК в качестве матрицы. Согласно последовательности генома гипотетической β-глюкозидазы из N.fischeri NRRL 181 (XP_001261562), два специальных наборов праймеров (Nfbgl1-F: ATGCAGAACCTCTTCCTTTCTCTCC и Nfbgl1-R: CTTTCAGGGTCCGTCGCGGATGGTGA и Nfbgl1-ехр: GGGGAATTCTACGGTTCTGGTGGCAGCAACTGGG и Nfbgl1-Expr: GGGGCGGCCGCTCACCATCCGCGACGGACCCTGAAAG, сайты рестрикции подчеркнуты) были разработаны для амплификации полной длины Ген β-глюкозидазы, Nfbgl1 , и его кДНК без последовательности, кодирующей сигнальный пептид. Продукты ПЦР подходящего размера лигировали в вектор pGEM-T3 Easy (TransGen) для секвенирования.

Нуклеотидную последовательность анализировали с использованием программного обеспечения Vector NTI Advance 10.0 (Invitrogen). Программы BLASTn и BLASTp (http://www.ncbi.nlm.nih.gov/BLAST/) и AlignX от Vector NTI использовали для анализа нуклеотидной и выведенной аминокислотной последовательностей соответственно. Онлайн-программное обеспечение FGENESH (http://linux1.softberry.com/berry.phtml) использовалось для предсказания сайтов инициации транскрипции, интронов и экзонов. Сервер NetNGlyc 1.0 (http://www.cbs.dtu.dk/services/NetNGlyc/) использовался для прогнозирования потенциальных сайтов гликозилирования N .Множественное выравнивание последовательностей выведенного NfBGL1 и других грибковых аналогов проводили с использованием программы ClustalW (www.genome.jp/tools/clustalw/). Трехмерная структура была предсказана с использованием SWISS-MODEL (http://swissmodel.expasy.org/) с β-глюкозидазой Gh4 AaBGL1 из Aspergillus aculeatus (PDB: 4IIB; идентичность 44,1%) [16] в качестве шаблон.

2.4. Гетерологичная экспрессия и очистка NfBGL1

Гетерологическую экспрессию рекомбинантного NfBGL1 проводили с использованием набора для экспрессии Pichia (Invitrogen).Фрагмент кДНК зрелого NfBGL1 без последовательности, кодирующей сигнальный пептид, расщепляли с помощью EcoR I и Not I, а затем клонировали в соответствующие сайты вектора pPIC9. Затем рекомбинантную плазмиду pPIC9- Nfbgl1 линеаризовали с помощью Bgl II и трансформировали в компетентные клетки P. pastoris GS115 с помощью электропорации (Bio-Rad, Hercules, CA). Положительные трансформанты были отобраны на основании их ферментативной активности во встряхиваемых пробирках.Трансформант, который проявлял наивысшую активность β-глюкозидазы в культуральном супернатанте, использовали для крупномасштабной ферментации в 1-литровых колбах Эрленмайера. Бесклеточные культуральные супернатанты собирали и наносили на колонку HiTrap Q Sepharose XL FPLC (GE Healthcare, Уппсала, Швеция), уравновешенную буфером A (20 мМ буфер McIlvaine, pH 7,0). Белки элюировали градиентами NaCl (0–1,0 М) в том же буфере при скорости потока 3 мл / мин. Фракции, содержащие ферментативную активность, собирали и оценивали электрофорезом в полиакриламидном геле с додецилсульфатом натрия (SDS-PAGE).Концентрацию белка определяли методом Брэдфорда с бычьим сериновым альбумином в качестве стандарта.

2,5. Ферментация с высокой плотностью клеток в ферментере

емкостью 3,7 л

Положительный трансформант с наивысшей активностью β-глюкозидазы в культуре во встряхиваемой колбе был выбран для ферментации с высокой плотностью клеток в ферментере с мешалкой объемом 3,7 л (Bioengineering KLF 2000, Wald, Швейцария) с использованием стратегии трехступенчатой ​​ферментации, как описан [17]. Соотношение посевного материала составляло 10% (об. / Об.).Температура и начальный pH были установлены равными 30 ° C и 5,0. В течение всего процесса ферментации образцы периодически отбирали для анализа сырого веса и активности ферментов.

2,6. Анализ активности ферментов

Активность β-глюкозидазы анализировали с использованием p NPG в качестве субстрата. Реакционная система состояла из 400 мкл 1,25 мМ p NPG в буфере McIlvaine (200 мМ Na 2 HPO 4 , 100 мМ лимонная кислота, pH 5,0) и 100 мкл соответственно разбавленного раствора фермента.Смесь инкубировали при 80 ° C в течение 10 мин, а затем останавливали добавлением 1,5 мл 1 М Na 2 CO 3 . После охлаждения до комнатной температуры оптическую плотность измеряли при 405 нм. За одну единицу активности фермента принимали количество фермента, которое высвобождает 1 мкмоль p -нитрофенола в минуту. Каждую реакцию проводили в трех экземплярах, и данные были представлены как среднее ± стандартное отклонение. ( n = 3). Ферментативную активность в отношении других p -нитрофенилгликозидов анализировали, как описано выше, с различными субстратами.

Активность целлюлазы / глюканазы / ксиланазы определяли с помощью анализа 3,5-динитросалициловой кислоты (DNS) [18]. Стандартная реакционная система, содержащая 100 мкл соответственно разбавленного фермента и 900 мкл 1% (мас. / Об.) Субстрата (CMC-Na, авицел, ксилоглюкан, β-глюкан ячменя, ксилан буковой древесины или ксилан березовой древесины) в буфере Макилвейна (pH 5,0) инкубировали при 80 ° C в течение 10 мин с последующим добавлением 1,5 мл реагента DNS. После 5-минутного кипячения и охлаждения до комнатной температуры оптическую плотность измеряли при 540 нм.Одну единицу активности целлюлазы / глюканазы / ксиланазы определяли как количество фермента, которое высвобождает 1 мкмоль восстанавливающего сахара в минуту в условиях анализа.

Ферментативную активность 10 мМ целлобиозы, салицина, лактозы, даидзина, глицитина и генистина оценивали путем измерения количества высвобожденной глюкозы с использованием метода GOD-POD с коммерческим набором (Biosino, Пекин, Китай). Поглощение измеряли при 505 нм. За одну единицу активности фермента принимали количество фермента, которое высвобождает 1 мкмоль глюкозы в минуту.

2,7. Биохимическая характеристика

Оптимальные значения pH были определены при 80 ° C в следующих растворах: 100 мМ глицин-HCl для pH 2,0–3,0, буфер McIlvaine для pH 3,0–8,0, 100 мМ трис-HCl для pH 8,0–9,0 и 100 мМ глицин. -NaOH для pH 9,0–12,0. Стабильность pH определяли путем измерения остаточной активности фермента в стандартных условиях (pH 5,0, 80 ° C, 10 мин) после предварительной инкубации фермента в буферах с pH 2,0–12,0 при 37 ° C в течение 1 ч без субстрата. .

Оптимальная температура была исследована при оптимальном pH путем измерения активности фермента в диапазоне температур от 20 до 90 ° C. Анализ термостабильности проводили, инкубируя фермент при оптимальном pH и при 70 ° C или 80 ° C без субстрата в течение 2, 5, 10, 20, 30 или 60 минут, а затем измеряя остаточную активность фермента в условиях анализа. .

Для исследования влияния различных ионов металлов и химических реагентов на активность очищенного рекомбинантного NfBGL1 реакционная система, содержащая 5 мМ каждого Na + , K + , Li + , Ag + , Cu 2+ , Ni 2+ , Mn 2+ , Ca 2+ , Pb 2+ , Co 2+ , Zn 2+ , Mg 2+ , Fe 3+ , Cr 3+. , SDS, EDTA и β-меркаптоэтанол подвергали анализу ферментативной активности в стандартных условиях и сравнивали с холостым контролем без каких-либо добавок.

2,8. Субстратная специфичность и кинетические параметры

Субстратную специфичность NfBGL1 определяли в стандартных условиях анализа (pH 5,0 и 80 ° C в течение 10 мин) в присутствии 1 мМ p -нитрофенильных производных и олигосахаридов или 10 мг / мл полисахаридов и изофлавоновых гликозидов.

Значения NfBGL1 K m и V max определяли в буфере McIlvaine (pH 5,0), содержащем 0.01–2 мМ p NPG при 80 ° C в течение 5 мин. Эксперименты проводились трижды, и каждый эксперимент включал трехкратную повторность. Данные были рассчитаны с использованием метода Лайнуивера-Берка с компьютерной программой нелинейной регрессии GraFit (версия 7.0, Erithacus Software, Хорли, Великобритания).

2.9. Толерантность к ингибированию глюкозы

Ингибирующий эффект глюкозы на активность NfBGL1 определяли путем подгонки к графику Диксона [19], [20]. Аликвоты раствора фермента (5 мкл) добавляли к 120 мкл 0.01–2,0 М раствора глюкозы и инкубируют при комнатной температуре в течение 1 ч. В смеси добавляли 125 мкл 3 или 4 мМ p NPG и 250 мкл буфера McIlvaine (pH 5,0), содержащего такое же количество глюкозы. Остаточную активность фермента измеряли при 80 ° C, pH 5,0 в течение 10 мин. Значение K i рассчитывали путем построения графика обратной зависимости скорости реакции и концентрации ингибитора для каждой концентрации p NPG.

2.10. ВЭЖХ-анализ продуктов гидролиза экстракта четырех соевых бобов

Для сравнения эффективности гидролиза NfBGL1 и Novozyme 188 по отношению к изофлавоновым гликозидам 50 мкл 10% (мас. / Об.) Соевой муки инкубировали с 200 мкл каждого раствора фермента (0.05 U) в буфере McIlvaine (pH 5,0) в термостатируемом инкубаторе при 50 ° C. Реакции останавливали охлаждением ледяной водой. После центрифугирования при 13000 g , 4 ° C в течение 10 мин, 20 мкл каждого супернатанта подвергали анализу ВЭЖХ с использованием системы ВЭЖХ Waters HP1100 (Милфорд, Массачусетс), снабженной колонкой C18 (5 мкм, 4,6 × 250 мм). . Растворитель состоял из ацетонитрила и 100 мМ фосфатного буфера (pH 5,0) в соотношении 70-30 (об. / Об.) И работал при скорости потока 0,8 мл / мин. Хроматограммы регистрировали при 260 нм.

Результаты и обсуждение

3.1. Анализ последовательности

Nfbgl1

кДНК Nfbgl1 из N. fischeri P1 состоит из 2220 пар оснований и кодирует полипептид из 739 аминокислот с предполагаемым сигнальным пептидом из 17 остатков на N-конце. Молекулярная масса и значение p I составили 78,8 кДа и 5,54 соответственно. Два предполагаемых сайта гликозилирования N (Asn207 и Asn381) были идентифицированы в предполагаемом NfBGL1.

Выведенная аминокислотная последовательность зрелого NfBGL1 показала наивысшую идентичность 100% с гипотетической β-глюкозидазой из N. fischeri NRRL 181 (XP_001261562) и 61% идентичности с β-глюкозидазой Trichoderma reesei (1713235A ) с экспериментально подтвержденной активностью [21]. Множественное выравнивание последовательностей и анализ структуры с другими β-глюкозидазами показал, что NfBGL1 является типичной β-глюкозидазой Gh4 (Рис. 1). В отличие от двухдоменной β-глюкозидазы ExoI ячменя из Hordeum vulgare [22] и четырехдоменной дрожжевой β-глюкозидазы BglI из Kluyveromyces marxianus [23], модель на основе гомологии зрелого NfBGL1 с AaBGL1 в качестве матрицы. [16] было предсказано три домена (рис.2A): бочкообразный домен TIM (Y1-S313), α / β-сэндвич-домен (T324-G526) и C-концевой домен FnIII (Y585-W722). Предполагаемые каталитические остатки, D235 в бочкообразном домене и E447 в α / β-сэндвич-домене, расположены на границе первых двух доменов. Три дисульфидные связи могут образовываться между C41 – C57, C201 – C212 и C374 – C379 для стабилизации структуры белка. Предполагается, что остатки D60, R124, K157 и h258 образуют водородные связи с гидроксилами сахаров субстрата. В соответствии со структурными особенностями AaBGL1, субсайт -1 смоделированного NfBGL1 имеет строгие стереохимические требования, формируя взаимодействие ароматического стэка с сахарным кольцом посредством W236 (рис.2B) эквивалент W281 из AaBGL1 [16]. Аминокислотные остатки, относящиеся к субсайту +1, менее консервативны, один (N261 смоделированного NfBGL1) из трех остатков (W36, N261 и Y449) отличается. Разнообразные структуры, образующие субсайт +1, могут объяснять широкий диапазон субстратной специфичности β-глюкозидаз Gh4.

Рисунок 1. Множественное выравнивание выведенной аминокислотной последовательности зрелого NfBGL1 (XP_001261562) с другими грибковыми аналогами из T. reesei (TrBgl1, 1713235A) и A.aculeatus (AaBGL1, 4IIB).

Идентичные и похожие аминокислоты обозначены сплошными черными и серыми прямоугольниками соответственно. Предполагаемые каталитические остатки, D235 и E447, указаны звездочками. Остатки, вероятно, относящиеся к субсайту -1 (W236) и +1 (W36, N261 и Y449), обозначены белыми и черными треугольниками соответственно. Остатки, вероятно, образующие водородные связи с субстратом, D60, R124, K147 и h248, обозначены черными точками.

https: // doi.org / 10.1371 / journal.pone.0106785.g001

Рис. 2. Смоделированный гомологией NfBGL1 с AaBGL1 из A. aculeatus (4IIB, идентичность 44,1%) в качестве шаблона.

(A) Предполагаемая структура NfBGL1. Указаны каталитические остатки D235 и E447. (B) Предполагаемые взаимодействия между ключевыми остатками NfBGL1 и субстратом целлобиозы.

https://doi.org/10.1371/journal.pone.0106785.g002

3.2. Сверхэкспрессия, очистка и продукция с высокой плотностью клеток NfBGL1

Фрагмент кДНК Nfbgl1 без последовательности, кодирующей сигнальный пептид, амплифицировали с помощью ПЦР и клонировали в вектор pPIC9 для гетерологичной экспрессии.Активность β-глюкозидазы рекомбинантного NfBGL1 была определена как 33,5 ± 0,4 Ед / мл (pH 5,0, 50 ° C, 10 мин) после 2-дневного выращивания в 1-литровых колбах Эрленмейера при 30 ° C. Супернатант культуры очищали до электрофоретической гомогенности одностадийной анионообменной хроматографией. Одиночная полоса приблизительно 80 кДа мигрировала в SDS-PAGE (фиг. 3A), что по существу идентично расчетной молекулярной массе NfBGL1 (78,8 кДа). Результат показывает, что в рекомбинантном NfBGL1 во время гетерологичной экспрессии у P.Пастор . Удельная активность очищенного рекомбинантного NfBGL1 против p NPG составила 2189 ± 1,7 Ед / мг, что значительно выше, чем у всех известных грибковых β-глюкозидаз (таблица 1).

Рисунок 3. Очистка и ферментация рекомбинантного NfBGL1 при высокой плотности клеток.

(A) SDS-PAGE анализ очищенного рекомбинантного NfBGL1. Дорожки: 1 — стандарты молекулярной массы; 2, очищенный рекомбинант NfBGL1. (B) Динамика производства NfBGL1 в ферментере на 3,7 л. Каждое значение на панели представляет собой среднее ± S.D. ( n = 3).

https://doi.org/10.1371/journal.pone.0106785.g003

Трансформант, который показал самую высокую активность β-глюкозидазы в культурах во встряхиваемых колбах, подвергали ферментации с высокой плотностью клеток в ферментере объемом 3,7 л. Влажный вес клеток продолжал увеличиваться, но активность β-глюкозидазы в культуральном супернанте перед фазой индукции не определялась. После индукции метанолом активность β-глюкозидазы в супернатанте увеличивалась до максимального значения 1873 ± 1.5 Ед / мл через 159 ч, что в 56 раз больше, чем у культур во встряхиваемых колбах (рис. 3В). Это значительное увеличение активности может быть приписано более высоким уровням растворенного кислорода и более эффективному массопереносу в аэрируемой системе [32]. Высокий выход, простая очистка и высокая удельная активность делают NfBGL1 подходящим для крупномасштабного промышленного производства.

3.3. Ферментативные свойства очищенного рекомбинантного NfBGL1

Обычно β-глюкозидазы грибов имеют кислотный оптимум pH в диапазоне от 4.От 0 до 6,5 и обычно стабильны в широком диапазоне pH (таблица 1). NfBGL1 из N. fischeri P1 показал аналогичные свойства. Он имел оптимум pH 5,0 и оставался> 80% максимальной активности при pH 4,5–5,5 (рис. 4A). По сравнению с другими грибными аналогами, NfBGL1 был стабильным в более широком диапазоне pH, сохраняя> 80% активности после инкубации при pH от 3,0 до 9,0, 37 ° C в течение 1 часа (фиг. 4B). NfBGL1 представляет собой типичную термофильную / термостабильную β-глюкозидазу. Из всех охарактеризованных β-глюкозидаз грибов именно P.thermophila [25] имеет самый высокий температурный оптимум 75 ° C, что все еще на 5 ° C ниже, чем у NfBGL1 (рис. 4C). Более того, NfBGL1 показал отчетливую адаптивность и устойчивость к высоким температурам. Он оставался> 50% активности при 50–85 ° C и 27% активности даже при 90 ° C и был термостабильным при 70 ° C в течение 120 мин (рис. 4D). При увеличении температуры инкубации до 80 ° C фермент сохранял 50% активности в течение 10 минут и 11% активности в течение 120 минут. NfBGL1 был устойчив к большинству химикатов, включая Li + , Pb 2+ , Mn 2+ , Mg 2+ , Zn 2+ , Cr 3+ , Ni + , Cu 2 + , SDS и EDTA, но сильно ингибировался Ag + , Co 3+ , Fe 3+ , Ca 2+ и β-меркаптоэтанолом (данные не показаны).Учитывая его кислотные, термофильные, стабильные и химически стойкие в широком диапазоне pH / температур преимущества при переработке биомассы, обращении, последующей обработке и транспортировке [30], NfBGL1 имеет потенциал для широкого применения в биотопливе, моющих средствах, текстильной и других отраслях промышленности. .

Рисунок 4. Характеристика очищенного рекомбинантного NfBGL1.

(A) Влияние pH на активность β-глюкозидазы. Ферментный анализ проводили при 80 ° C в течение 10 мин. (B) pH-стабильность. Фермент предварительно инкубировали без субстрата при 37 ° C в течение 60 мин, а затем подвергали анализу остаточной активности в стандартных условиях (pH 5.0, 80 ° C, 10 мин). (C) Влияние температуры на активность β-глюкозидазы, определенную при pH 5,0 в течение 10 мин. (D) Термостабильность. Остаточные активности фермента измеряли в стандартных условиях после предварительной инкубации фермента без субстрата в буфере McIlvaine (pH 5,0) в течение различных периодов времени. Каждое значение на панели представляет собой среднее ± стандартное отклонение. ( n = 3).

https://doi.org/10.1371/journal.pone.0106785.g004

3.4. Специфичность субстрата

NfBGL1 проявлял широкую субстратную специфичность, включая активность гидролиза β-глюкозидазы, целлобиазы, глюканазы, ксиланазы и изофлавонгликозида (таблица 2).Помимо p NPG, он был активен в отношении β-связанного синтетического субстрата p -нитрофенил β-d-целлобиозида и p -нитрофенил β-d-ксилопиранозида. Из всех испытанных сахаридов наиболее предпочтительным субстратом была софороза (β-1,2-связанная), за ней следовали ламиниарин (β-1,3, β-1,6-связанный), салицин (β-связанный), целлобиоза (β-связка). -1,4-связанный), лихенан (β-1,3, β-1,4-связанный) и лактоза (β-1,4-связанный). Хотя большинство β-глюкозидаз обладают более высокой активностью по отношению к β-1,4-связанным сахаридам, NfBGL1, а также β-глюкозидазы из Trichoderma koningii [33] и микробный метагеном компоста [34] оказались высокоэффективными при гидролизе. β-1,2, 1,3 или 1,6-связей.Такие β-глюкозидазы могут участвовать в большей биологической активности, чем осахаривание целлюлозы. Помимо активности β-глюкозидазы и целлобиозы, NfBGL1 проявляет слабую ксиланазную активность в отношении ксилана бука и ксилана березы. Не было обнаружено активности против β-1,4-связанной CMC-Na и Авицела. Эта широкая субстратная специфичность предполагает, что NfBGL1 может иметь слабую стереохимическую специфичность в субсайте +1, как показывает структурный анализ, описанный выше. Таким образом, NfBGL1 можно использовать в различных областях биотехнологии для разложения сахаридов.

3,5. Кинетический анализ и толерантность к ингибированию глюкозы

С p NPG в качестве субстрата, K m , V max и k cat значения для NfBGL1 составляли 0,51 мМ, 2172 мкмоль / мин / мг и 2853 / с, соответственно. Значение K m NfBGL1 попало в диапазон значений грибковой β-глюкозидазы K m , но его значение V max было довольно высоким (Таблица 1).Каталитическая эффективность ( k cat / K m ) является истинным кинетическим параметром для оценки каталитических свойств фермента. Значение NfBGL1 для k cat / K m было 5594 / мМ / с, что выше, чем у β-глюкозидаз из P. thermophila (42,8 / мМ / с) [25], Stachybotrys sp. (494,6 / мМ / с) [28] и C. thermophilum (193,4 / мМ / с) [30].

Накопление глюкозы во время ферментативного гидролиза может значительно снизить скорость гидролиза целлюлозы, блокируя активный центр или предотвращая высвобождение продуктов гидролиза [35].Таким образом, высокая толерантность к накоплению глюкозы является требованием грибковых β-глюкозидаз. Насколько нам известно, β-глюкозидазы Gh4 из Candida peltata [36] и Aspergillus oryzae [37] продемонстрировали самую высокую толерантность к глюкозе со значениями K i, равными 1,4 и 1,36 M, соответственно. По сравнению с этими двумя грибковыми аналогами, NfBGL1 показал меньшую устойчивость к ингибированию глюкозы с K i, равным 13,4 мМ, но толерантность к глюкозе была намного выше, чем у β-глюкозидаз из T.reesei , F. palustris и P. funiculosum NCL1 (таблица 1).

3,6. Гидролиз изофлавоновых гликозидов сои NfBGL1

β-глюкозидазы с гидролизной способностью разлагать изофлавоновые гликозиды сои имеют потенциал применения в пищевой и кормовой промышленности. На основании анализа ВЭЖХ экстракт соевой муки содержал как изофлавоновые глюкозиды (270 мг / г; даидзин, генистин и глицитин), так и изофлавоновые агликоны (343 мг / г; даидзеин, генистеин и глицитеин) (Таблица 3).После 5-минутной инкубации при 50 ° C содержание даидзина, генистина и глицитина заметно снизилось, что свидетельствует о том, что большинство изофлавоновых глюкозидов сои (> 90%) превращается в свободные изофлавоны под действием NfBGL1. Эффективность преобразования даидзина и глицитина достигала 100%, а для тестируемых изофлавоновых глюкозидов — 90%. В тех же условиях коммерческая β-глюкозидаза Cellobiase (Novozyme 188) была немного менее эффективной в гидролизе изофлавоновых гликозидов, превращая 82% гликозидов в агликоны.Кроме того, после обработки целлобиазой в экстракте соевой муки было обнаружено больше свободных изофлавононов, чем с NfBGL1 (1120 мг / г по сравнению с 920 мг / г). Это может быть связано с присутствием других неидентифицированных изофлавоновых гликозидов сои, таких как малонил или ацетил.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Неполная блокада правой ножки пучка Гиса

Набрать столовую ложку с предметным стеклом этого сбора, залить стаканом холодной воды и подержать одну сотку. Затем поставить препарат на огонь, прокипятить 5 минут и остудить.Полученное лекарство пить в течение дня небольшими порциями. Курс лечения должен длиться не менее 2 месяцев, чтобы вы почувствовали стойкий эффект.

Прогноз у пациентов, у которых не было никаких симптомов на протяжении всего периода, в течение которого проводилось лечение, считается достаточно благоприятным. Если возникло какое-либо заболевание, сопутствующее полной блокаде или причина ее развития, то врач должен учесть эти факторы при формулировании прогноза.

Однако следует учитывать, что полная блокада самого НПГ значительно увеличивает риск не только развития в будущем очень серьезных осложнений, но и внезапной смерти.

Если дефект постепенно прогрессирует, или при гипертонии, АБ-блокаде, сердечной недостаточности или кардиомегалии, прогноз будет значительным.

У пациентов с частичной блокадой течение патологии благоприятное, особенно у тех, у кого нет симптомов и других патологий сердца.Пациентам следует учитывать, что прогноз зависит от основной патологии сердца или сосудов, а также от того, насколько внимательно они будут относиться к своему здоровью.

Прогноз неблагоприятный с полным левосторонним вмешательством и тремя перцептумами. Первый в остром периоде инфаркта в 40-50% случаев заканчивается летальным исходом, второй опасен развитием асистолии, фибрилляции желудочков, внезапной смерти от остановки сердца.

Пучок Гиса выполняет один из основных компонентов проводящей системы сердца, содержащий узлы, волокна и целые комплексы таких элементов.Его функция — передача электрического импульса желудочкам сердца. Но из-за помех может нарушиться проводимость, из-за чего возникают неисправности.

Построение балки Гиса предполагает наличие двух передних опор и задней. Находящаяся справа ветвь имеет широкий пучок, пронизывающий мышечные слои правого желудочка. Чтобы понять, что такое блокада правой ножки сердца, необходимо учитывать особенности наблюдаемых при этом изменений:

  • По всей сердечной системе происходит замедление импульсов.
  • Правые отделы органа возбуждаются, затрагивая имеющуюся перегородку между желудочками.
  • В процесс вовлекается разблокированный левый желудочек, после чего возбуждается и правый.

Нарушение проводимости на правой ножке пучка Гиса может отрицательно сказаться на работе желудочков, в результате чего изменяется время их возбуждения. В результате возможна потеря нормальной эффективности.

На фоне развития данной патологии импульсы в левый луч Гиса могут доходить без изменений, не обращаясь к правой ноге.Из-за такой разобщенности в работе сердец возможны серьезные патологии организма.

Причины

Подобные изменения чаще всего связаны со структурной перестройкой сердечной мышцы. Причиной этого может быть одно из следующих заболеваний:

  • пороки сердца различного типа;
  • ишемия;
  • гемохроматоз;

  • инфаркт, кардиосклероз и другие болезни сердца;
  • легочное сердце;
  • тромбоемол артерий легкого;
  • амилоидоз;
  • отравление медицинскими препаратами или с превышением рекомендованных доз;
  • гипертония.

В некоторых случаях причиной нарушения проводимости могут быть:

  • системные заболевания соединительной ткани;
  • проблемы водоэлектроэнергетического характера;
  • врожденные патологии, связанные с проводящей функцией сердца.

Не стоит забывать о характеристиках корпуса. По статистике каждый двадцатый пациент имеет врожденное нарушение проводимости на правой ноге, что является нормой.

Симптоматика

Осложнения в диагностике заболевания возникают по той причине, что нарушение проводимости правой ножки пучка ГИС не имеет значимых проявлений. Пациент просто не может самостоятельно обнаружить это отклонение.

Чаще всего заболевание выявляется случайным образом, при плановом прохождении ЭКГ. Тем не менее, у пациента могут быть такие жалобы, как боли в области сердца, одышка, прерывания пульса, сильная утомляемость, которые появляются из-за прогрессирования основного недуга, вызвавшего блокаду.

При поражении других секторов возможны следующие симптомы:

  1. Признаки расслоения задней или передней левой ветви зависят от основного заболевания. Обычно они слабо выражены и предполагают боли в сердце, одышку, утомляемость.
  2. Полная блокада левой ножки сердца проявляется головокружением, болями в сердце, сильным сердцебиением. Появление этих симптомов может быть вызвано обширными изменениями левого желудочка, в том числе острым инфарктом.
  3. Трехпакулярная блокада может характеризоваться полным отсутствием проводимости импульсов. У больных частые головокружения, перебои в работе сердца, обмороки. Если не провести адекватное лечение, то возможны различные осложнения, вплоть до инфаркта.

Диагностические особенности

Во время электрокардиографии можно обнаружить любое нарушение проводимости. По результатам этой процедуры специалист определяет дальнейшие действия:

  1. Если выявлена ​​неполная блокада справа при отсутствии других сердечных заболеваний, ее можно списать на характеристики организма.Дополнительные исследования в этом случае не назначаются.
  2. Обнаруженный двуручный блок потребует углубленной диагностики. Если этого отклонения ранее у пациента не наблюдалось, то ему необходима срочная госпитализация, даже при отсутствии жалоб. Если полная блокада слева существует длительное время, то лечение в стационаре не требуется.
  3. При блокаде трех пустышек необходима его госпитализация. Здесь будет находиться Б. непродолжительное время. Было проведено полное обследование с целью определения дальнейшего курса лечения.

Методики лечения

Устранять данную патологию необходимо только при наличии у пациента заболевания, провоцирующего развитие блокады. При его отсутствии терапия не проводится.

Для пациентов, страдающих одно- или двухфакторной неврологией, выбирается медикаментозная терапия, предполагающая прием следующих средств:

  • антиоксидантов;
  • витамины;
  • препараты растений седативные;
  • средство для устранения артериальной гипертензии;
  • антибиотики;
  • сердечные гликозиды и диуретики.

Курс лечения выбирается в зависимости от основного заболевания и стадии его развития. В запущенных случаях блокаду можно лечить хирургическим путем. Предполагает установку пациенту электрокардиостимулятора.

Образ жизни больного и прогноз заболевания

Если у пациента нет сердечных заболеваний, и блокада правой ножки сердца протекает в его организме без осложнений, он может вести нормальный образ жизни при средней степени тяжести. физическая нагрузка.В том случае, если патология вызвана другим недугом, пациенту следует ограничить стрессовые ситуации и нагрузки, устранить вредные привычки, следить за питанием.

Если во время операции пациенту установили ЭКС, то ему следует соблюдать такие меры предосторожности:

  • иметь справку владельца кардиостимулятора;
  • защитить зону имплантации от ударов мобильного телефона или электроприборов;
  • 1 раз в год сдавала ЭКГ (или чаще при наличии специального назначения врача).

Поскольку блокада пучка Гиса не является самостоятельным заболеванием, а выступает как следствие других недугов, прогноз напрямую зависит от заболевания, спровоцированного данной патологией. Одноразовая правая блокада без выраженного поражения сердца не опасна для здоровья человека.

Если импульс левой ветви был заблокирован в результате инфаркта, прогноз менее благоприятный (летальность до 50% при обострении заболевания). Патология трех ремесел также характеризуется тяжелыми последствиями, поскольку на ее фоне появляется вероятность асистолии.

Глокард сам по себе является особенностью организма и не может влиять на качество жизни пациента. Но при развитии сопутствующих заболеваний последствия этой патологии могут быть очень плачевными. Чтобы избежать неприятностей, необходимо систематически проходить обследования на ЭКГ.

При изменении пульса в системе ГИС возникает крайне серьезная патология, нарушающая нормальное функционирование сердца. Блокада стопы пучком Гиса (БНПГ) приводит к тому, что характер меняет или полностью прерывает сократительную способность сердечных зон.

Чаще всего мелкие блокады не беспокоят пациента и выявляются при профилактических осмотрах. Тем не менее, чтобы не допустить ухудшения состояния, важно своевременно начать лечение. Чтобы понять, что такое пучок Гиса, важно разобраться с физиологией проводящей системы в целом.

Описание проводящей системы сердца

Проводящая система сердца

Сердце — удивительный орган, выполняющий множество функций.Одна из них — это функция, которую выполняет токопроводящая система. Он состоит из нескольких образований, а именно:

Иначе это образование называется узлом Киса Flak, и именно от него начинается импульс. Он расположен между полыми венами, а если говорить точнее, то между их ртами. Длина этого узла 10-15 мм, а само образование представлено ячейками двух типов. R-клетки нужны для создания импульса, а Т-клетки — непосредственно для его проведения.

Другое имя — Ашоффа Тавара, находится в правом атриуме.Длина в два раза меньше предыдущего узла. Также состоит из t и p ячеек. Формирует нормальный синусовый ритм.

Одно из важнейших и крупных образований проводящей системы сердца. Состоит из ветвления и начальных сегментов. Последний не связан с миокардом. Ветвление разделено на 2 большие ветви — правую и левую. Обе эти ножки проходят по двум сторонам межжелудочковой перегородки. Слева ответвляются еще 2 веточки, иннервирующие левый желудочек.Правый отвечает за передачу возбуждения на правый желудочек.

Дальнейшее разветвление приводит к образованию этого образования, отвечающего за сократительную способность миокарда желудочков.

Процесс проведения импульса проходит в несколько этапов:

  1. Формирование импульса в узле Kisa Flak. Этот процесс не отражается на ЭКГ. Сформированный импульс поступает в предсердие.
  2. Далее возбуждение по трем трактам (Телель, Бахман, Валлабах) достигает атриовентрикулярного узла.
  3. От АВУ импульс проходит через окружающий миокард, а также попадает в пучок Гиса.
  4. В луче Гиса импульс идет в его правую и левую ветви и далее в волокна Пуркинье, осуществляя возбуждение желудочков.

Стоит отметить, что в обычном ритм-драйвере это узел Kisa Flak. Центры возбуждения второго и третьего порядка могут выполнять роль водителя только в условиях сформировавшейся патологии.

Классификация блоков

Виды блокады

Если говорить непосредственно о нарушениях проводимости в пучке Гиса, то в зависимости от количества пораженных пучков блокаду следует разделить на следующие:

  1. Одиночная боль.
  2. Двуручный.
  3. Три корабля.
  • Местный. Проблема четко локализована и изменение пульса фиксируется исключительно в этой точке.
  • Переходный.Есть небольшой затор, поэтому нормальное возбуждение может чередоваться с патологическим.
  • Чередование. Нет четкой локализации. Во время экспертизы нарушение можно зарегистрировать в любом отделении, а затем изменить его местонахождение.
  • Полная блокада правой ножки.
  • Полная закупорка стопы луча в области левой ноги.
  • Неполный пучок ГИС в правой или левой ноге.

Также выберите блокаду ветвления. Нарушение располагается в нижних отделах волокон Пуркинье.Таким образом, существует большое количество всевозможных блокад, различить которые можно, проведя электрокардиографическое исследование (ЭКГ).

ВАЖНО: Неполная блокада правой ножки луча Гиса чаще всего не вызывает никаких симптомов и не предполагает опасности. В диагностическом плане такие состояния достаточно сложны и выявляются исключительно на ЭКГ.

Причины

Блокада стопы балки Гиса редко возникает как самостоятельное состояние.В основном это возникает из-за какой-либо патологии. Итак, выделяем следующие причины этого заболевания:

  1. Сердце. Наиболее частыми патологическими состояниями, при которых наблюдается нарушение проводимости в правой и левой ногах луча ГИС, являются сердечно-сосудистые заболевания. В частности, такие блокады отмечаются инфарктами, а также ишемической болезнью сердца.
  2. Легочный. На фоне длительной гипоксии, возникающей из-за проблем с дыхательной системой, возникают также сбои в проводящей системе сердца.
  3. Неврологический. Большую роль играют проблемы с вегетативной нервной системой.
  4. Лекарственное. К нарушениям может привести и неправильное лечение медикаментами. При этом осложнении можно назначать диуретики или гликозиды.
  5. Токсично. На фоне отравления могут быть нарушения в проводящей системе. Самые обычные отравляющие вещества — это алкоголь, а также курительные продукты.
  6. Метаболический. Нарушение электролитного обмена также может проявляться полной и неполной блокадой правой ножки пучка Гиса.
  7. Эндокринная. Возникает на фоне гормонального нарушения. Чаще всего это может быть поражение щитовидной железы или надпочечников. Также одним из заболеваний, при котором можно выявить нарушение проводимости, является диабет.
  8. Идиопатический. В этом случае причину блокады лучевой ножки Гиса на ЭКГ или при проведении другого обследования выявить не представляется возможным.

Таким образом, существует ряд причин, которые приводят к нарушениям в проводящей системе.Чтобы избавиться от этой проблемы, крайне важно не только выявить основной этиологический фактор, но и провести коррекцию основного заболевания, для чего требуется консультация врача.

Симптомы

Для блокады стопы пучком Гиса, характеризующейся симптомами:

  • Головокружение.
  • Чувство перебоев в работе сердца.
  • Полная слабость.
  • Одышка.
  • Брадикардия (снижение частоты сердечных сокращений).
  • Обморок.

Стоит отметить, что если отмечается неполная блокада правой ножки, пациент может вообще не предъявлять претензий. Его обнаружение возможно только при проведении ЭКГ-исследования, поэтому определяется при профилактическом осмотре у лечащего врача. Именно поэтому так важно своевременно посещать специалистов.

Диагностика

Чтобы поставить диагноз «неполной» или «полной» группы ГИС, врачу потребуется ряд данных.Первое, что помогает заподозрить эту проблему, — это жалобы пациентов. Так, пациент может жаловаться на общую слабость, одышку, потерю сознания. В некоторых случаях роль могут играть хронические заболевания или образ жизни пациента.

При физикальном обследовании важную роль играет аускультация. При этом можно обнаружить нарушения сердечного ритма. При перкуссионном исследовании можно выявить изменение границ сердца. В любом случае чаще всего это проявление основного заболевания, поэтому большого диагностического значения не несет.

Наиболее важным обследованием при данной патологии является ЭКГ. Подробности о проявлениях можно найти в таблице.

Местоположение блокады Данные ЭКГ
Правая нога (Next PN) На ЭКГ при блокаде правой ножки пучка Гиса имеется отклонение электронной оси сердца (ЭОС) вправо. Есть расширение комплекса QRS.
Передняя ветвь левой ноги Очищает q в первом определении, а зубец R — в третьем.Отклонение оси сердца влево.
Задняя ветвь левой ноги В первой есть зубец r, а в третьем — Q из Q. Отклонение оси сердца вправо.
Передняя и задняя ветви Ось сердца расположена горизонтально. В некоторых случаях его отклонение можно оставить. В первом определении записан широкий зубец r.
Пн + переднее отделение
Mon + Rear Branch Существует комбинация перечисленных выше функций.Отклонение оси сердца вправо.
Трехкратная блокада На ЭКГ зафиксирована блокада по экстровентрикулярному типу.

Если при проведении обычной ЭКГ блокаду ног выявить не удается, но врач подозревает именно эту патологию, назначается Хальтер-мониторинг. При этом при обследовании в течение дня у пациента имеется компактный прибор ЭКГ, фиксирующий все приступы нарушений сердечной проводимости.При этом виде ЭКГ выявляются неполные блоки правой ножки пучка Гиса.

Терапия

С целью лечения блокады правой и левой ножек пучка Гиса, помимо терапии, врач назначает следующую терапию:

  1. Диета.
  2. Витаминотерапия.
  3. Физиотерапия.

Следует понимать, что для полного избавления от проблемы крайне важно провести основное заболевание.Именно поэтому так важно своевременно обращаться к специалисту, а также соблюдать все его рекомендации.

В особо тяжелых случаях может быть назначено хирургическое лечение. Если медикаментозная терапия не дает должного эффекта, а пациент жалуется на частые обмороки и заболевание серьезно угрожает его жизни, устанавливается электростимулятор. Устройство генерирует правильный ритм и позволяет сердцу работать в обычном режиме.

В случае, если установка электростимулятора производилась, от пациента требуется выполнение некоторых рекомендаций:

  • Не проходить диагностику, основанную на использовании магнитных волн (МРТ, YMRT).
  • Исключить физиотерапию.
  • Не допускайте травм груди.

Тяжелые нарушения могут быть вызваны воздействием электрического тока. Установка кардиостимулятора — крайне серьезный метод, к которому прибегают только в самых сложных случаях. Чтобы этого не произошло, рекомендуется своевременно проходить профилактические осмотры, а также правильно лечить основное заболевание.

Полная блокада правой ножки пучка Гиса не всегда является прямым указанием на включение стимулятора.Обычно к этому методу терапии прибегают при возникновении атриовентрикулярной блокады.

Прогноз жизни

Если блокада голени без клинических проявлений, прогноз болезни можно с уверенностью назвать благоприятным. В этом случае заболевание не требует специфической терапии. Главное, своевременно не допустить обострения основного заболевания и профилактических осмотров врача.

Даже неполный пучок пучка Гиса в правой ноге легко обнаруживается при обследовании.Именно поэтому так важно посетить специалиста и при необходимости пройти курс терапии.

Полная блокада правой ножки сердца — редкий патологический процесс в организме человека. Это не отдельное заболевание, а становится вспомогательным симптомом, который обнаруживается при снятии электрокардиографии. Хотя симптом представляет опасность для здоровья, жалобы со стороны пациента на плохое самочувствие в этом случае отсутствуют.

Наиболее частые блокады провоцируют перенесенные в детстве инфекционные заболевания.Среди них выделено:

  • корь;
  • грипп;
  • ветряная оспа;
  • стенокардия;
  • скарлатина.

При осмотре пациента врач выявляет остаточные проявления нарушений в деятельности сердечной мышцы, которые не были вовремя диагностированы. Однако эти изменения миокарда, появившиеся в детстве, уже не требуют лечения во взрослом возрасте.

  • Вся информация на сайте ознакомлена и не является руководством к действию!
  • Поставить точный диагноз сможет только врач!
  • Убедительно прошу не заниматься самолечением, а записаться к специалисту !
  • Здоровья вам и вашим близким!

С другой стороны, очень важно диагностировать патологические изменения в работе сердечной мышцы в детстве, чтобы избежать осложнений во взрослом возрасте.Поэтому пациентам нужно быть осторожными со стороны педиатров и серьезно подходить к устранению проблем с сердцем.

Функции сердечного луча Gis

Каждому организму человеческого тела для нормального функционирования необходим кислород, который он получает с кровью. Кровообращение поддерживается способностью сердца автономно сокращаться в строго определенном ритме.

Нервные импульсы, заставляющие мышечные волокна сердца сокращаться, воздействовать на проводящую систему органа.Одним из важных участков на его протяженности является балка Гиса. Этот элемент находится в толще мышечной перегородки, которая находится между левым и правым желудочками.

Балка ГИС имеет особую конструкцию, в которой различают две ножки — левую и правую. По ним проходят нервные импульсы, устремляясь в один из желудочков сердца. При нарушении нервной проводимости пульса говорят о патологии, которую врачи называют блокадой пучка Гиса ног.

Эта патология Б. в разных случаях выражена сильнее или слабее. Неполная блокада сердца характеризуется частичным затруднением при прохождении возбуждающего импульса, полная диагностируется с прекращением пульса в структурах ножек сердца.

В зависимости от локализации заболевания снимается блокада одной ножки — правой или левой, а также обеих одновременно. Очень часто в детстве блокады образуются без видимых причин.

В большинстве случаев такая блокада бывает неполной, ни с какими заболеваниями не связана. Патологический процесс развивается бессимптомно. К тому же иногда это можно считать даже вариантом нормы.

Если происходит полная блокировка правой ножки сердца, то в этом случае нервный импульс проводится по отдельным мышечным волокнам, начиная от левого желудочка и до левой части перегородки между желудочками.

Симптомы

Неполная блокада правой ножки изолированного типа изолированного типа не ассоциируется с текущими поражениями внутренних органов и заболеваниями.В связи с этим патология протекает без выраженных признаков и поэтому ее сложно диагностировать. Нарушение чаще всего выявляется случайно при плановой проверке.

При полной блокаде правой ножки сердца имеются признаки первичного заболевания, на фоне которого развивается данное нарушение, в том числе:

  • одышка;
  • душевная боль;
  • сильная усталость;
  • сбой в работе сердца.

Однако сама блокада и в этом случае протекает бессимптомно и диагностируется исключительно при УЗИ грудной клетки либо во время ЭКГ, либо во время прослушивания.

Полная блокировка левой ножки пучка Гиса может быть выявлена ​​по другим симптомам, среди которых:

  • головокружение;
  • учащенное сердцебиение;
  • боль в груди.

Характерной чертой блокады является то, что она не носит постоянного характера, поэтому может возникать внезапно, но со временем часто исчезает. Например, при тахицимальной форме болезни нарушение устраняется при нормализации пульса.

При трехкислородной блокаде на пути прохождения нервного импульса также образуется полная или неполная изоляция. В случае неполной блокады импульсы, передаваемые в желудочки по неповрежденным волокнам, блокируются.

При полной блокаде трех пустышек импульсы вообще не проходят. При этом в желудочках сердца появляется эктопический очаг возбуждения. Полностью разобрана работа предсердия и желудочков, а частота ударов сердца снижена до 20-40 ударов в минуту.Такой показатель значительно ниже нормы, что свидетельствует о невозможности полноценного выброса крови в аорту.

Этот тип блокады сопровождает обмороки, вызванные затруднением кровообращения в головном мозге и сопутствующим кислородным голоданием органа. Также может быть ощущение сбоев в работе сердца, головокружение. В таких случаях увеличивается риск внезапной смерти.

Прогнозы развития

Если блокада протекает изолированно, прогноз обычно благоприятный.Изоляция лишь в очень редких случаях переходит в атриовентрикулярную форму. Это может произойти только тогда, когда блокада сформирована против очень серьезного заболевания или нарушения. Также высоки шансы на излечение при одноконтактной блокаде и при отсутствии патологических процессов в сердце и легких.

Прогноз излечения при артериальной гипертензии или ишемии хуже. Однако острый инфаркт чаще всего не оказывает существенного влияния на развитие блокады. Вероятность летального исхода увеличивается при наличии трансмурального обширного инфаркта.

Неблагоприятный прогноз с полной блокадой делается при наличии инфаркта миокарда. При этом умирают 40-50 пациентов из 100. Также низкие шансы на выздоровление наблюдаются при блокаде из трех пустышек, поскольку увеличивается риск асистолизма.

Причины

Причинами образования блокады правой ножки сердца обычно становятся множественные врожденные аномалии:

  • деформация правого сегмента луча;
  • стеноз легочной артерии;
  • дефект перегородки внутри сердца.

Полная блокада правой ножки пучка Гиса образуется вследствие некоторых заболеваний. Их список довольно обширен:

  • гипертония;
  • кардиомиопатия;
  • острая форма инфаркта;
  • ишемическая болезнь;
  • тупое ранение грудной клетки;
  • операция на сердце;
  • дистрофические изменения мышечных волокон;
  • гиперкалимия;
  • интоксикация сердечными препаратами;
  • изменения функциональности и структуры миокарда.

Лечение блокады правой голени

При блокировании опор балки ГИС специфических особенностей нет, а нарушения обычно диагностируются случайно во время плановых обследований. В связи с этим выявить нарушения получается только по наличию сопутствующих заболеваний сердца. Соответственно, лечение блокады правой ножки сердца начинает устранять негативное влияние этих заболеваний на организм.

Выделяют 4 основных заболевания, на фоне которых развивается блокировка в пучке ГИС:

  • ишемическая болезнь;
  • артериальная гипертензия;
  • хроническая интоксикация;
  • инфаркт правого желудочка.

Перед непосредственным устранением последствий, возникающих из-за блокировки ножек балки Гиса, необходимо вылечить первичное заболевание, провоцирующее развитие патологии.

Сам факт наличия блокировки ножек сердца говорит о наличии значительных нарушений в организме. Они локализуются в мышцах правого желудочка или в перегородке между желудочками.

Лекарства При лечении последствий блокады правой ножки пучка Гиса используются некоторые лекарственные средства, в том числе часто используются следующие:
  • Эналаприл;
  • Милдронат;
  • рибоксин;
  • Триметазидин.

Конкретный вид препарата подбирается врачом в каждом конкретном случае индивидуально с учетом показателей, полученных по результатам исследований.

В рамках дополнительной терапии пациентам назначают препараты от аритмии.

При стойком повышении артериального давления врач прописывает пациенту лекарства для устранения этого симптома.

Хирургический Хирургическое вмешательство может потребоваться, если блокада ножек сердца была вызвана каким-либо врожденным пороком развития сердца.

По окончании общего курса лечения или после операции пациенту следует продолжить наблюдение терапевтов и кардиологов. Специалисты будут отслеживать все изменения. Если возникает такая необходимость, вовремя корректируют методы терапии.

Эффекты

Однако все негативные последствия в большинстве случаев развиваются из-за того, что пациент игнорирует рекомендации врача. Поэтому, чтобы избавиться от различных рисков, нужно своевременно пройти медицинское обследование и явиться на осмотр к врачу.

Особенно важно проконсультироваться с врачом у пациентов, у которых в настоящее время проводится лечение сердечно-сосудистой системы. При первом появлении опасных симптомов важно немедленно обратиться в больницу, не откладывая обследование на потом. Последствия могут быть необратимыми.

Пациент с характерными симптомами направляется на ЭКГ и в результатах видит такую ​​запись: «Полная блокада правой ножки пучка Гиса.«Сразу возникает множество вопросов: насколько это опасно. Что это вообще: болезнь или симптом? Не волнуйтесь особо, в первую очередь нужно разобраться.

Сердце — сложная система

Физиология

Его пучковые ножки — составная часть проводящей системы миокарда. Они отвечают за суммирование импульсов возбуждения к желудочкам. Различают эти ножки пучка Гиса:

  1. слева;
  2. справа спереди;
  3. сзади — сзади. толще других.

Левая и правая — задние ответвления. Ноги связаны сеткой анастомозов. Весь пучок имеет в своей структуре атипичные мышечные волокна. Крайние участки ножек разветвлены и образуют еще один элемент сердца — волокно Пуркинье.

Ключевой целью луча является передача электрического импульса в желудочки от правого предсердия. Неполное или полное нарушение проводимости пульса может произойти и на правой и на левой ноге, и на двух одновременно.

Примечание! БПНПГ часто клинически не проявляется, а значит, лечение не проводится.

Опасность БПНПГ растет с возрастом. Если у молодежи такое явление имеется от 0,6%, то для возрастной группы старше 55 лет в среднем — 2%. Блокада правой ножки пучка Гиса чаще встречается у мужчин.

Почему развивается?

Блокада PNPG вызывает различные виды патологических состояний:

  • пороки сердца, в том числе врожденные и приобретенные;
  • кардиомиопатия, миокардиодистрофия;
  • Ишемия сердца;
  • миокардит вирусного и бактериального происхождения;
  • инфаркт миокарда, кардиосклероз;
  • ревматические поражения сердца;
  • тромбоэмболия;
  • хронические патологии легких, провоцирующие такое состояние, как легочное сердце;
  • недоразвитие ПНПГ.

Существуют и другие причины, не относящиеся к патологическим состояниям миокарда, среди них:

  • хронические патологи органов дыхания, которые сопровождаются обструктивными процессами;
  • мышечная дистрофия;
  • передозировка сердечными гликозидами, диуретиками и некоторыми другими лекарственными средствами;
  • курение длительное время;
  • алкоголизм;
  • дисфункция vNS;
  • болезни эндокринной системы;
  • диабет;
  • анемия.

Размещение пучка Gisa

У детей блокада возникает из-за небольших аномалий сердца, незакрытого овального окна, пролапса митрального клапана. Если органических поражений сердца нет, такое состояние считается нормой.

Читайте также :, Аргументы специалистов

Классификация

Классифицируется БНПГ по разным признакам. Если рассматривать это с позиции проводимости импульсов, это бывает неполным, когда импульс замедляется, но все же проходит.Полную блокаду называют абсолютным прекращением передачи пульса.

Разделение по количеству некровируемых лучей:

  1. Sing-apart — чаще страдает правая нога, но может пропасть проводимость только в левой или только в спине.
  2. Две полые — прикрывает ветвь левой; По одной ветви левая и правая нога.
  3. Трехручный — имеется неполная или полная блокада правой и левой ноги.

Классификация типов развития:

  • Прерывистое — при кардиограмме кажется, исчезает.
  • Постоянный — постоянно отслеживается в исследовании.
  • Overgoing — блокада правой ножки пучка Гиса на ЭКГ проявляется время от времени.
  • Переменный. Для такой формы характерна блокада то на правой, то на левой ноге.

Приметы

Чтобы своевременно начать лечение и не страдать от последствий, важно вовремя заметить патологическое состояние. Часто БПНПГ проходит бессимптомно, особенно не «люблю» показывать одношаговые блокировки.Часто они обнаруживаются случайно при плановой ЭКГ. При полной блокаде ПНПГ симптомы проявляются, хотя в основном они не сопровождаются серьезными поражениями миокарда. Среди примет:

  1. Необычные цвета сердца при прослушивании.
  2. Головокружение.
  3. Предреальное и слабое.
  4. Ощущение нехватки воздуха, одышка.
  5. Слабая переносимость любых нагрузок, быстрое утомление.
  6. Редкое проявление — боль в сердце, ощущение перебоев в работе организма.

Если блокада спровоцировала заболевание, то отмечаются характерные для нее проявления.


ЭКГ блокады задней и правой ноги

Методики диагностики

При появлении перечисленных симптомов рекомендуется обратиться к врачу на консультацию. Скорее всего, сразу на ЭКГ отправят. Если результаты кардиограммы показали неполную блокаду правой ножки, и при этом у пациента нет других патологий сердца, состояние считается нормой.Дополнительные техники не назначаются.

Если обнаружена засорение двумя руками, необходимо детальное обследование. При диагностировании блокады двух левых ветвей, которая обнаруживается впервые, требуется немедленная госпитализация. Аналогично выявляется патология миокарда обширного типа. Часто двуручный блок качает проявление инфаркта миокарда. Если левая блокада держится долго, в стационарном лечении нет необходимости.

Трехручная блокада — показание к немедленной госпитализации и подробному обследованию.

В дополнение к ЭКГ используются другие методы отслеживания:

  • Холтер. Помогает выявить поворотную блокаду.
  • Хирургическая ЭКГ. Благодаря тому, что электрод максимально приближен к сердцу, можно определить блокаду, если кардиограмма этого не покажет.
  • Эхоче — УЗИ сердца.
  • МСКТ (мультиспиральная компьютерная томография) — решающая мера, если другие методы дали противоречивые результаты.

Лечение

При BPNPG специальное лечение лекарствами не требуется, но только при условии, что нет основного сердечного или другого заболевания.Часто назначают такие группы препаратов:

  1. Витамины. Среди них Тиамин, Рибофлавин, Никотиновая кислота.
  2. Антиоксиданты.
  3. Успокаивающее средство растительного происхождения.
  4. Липидсодержащие средства, способствующие нормализации количества холестерина в крови.
  5. При хронической недостаточности — диуретики и гликозиды.
  6. При гипертонической болезни — гипотензивное средство.
  7. При ишемии — Анангинальные препараты.
  8. При воспалении оболочек сердца — антибиотики, НПВП.

Иногда медикаментозное лечение малоэффективно, чтобы избежать негативных последствий применяемое хирургическое вмешательство. Операция по установке кардиостимулятора. Полные блокады часто развиваются в острой фазе инфаркта миокарда, поэтому требуется временная электростимуляция.


Лечение БПНПГ необходимо часто

Последствия и осложнения

Большинство. опасное последствие. Это нарушение проводимости становится внезапной смертью. Это возможно при полной блокаде.Что касается менее критических последствий, это развитие сердечной недостаточности. Могут возникнуть:

  • Острое нарушение мозгового кровообращения, которое приводит к инсульту.
  • Обострение основной патологии, спровоцировавшей блокаду.
  • Тромбоэмболия на фоне загустения крови. Трубы образуются не только в сердце, но и в других органах, конечностях.

Выход

Блокада правой ножки пучка Гиса не считается опасной, если она не сопровождается другими патологиями сердца.Если такие есть, необходимо держать состояние под контролем и регулярно сдавать ЭКГ.

Еще:

ЭКГ при блокаде левой ножки пучка Гиса, причины развития патологии, методы лечения

границ | Продукты ферментации Paenibacillus bovis sp. ноя BD3526 облегчает симптомы сахарного диабета 2 типа у крыс GK

Введение

Согласно данным, опубликованным Международной федерацией диабета, в 2017 году во всем мире насчитывалось 425 миллионов человек с диабетом.Сахарный диабет 2 типа (СД2) характеризуется устойчивым снижением секреции инсулина β-клетками поджелудочной железы, что приводит к недостаточности инсулина для удовлетворения потребностей организма. Длительный СД2 в организме человека может вызывать серьезные осложнения, например, при заболеваниях почек, раке и сердечно-сосудистых заболеваниях (Stern, 1995; Coughlin et al., 2004).

За последние два десятилетия накопились доказательства того, что патогенез СД2 и его осложнений может быть связан с факторами воспаления (т.е., IL-1β, IL-6, MCP-1, TNF-α и IFN-γ) (Cuman et al., 2001; Rotter et al., 2002; Masters et al., 2010; Westwellroper et al., 2011; WestwellRoper et al., 2014; Greer et al., 2016). Например, IL-6 является наиболее эндокринным цитокином и вырабатывается не только иммунокомпетентными клетками, но и жировыми клетками, участвующими в воспалительной реакции организма и энергетическом обмене (Rotter et al., 2002). У пациентов с воспалением уровень IL-6 повышен. Избыток IL-6 способствует дифференцировке островковых β-лимфоцитов поджелудочной железы и сверхэкспрессирует ген IgG, что способствует чрезмерной активации Т-лимфоцитов и тем самым вызывает разрушение и гибель островковых β-клеток (André-Schmutz et al., 2010; Донат, 2013). Таким образом, терапевтические цели для лечения СД2 сместились с простых гипогликемических препаратов (например, инсулина и акарбозы) на препараты, подавляющие воспалительные факторы (такие как блокировка рецепторов IL-1, анакинра, и ингибирование IKKβ-NF-κB салсалатом) (Donath, 2013).

Микробиота кишечника играет важную роль в развитии T2DM, искажая иммунный ответ хозяина на воспалительную реакцию (Karlsson et al., 2013). Wu et al. (2017) обнаружили, что у клинических пациентов с СД2 произошли значительные изменения в составе и разнообразии микробиоты кишечника после приема метформина, который полезен для улучшения симптомов СД2.Некоторые источники утверждают, что Akkermansia muciniphila в кале значительно обогащается у пациентов и мышей с СД2 после приема метформина (Karlsson et al., 2013; Lee and Ko, 2014; Shin et al., 2014; Zhang et al., 2015). ; de la Cuesta-Zuluaga et al., 2017; Forslund et al., 2017). Низкие уровни A . muciniphila в кишечнике может коррелировать с истончением слизистой оболочки, что приводит к ослаблению барьерной функции кишечника (Derrien et al., 2004).Кроме того, A. muciniphila было снижено у пациентов с ожирением и СД2 (Derrien et al., 2004; Everard et al., 2013). Кроме того, недавнее исследование также утверждает, что A . muciniphila может улучшить скорость ответа пациентов с опухолями на иммунотерапию PD-1 / PD-L1 (Routy et al., 2018).

С тех пор мы выделили новую бактерию, обозначенную как Paenibacillus bovis sp. ноя BD3526 из молока тибетского яка в предыдущей работе (Hang et al., 2016).Этот штамм может синтезировать экзополисахариды с иммуномодулирующей активностью in vitro (Xu et al., 2016). Вместо этого попытки определить взаимосвязь между экзополисахаридами и СД2 еще не решены. В этой работе лиофилизированный супернатант ферментированного молока штамма BD3526 скармливали крысам GK и наблюдали его влияние на диабетический фенотип крыс. Было обнаружено, что симптомы диабета у крыс, получавших супернатант, значительно улучшились. Содержание А . muciniphila в кишечнике было значительно увеличено, что совпало со снижением воспалительной реакции в кишечнике.

Материалы и методы

Бактериальный штамм и культивирование

Paenibacillus bovis sp. nov BD3526 (CGMCC 8333 = DSM28815 = ATCC BAA-2746) был предоставлен Государственной ключевой лабораторией молочной биотехнологии, Шанхай, 200436, Китай. Бактериальный штамм обычно культивировали в аэробных условиях на молочном агаре при 30 ° C в течение 24 часов.Среду готовили добавлением 10 мл стерильного 10% (мас. / Мас.) Восстановленного обезжиренного молока к 100 мл расплавленного 1,5% (мас. / Мас.) Раствора агара. Штамм хранили в стерильной 10% (мас. / Мас.) Восстановленной добавке из обезжиренного молока с 10% (об. / Об.) Глицерином при -80 ° C.

Приготовление продуктов ферментации штамма BD3526

Петлю свеже культивированного BD3526 на молочном агаре инокулировали в колбу емкостью 100 мл, содержащую 20 мл стерильного 10% (мас. / Мас.) Восстановленного обезжиренного молока, и культивировали при 30 ° C при 180 об / мин в течение 24 часов.Затем культуру переносили в колбу на 250 мл, содержащую 50 мл стерильного 10% (мас. / Мас.) Восстановленного молока в соотношении 4% (об. / Об.), И культивировали в тех же условиях, как указано выше, в течение 72 часов. Образцы с разными интервалами кипятили в течение 5 мин, а затем центрифугировали при 12000 × g при 4 ° C в течение 20 мин. Супернатант нейтрализовали 1 М NaOH до pH 6,8 и анализировали на ингибирующую активность в отношении альфа-глюкозидазы (EC 3.2.1.20), используя p -нитрофенил- D -глюкопиранозид (PNPG) в качестве субстрата.72-часовую культуру с ингибирующей активностью по отношению к альфа-глюкозидазе приблизительно 60% (данные не опубликованы) кипятили и центрифугировали при тех же условиях, упомянутых выше. Супернатант лиофилизировали под вакуумом. Затем лиофилизированный порошок хранили в холодильнике. Перед введением через желудочный зонд экспериментальным животным порошок повторно растворяли в дистиллированной воде в концентрации 50 мг / мл.

Эксперименты на животных

Всего 10 крыс Goto-kakisaki (GK) в возрасте двенадцати недель были усыновлены на 1 неделю, а затем случайным образом разделены на две группы.Крысам в группе BD3526 ежедневно вводили через желудочный зонд 2 мл 50 мг / мл лиофилизированных продуктов ферментации BD3526, тогда как крысам в контрольной группе вводили через желудочный зонд 2 мл 50 мг / мл сухого обезжиренного молока. Животных содержали в индивидуальной клетке со свободным доступом к обычной жевательной планке и питьевой воде. В день определения уровня глюкозы в крови после приема пищи животным сначала давали нормальный жевательный батончик в течение 1 ч, а затем проводили через желудочный зонд. После введения через желудочный зонд жевательные батончики были удалены из клетки, и образец крови из хвоста был собран через 2 часа после введения через желудочный зонд и проанализирован с помощью коммерческих тест-полосок для определения уровня глюкозы в крови (Sannuo, Шэньчжэнь, Китай).

Уровень глюкозы в крови после приема пищи и масса тела измерялись еженедельно, а также собирались образцы кала. Гликированный гемоглобин измеряли на 5-й неделе. С 6-й недели и после этого введение через желудочный зонд прекращали, и животных возвращали к нормальному содержанию. Постпрандиальный уровень глюкозы в крови и вес тела измеряли непрерывно (еженедельно), и образцы кала собирали до 9-й недели. После 9-й недели кишечную слизь крыс собирали для определения иммунологического фактора.Кормление норм проводили в Shanghai Slac Experimental Animal Co., Ltd.

.

Экстракция ДНК и ПЦР-амплификация

Микробная ДНК была извлечена из образцов фекалий с помощью E.Z.N.A. ® набор ДНК стула (Omega Biotek, Norcross, GA, США) в соответствии с протоколами производителя. Конечную концентрацию ДНК и степень очистки определяли с помощью спектрофотометра NanoDrop 2000 UV-vis (Thermo Scientific, Wilmington, DE, USA), а качество ДНК проверяли электрофорезом в 1% агарозном геле.Гипервариабельные участки V3-V4 гена 16S рРНК бактерий амплифицировали с помощью термоциклерной ПЦР-системы (GeneAmp 9700, ABI, США). ПЦР проводили в трех повторах с 20 мкл смеси, содержащей 4 мкл 5 × FastPfu буфера, 2 мкл 2,5 мМ dNTP, 0,8 мкл каждого праймера (5 мкМ), 0,4 мкл полимеразы FastPfu и 10 нг матричной ДНК. Полученные продукты ПЦР экстрагировали из 2% агарозного геля, дополнительно очищали с помощью набора для экстракции ДНК из геля AxyPrep (Axygen Biosciences, Юнион-Сити, Калифорния, США) и количественно оценивали с помощью QuantiFluor TM-ST (Promega, США), согласно протокол производителя.

Высокопроизводительное секвенирование

Очищенные ампликоны объединяли в эквимолярном соотношении и секвенировали по парным концам (2 × 300 п.н.) на платформе Illumina MiSeq (Illumina, Сан-Диего, Калифорния, США) в соответствии со стандартными протоколами Sinotech Genome Technology Co., Ltd. (Шанхай, Китай).

Биоинформатический анализ и статистический анализ

При биоинформатическом анализе образцов секвенирования 16S рРНК мы использовали облачную онлайн-платформу от Sinotech Genome Technology Co., ООО

В частности, мы использовали Usearch (версия 7.0) для выполнения кластерного анализа OTU. Разнообразие группы BD3526 и контрольной группы было проанализировано с использованием материнского программного обеспечения (версия v.1.30.1). Кроме того, мы также использовали анализ PLS-DA в пакете R language mixOmics и создали карту расстояний для каждого образца.

При сравнении различных штаммов мы использовали метагеномную последовательность, полученную из языкового пакета R, для выполнения нулевого гауссова распределения, чтобы обработать влияние глубины секвенирования, и, наконец, мы обнаружили разницу на основе линейной модели.

При анализе случайного леса мы использовали пакет Random Forest и пакет plotROC, чтобы быстро и эффективно выбрать категорию видов, которая является наиболее важной для классификации выборки, и выполнить соответствующую проверку ROC.

Мы использовали программное обеспечение Networkx для анализа коллинеарных сетей и корреляционного анализа сетей.

Прогнозирование функции 16S используется для стандартизации таблицы численности OTU с помощью PICRUSt (программное обеспечение PICRUSt хранит информацию о KO, соответствующую идентификатору зеленого гена), то есть для устранения влияния количества копий гена-маркера 16S у вида. геном.Затем мы передаем идентификатор зеленого гена, соответствующий каждому ауту, получаем информацию по ортологу KEGG (KO), соответствующую ауту, и вычисляем численность KO. Согласно информации из базы данных KEGG, можно получить информацию о KO, Pathway и EC, а также можно рассчитать численность каждой функциональной категории на основе численности OTU. Кроме того, для Pathway PICRUSt можно использовать для получения трех уровней информации о метаболических путях и для получения таблиц численности для каждого уровня.

Кроме того, мы также использовали программное обеспечение Graphpad Prism6 для создания статистических изображений статистических данных.

In vitro Имитатор кишечника

Основные протоколы отсылаются к опубликованной статье (Wu et al., 2017). Вкратце, собирали 2% пробы фекалий и культивировали в 5 мл бульона BHI в течение 3 часов при 37 ° C, и 2% предварительную культуру засевали в питательную среду. Среда состояла из: (в г / литр) арабиногалактана (1,0), пектина (2,0), ксилозы (1,5), крахмала (3.0), глюкоза (0,4), дрожжевой экстракт (3,0), пептон (1,0), муцин типа II (4,0) и цистеин (0,5). Среду подкисляли до pH примерно 2 с помощью 6-M HCl для имитации процессов пищеварения и нейтрализовали имитацией панкреатического сока до pH примерно 6,9. Смоделированный панкреатический сок содержал: (в г / литр) NaHCO 3 (12,5), желчные соли Oxgall (6,0) и панкреатин (0,9). Если эксперимент не проводился в течение 3 дней, все культуры находились в анаэробных условиях.

Обнаружение цитокинов

Протокол определения цитокинов можно найти в инструкциях к набору крысиного набора цитокинов антител (Abcam, ab133992).Вкратце, мембрану инкубировали с блокирующим буфером. Затем добавляли 1 мл слизи толстой кишки для связывания антител, которые фиксируются на поверхности мембраны. После этого этапа мембрану промывали промывочным буфером пять раз, а затем инкубировали с 1X биотин-конъюгированными антицитокинами и 1X HRP-конъюгированным стрептавидином. Наконец, мембрану экспонировали с помощью рентгеновской пленки.

Регистрационный номер

Paenibacillus bovis sp. ноя BD3526, упомянутый в этой статье, можно найти в базе данных ATCC.Номер АТСС Paenibacillus bovis sp. ноя BD3526 — это BAA-2746. Данные высокопроизводительного секвенирования из этого исследования были депонированы в базах данных Sequence Read Archive (SRA) под следующим номером доступа: SRP151163 и PRJNA508215.

Заявление об этике

Проект использования животных и ухода за ними в этом исследовании был рассмотрен и одобрен Шанхайским офисом управления лабораторными животными (SYXK [Шанхай] 2017-0008).

Животные, использованные в исследовании, были использованы на основании соответствующих экспериментальных процедур.Все животные были приобретены на законных основаниях, и их содержание и использование соответствовало федеральным, государственным и местным законам и постановлениям в каждом случае и в соответствии с Руководством по уходу и использованию Институционального комитета по уходу и использованию животных SLAC (IACUC). Лабораторные животные.

Животные, использованные в этом исследовании, получили все необходимое для их комфорта и были надлежащим образом размещены, кормились, а их окружение содержалось в санитарном состоянии.

Использование животных соответствовало Руководству IACUC по уходу и использованию лабораторных животных.В экспериментах использовалось минимальное количество мышей. Соответствующие анестетики использовались для устранения чувствительности к боли во время всех хирургических процедур.

Результаты

Симптомы диабета были облегчены в группе BD3526

В нашей предыдущей работе мы обнаружили, что штамм BD3526 может синтезировать большое количество экзополисахаридов (36,25 г / л) с иммуномодулирующей активностью in vitro (Xu et al., 2016), что также может играть роль в замедлении развития диабета in vivo .Помимо EPS, моносахариды, например, в форме фруктозы, также могут быть идентифицированы в продуктах ферментации BD3526. Поэтому, чтобы наблюдать влияние продуктов ферментации штамма BD3526 в обезжиренном молоке на уровень глюкозы в крови, мы выбрали десять крыс GK в качестве субъектов. Крысы GK представляют собой широко используемую модель спонтанного диабета 2 типа без ожирения с умеренно повышенным уровнем глюкозы в крови натощак, повышенным уровнем глюкозы в крови после еды и стабильными нарушениями секреции инсулина, стимулированными глюкозой, и непереносимостью глюкозы (рис. 1А).Кроме того, он имеет те же изменения, что и микрососудистые осложнения диабета 2 типа у человека. Его фенотипы приближаются к стабильности по мере приближения к взрослой жизни. Результаты показали, что уровень глюкозы в крови после приема пищи в группе BD3526 показал значительное снижение на четвертой и пятой неделе ( * -значение P <0,05, среднее ± SEM) (рис. 1B). Самая низкая точка постпрандиального уровня глюкозы в крови в группе BD3526 появилась на пятой неделе, а концентрация глюкозы в крови составила 13.12 мМ / л. Соответственно, постпрандиальная концентрация глюкозы в крови контрольной группы крыс GK на пятой неделе составила 17,32 мМ / л. Кроме того, индекс гликозилированного гемоглобина в группе BD3526 также был значительно ниже, чем у контрольной группы ( ∗∗ P -значение <0,01, среднее значение ± стандартная ошибка среднего) (Рисунок 1C). Средняя концентрация гликированного гемоглобина в группе BD3526 составляла 199,58 нМ / л, тогда как значение в контрольной группе составляло 231,25 нМ / л. Это открытие предполагает, что симптомы диабета в группе BD3526 были значительно облегчены.Кроме того, в тесте на индекс массы тела мы вычли массу тела крыс контрольной группы из массы тела группы BD3526 и обнаружили, что скорость набора массы крыс GK в группе BD3526 была значительно ниже, чем у крыс контрольной группы (рис. 1D). Эти результаты показывают, что продукты ферментации штамма BD3526 обладают способностью снижать показатели, связанные с диабетом, у крыс GK с T2DM.

Рисунок 1. Наблюдение за симптомами сахарного диабета 2 типа. (A) Всего в этой работе использовали 10 крыс GK в возрасте 13 недель, которых случайным образом разделили на две группы. Крысам в группе BD3526 ежедневно вводили через зонд 2 мл лиофилизированного порошка продуктов ферментации штамма BD3526 (50 мг / мл), тогда как крысам GK в контрольной группе ежедневно вводили через зонд 2 мл физиологического раствора. Всем животным был разрешен свободный доступ к обычным жевательным плиткам и воде. С интервалом 0, 2, 3 и 6 недель наблюдали за изменением показателей диабета у этих крыс.На шестой неделе введение либо продуктов ферментации штамма BD3526, либо физиологического раствора было прервано, и крысы были возвращены к нормальному питанию. После восстановления животных анестезировали и умерщвляли, а слизь в кишечнике и толстой кишке расчесывали. После прекращения приема продуктов ферментации штамма BD3526 желательно наблюдать за изменениями фенотипа. (B) Измерения глюкозы в крови после приема пищи были выполнены в группе BD3526 и контрольной группе.Ось x представляет время недели. Оси и представляют концентрацию глюкозы в крови после приема пищи (мМ / л). Звездочка представляет собой значительную разницу в концентрации глюкозы в крови между группой BD3526 и контрольной группой ( * P -значение <0,05, среднее ± SEM). (C) Тест на гликированный гемоглобин (HbA1c) подтвердил, что концентрация глюкозы в крови в группе BD3526 была значительно ниже, чем в контрольной группе ( ∗∗ P -значение <0.01, среднее ± стандартная ошибка среднего). (D) Показатели массы тела использовались для оценки еженедельных изменений массы тела в моделях группы BD3526 и контрольной группы (среднее значение ± стандартная ошибка среднего).

Разнообразие кишечных микробов у крыс GK, получавших продукты ферментации штамма BD3526, увеличилось

Помимо еженедельного тестирования физиологических и биохимических показателей крыс GK в группе BD3526 и контрольной группе, образцы фекалий также собирали на неделях 0, 2, 3 и 6 для секвенирования 16S рРНК.Есть надежда, что эффект на кишечные микробы крыс GK можно будет наблюдать. Среди них нулевая неделя и шестая неделя были стандартами начального и вымываемого значения фекальной микробиоты крысы GK в группе BD3526, соответственно, а вторая неделя и третья неделя представляли микробиоту, на которую влияет прием ферментации BD3526. продукты.

Микробиоту в образцах фекалий либо группы BD3526, либо контроля анализировали с помощью секвенирования 16S рРНК, выполненного на платформе Illumina Miseq.После секвенирования было проанализировано биоразнообразие кишечных микробов двух групп крыс GK. На 2-й и 3-й неделях анализ Pan / Core показал, что в группе BD3526 общее количество OTU было значительно выше, чем в контрольной группе (рис. 2A). Соответственно, количество OTU, общих как в контрольной группе, так и в группе BD3526, значительно уменьшилось (рисунок 2B). Кривая Шеннона также показала, что количество OTU в группе BD3526 и в контрольной группе было насыщено с увеличением числа считываний секвенирования, а количество OTU в группе BD3526 было больше, чем в контрольной группе (рисунок 2D). .Эти результаты показывают, что разнообразие кишечной микробиоты крыс GK в группе BD3526 было значительно выше, чем у контрольных крыс GK. Этот результат был также подтвержден проверкой альфа-разнообразия ( * P <0,05, среднее ± SEM) (рис. 2C).

Рисунок 2. Анализ разнообразия кишечной микробиоты. (A) Панорамный анализ использовался для наблюдения увеличения общего числа видов по мере увеличения количества образцов. (B) Анализ керна был использован для наблюдения за уменьшением количества обычных видов по мере увеличения количества образцов. (C) Статистика α-разнообразия показывает значения индекса разнообразия каждой выборки по каждому типу индекса. ( * P -значение <0,05, среднее ± SEM). (D) OTU 97% сходства или другие таксономические уровни были выбраны для использования программного обеспечения mothur для расчета индекса разнообразия при различных случайных выборках и использования инструментов R-пакета для создания кривой Шеннона. (E) Алгоритм PLS-DA различает группы выборок разных периодов времени в группе BD3526 и контрольной группе.

Для проведения анализа различий внутри и между группами был выбран алгоритм PLS-DA (дискриминантный анализ частичных наименьших квадратов) для сравнения двух групп GK для недели 0, недели 2, недели 3 и недели 6. Как показано на рисунке 2E, не наблюдалось значительной разницы между группой BD3526 и контрольной группой. Вместо этого с введением продуктов ферментации BD3526 микробиота кишечника была диверсифицирована, и на третьей неделе разница между группой BD3526 и контрольной группой была наиболее значительной.Тем не менее, на 6-й неделе и после прекращения введения продуктов ферментации BD3526 в течение 1 недели разница в микробиоте кишечника между двумя группами была частично восстановлена.

Akkermansia сильно обогащается в кишечнике крыс GK, которых кормят BD3526 Продукты ферментации

Секвенирование 16S рРНК в основном связано с различиями в составе кишечной микробиоты между группами. Поэтому мы использовали алгоритм metagenomeseq для анализа различий в составе микробиоты кишечника между крысами BD3526 GK и контрольными крысами GK на 2-й и 3-й неделях.Основываясь на статистике подсчетов каждой группы образцов секвенирования, мы обнаружили, что всего 23 рода изменились в группе BD3526 ( P <0,05). Среди них Akkermansia , Ruminococcaceae _NK4A214, Ruminclostridum _1 и No rank_ Peptococcaceae были повышены в группе BD3526 (рисунок 3A и дополнительная таблица S1). Статистический анализ скорректированных FDR значений P этих 23 родов показал, что Akkermansia продемонстрировала наиболее значительную разницу среди всех измененных родов [-10 Lg ( P -значение) = 2.848796] (Рисунок 3B). В группе BD3526 были обогащены Akkermansia , Ruminococcaceae _NK4A214, Ruminiclostridium _1 и Lachnospiraceae _ND3007, тогда как четыре рода не были обнаружены в другой группе. Вместо этого, Alkaliphilus , Sulfurimonas , Amphritea, Photobacterium , Arenibacter , Anaerolineaceae , Flavobacteriaceae , Sulfurovum 0008, 0008, 0008 Coloni, Sulfurovum Rhodobacteraceae исчезло в группе BD3526.Если быть точным, после корректировки Akkermansia на виды мы обнаружили, что он соответствует A. muciniphila .

Рисунок 3. Скрининг разных родов. (A) Метод metagenomeseq был использован для скрининга различных штаммов группы BD3526 и контрольной группы. Синие столбцы представляют обогащение различных штаммов в группе BD3526. Красные столбцы представляют собой обогащение различных штаммов в контрольной группе. (B) P -значное распределение дифференциальных штаммов, проверенных методом метагеномесек. (C) Предсказание двумерной диаграммы разброса для BD3526 и контрольных образцов путем случайного распределения в лесу. (D) Быстрый выбор категорий видов, наиболее важных для выборочной классификации, путем случайного распределения лесов. Наивысшая точность уменьшения среднего для рода оказала наибольшее влияние на BD3526 и контрольные компоненты.

Однако сам алгоритм metagenomeseq имеет определенные ограничения. Чтобы устранить кажущееся влияние разнообразия кишечной микробиоты, вызванное этим родом из-за его низкой численности или низкой дифференциальной кратности, и эффективно идентифицировать наиболее важные OTU для группы BD3526, мы также построили модель случайного распределения лесов (рис. 3C).В этой модели микробиота кишечника в группе BD3526 и контрольной группе была обогащена в двух разных местах. Мы обнаружили, что Akkermansia занимает наиболее важное место в этой модели, основываясь на численности рода при случайном распределении лесов (рисунок 3D и дополнительная таблица S2). Это говорит о том, что Akkermansia может быть самым большим фактором, влияющим на разницу между группой BD3526 и контрольной группой. Помимо Akkermansia , No rank_ Lachnospiraceae , Prevotella _9, Ruminiclostridium , Lachnospiraceae _UCG_001 и Candidatus_Saccharimonas также вошли в пятерку лучших родов .Среди них Akkermansia и Prevotella _9 также были двумя родами, проверенными с помощью алгоритма metagenomeseq, который показал значительную разницу между двумя группами крыс.

При анализе случайного распределения лесов мы также использовали верхние 6 родов средней точности редукции ( Akkermansia , No rank_ Lachnospiraceae , Prevotella _9, Ruminiclostridium , Candida Lachnospiraceae 900rimus _UCG. модели для выполнения анализа кривой рабочих характеристик приемника (кривая ROC) (дополнительный рисунок S1).Результаты показывают, что в модели, содержащей только эти шесть родов, кривая рабочих характеристик приемника (ROC) достигла 0,81. Соответственно, в модели, содержащей все роды, ROC составляет 0,48. Когда шесть родов были удалены из модели всех родов, ROC составил 0,51. Это показало, что наша модель была точной для оценки разницы между двумя группами.

Интересно, что среди шести родов Akkermansia продемонстрировал наиболее значительную разницу в секвенировании 16S рРНК, что предполагает, что Akkermansia может играть важную роль в облегчении симптомов у крыс GK, получавших продукты ферментации BD3526.Хотя короткоцепочечные жирные кислоты (SCFA) были описаны другими исследователями как ключевые эффекторы при СД2 (Zhao et al., 2018), в группе BD3526 не наблюдалось обогащения микробиоты, продуцирующей SCFA.

Для дальнейшего подтверждения прямой связи между продуктами ферментации и Akkermansia , мы повторно культивировали образцы фекалий in vitro , обработанные 5% продуктами ферментации или 5% обезжиренным молоком. В этом эксперименте in vitro мы сосредоточили внимание на Akkermansia , который был значительно обогащен после обработки продуктами ферментации в течение 1 дня (дополнительный рисунок S2).Это явление соответствовало сделанным нами ранее выводам о том, что Akkermansia значительно обогащается в кишечнике крыс GK, получавших продукты ферментации BD3526.

Продукты ферментации штамма BD3526 изменили взаимодействие кишечных микробов

В кишечнике часто происходят взаимодействия микробов между разными родами и между разными видами. Поэтому для дальнейшей оценки влияния продуктов ферментации штамма BD3526 на микробиоту кишечника крыс GK мы использовали программное обеспечение Networkx для анализа сети взаимодействия.Оценивали взаимодействие между микроорганизмами разных родов в одном образце и корреляцию видов между разными образцами. В сети видового взаимодействия группы BD3526 и контрольной группы мы обнаружили, что доминирующие виды принадлежат Firmicutes. На уровне филума не было значительных различий между двумя группами (рис. 4A, B). Однако, когда мы построили диаграмму центральности узлов на уровне рода, мы обнаружили, что сети взаимодействия группы BD3526 и контрольной группы значительно различались.На диаграмме центральности узла число на оси x представляет другой узел. Каждый узел соответствует взаимодействию отдельного рода с другими родами. Когда пик одновременно возникал на трех кривых степени центральности, центральности близости и между центральностью, считалось, что соответствующий род узла может иметь большое значение для всей сети. В соответствии с этим принципом в группе BD3526 было идентифицировано 9 родов, в том числе No rank_ Ruminococcaceae , Butyrivibrio , Prevotellaceae _NK3B31, Parasutterella и Lactobacillus 4ae, GC-4occ. , Treponema _2 и Ruminiclostridium .В контрольной группе было идентифицировано только пять родов, включая Unclassified_ Veillonellaceae , Sulfurovum , Oscillibacter , No rank_ Gastranaerophilales и [ Fig. Не было ассоциаций между 9 родами группы BD3526 и 5 родами контрольной группы. Этот результат предполагает, что продукты ферментации штамма BD3526 могут оказывать важное влияние на сеть взаимодействия кишечной микробиоты крыс GK.Это может быть еще одним важным фактором улучшения симптомов СД2 в группе BD3526.

Рисунок 4. Сеть взаимодействия кишечной микробиоты. (A) Доминирующая сеть взаимодействия микробиоты в группе BD3526. (B) Доминирующая сеть взаимодействия микробиоты в контрольной группе. (C) Ключевые узлы штамма в группе BD3526 были проанализированы для основного рода. Зеленая кривая представляет степень центральности. Красная кривая представляет центральность близости, а синяя кривая представляет центральность промежуточности.Узлы, три кривые которых достигают пика одновременно, могут быть родом, который играет важную роль в сети взаимодействия. Подробное название рода и информация о параметрах перечислены в следующей таблице. Черные треугольники представляют важный род в этой сети. (D) Ключевые узлы штамма в группе BD3526 были проанализированы для основного рода. Зеленая кривая представляет степень центральности. Красная кривая представляет центральность близости, а синяя кривая представляет центральность промежуточности.Узлы, три кривые которых достигают пика одновременно, могут быть родом, который играет важную роль в сети взаимодействия. Подробное название рода и информация о параметрах перечислены в следующей таблице. Черные треугольники представляют важный род в этой сети.

В то же время видовая корреляция показала, что крысы в ​​группе штамма BD3526 разделяли часть видов с таковыми из контрольной группы. Однако баллы, соответствующие только группе BD3526, были значительно выше, чем баллы только контрольной группы (дополнительный рисунок S3), что указывает на то, что виды в кишечной микробиоте крыс GK в группе BD3526 продемонстрировали большую специфичность.

Продукты ферментации штамма BD3526 уменьшили количество родов в кишечной микробиоте, которые были тесно связаны с болезнями у крыс GK

Чтобы оценить влияние различных микробов на стабильность микробиоты кишечника в группе BD3526, мы получили данные секвенирования 16S рРНК с помощью соответствующего идентификатора Greengene ID каждой OTU. Профили функционального состава были предсказаны с помощью PICRUSt. Результаты показывают, что в группе BD3526 наиболее значительные изменения в категориях KEGG (уровень 2) были сосредоточены на пяти путях, включая заболевания иммунной системы [-10 Lg ( P -значение) = 17.798790], рак [-10 Lg ( P -значение) = 16,241620], рост и гибель клеток [-10 Lg ( P -значение) = 15,0], трансляция [-10 Lg ( P -значение) = 16,241620] и инфекционных заболеваний [-10 Lg ( P -значение) = 15,785920] (Рисунок 5). Все эти пять путей KEGG были связаны с заболеваниями, включая иммунные заболевания, рак и инфекционные заболевания. Это говорит о том, что потребление продуктов ферментации штамма BD3526 может оказывать сильное влияние на развитие заболеваний и поддерживать баланс кишечной микробиоты крыс GK.

Рис. 5. Микробные изменения в группе BD3526. Ось x представляет собой KO-имя сигнальных путей. Ось y представляет разницу в аннотации генов KEGG (Pfdr <0,05) между группой BD3526 и контрольной группой.

Продукты ферментации штамма BD3526 снижают воспалительную реакцию слизистой оболочки кишечника у крыс GK

Причины СД2 часто бывают сложными. Исследования показали, что начало СД2 коррелировало с хронически слабой воспалительной реакцией (Donath et al., 2003; Ehses et al., 2009; Мастерс и др., 2010; Westwellroper et al., 2011; Lerner et al., 2012; Ословски и др., 2012; Jourdan et al., 2013; WestwellRoper et al., 2014). Воспалительная реакция играет важную роль в возникновении и развитии диабета. Другое исследование показало, что A. muciniphila может увеличивать толщину кишечной слизи и уменьшать воспалительный ответ (Wu et al., 2017).

Как упоминалось выше, мы обнаружили, что продукты ферментации штамма BD3526 значительно увеличили A.muciniphila у крыс GK и уменьшил роды в кишечной микробиоте, тесно связанные с заболеваниями, по данным анализа KEGG. Таким образом, мы предположили, что продукты ферментации штамма BD3526 могут снижать воспалительные факторы слизистой оболочки кишечника за счет увеличения содержания A. muciniphila и, в конечном итоге, играть роль в снижении уровня глюкозы в крови. Принимая это предположение, мы расширили нашу работу на воспалительные факторы в слизистой оболочке кишечника в группе BD3526 и контрольной группе, используя набор крысиных цитокиновых антител (Abcam, ab133992).После периода вымывания в течение 5 недель анализировали цитокины, экспрессируемые в слизи толстого кишечника крыс в группе BD3526 и в контрольной группе. Набор может одновременно обнаруживать 34 цитокина в одном массиве. В слизи толстого кишечника крыс контрольной группы 32 цитокина, включая воспалительные факторы (IL-1β, IL-6, MCP-1 и TNF-α) и другие онкогенные факторы, были экспрессированы на высоком уровне в GK. крыс, тогда как лиганд Neg и Fas вряд ли можно было обнаружить (Фигуры 6A, B).Среди 32 цитокинов, в большей степени экспрессируемых, онкогенный фактор Агрин (пятна A6 и B6 на карте массива) был значительно обогащен у крыс GK. В другом 31 цитокине IL-1β (пятна C7 и D7 на карте массива) рассматривается как цитокин, который активирует несколько иммунных клеток и способствует устойчивости к инсулину (Dinarello, 2009). IFN-γ (пятна C5 и D5 на карте массива), как сообщается, является медиатором в регуляции метаболизма глюкозы с помощью A. muciniphila (Greer et al., 2016). Подтверждено, что IL-6 (пятна C11 и D11 на карте массива) является промотором гибели островковых β-клеток, которая приводит к T2DM (Donath, 2013).Соответственно, экспрессия цитокинов в группе BD3526 в целом была снижена (Фигуры 6A, B). Для дальнейшей полуколичественной оценки экспрессии воспалительных факторов мы использовали программное обеспечение ImageJ для выполнения анализа серой шкалы на двух изображениях. Результаты показали, что интенсивность положительных контролей в левом верхнем и правом нижнем углу одинакова в двух массивах. Однако единственный экспрессируемый ген Agrin в группе BD3526 уменьшился примерно на 50% по сравнению с контрольной группой (Рисунок 6C).Этот результат означал, что продукты ферментации штамма BD3526 могут снижать уровень экспрессии большинства цитокинов в слизи толстого кишечника, таких как IL-1β, IFN-γ и IL-6, и, таким образом, снижать уровень глюкозы в крови у крыс GK.

Рисунок 6. Обнаружение цитокинов слизистой оболочки кишечника. (A) Обнаружены цитокины контрольной группы и группы BD3526. (B) В мембране все пятна перечислены в таблице ниже. Помимо всех 34 цитокинов, положительными контролями были A1, A2, B1, B2, G12 и h22.G3-G11 и h4-h21 были отрицательными контролями. (C) Цитокины были полуколичественно проанализированы с использованием программного обеспечения ImageJ ( ∗∗ P -значение <0,01, среднее ± SEM).

Обсуждение

Микробиота кишечника широко участвует в развитии различных заболеваний, и изменение микробиоты кишечника путем приема некоторых специфических микробных добавок было принято для лечения различных заболеваний. Эти заболевания включают аутизм, болезнь Паркинсона и рак (Hsiao et al., 2013; Buffington et al., 2016; Thaiss et al., 2016; Yu et al., 2017; Чунг и др., 2018; Dejea et al., 2018; Routy et al., 2018; Тилг и др., 2018). При исследовании кишечной микробиоты и диабета разнообразие и состав кишечной микробиоты пациентов значительно изменились по сравнению со здоровыми людьми (Cani et al., 2008; Larsen et al., 2010; Musso et al., 2010; Qin et al. ., 2012). В нескольких интервенционных экспериментах было обнаружено, что метформин увеличивает содержание A. muciniphila и других микроорганизмов, продуцирующих короткоцепочечные жирные кислоты, в кишечнике пациентов с диабетом (Shin et al., 2014; де ла Куэста-Сулуага и др., 2017; Wu et al., 2017; Wang et al., 2018). Метформин также оказывает сильное влияние на взаимодействие микроорганизмов в кишечной микробиоте. В этой работе, когда крысам GK вводили продукты ферментации штамма BD3526, содержание A. muciniphila в кишечнике значительно увеличивалось по сравнению с контрольной группой. Аналогичным образом, A. muciniphila показало увеличение после лечения метформином у пациентов с СД2 (Shin et al., 2014; de la Cuesta-Zuluaga et al., 2017). Этот результат указывает на то, что метформин и продукты ферментации штамма BD3526 могут вести себя аналогичным образом в облегчении симптомов диабета. Однако введение метформина увеличивает не только содержание A. muciniphila , но и содержание других микроорганизмов, продуцирующих SCFAs, в кишечнике, например, Butyrivibrio , Bifidobacterium bifidum и Megasphaera (de la Cuesta- Zuluaga et al., 2017), которые обеспечивают рациональное объяснение более высоких уровней SCFAs, обнаруживаемых в стуле клинических пациентов, принимающих метформин (Wu et al., 2017). Также было продемонстрировано, что большое количество пищевых волокон способствует росту некоторых пробиотиков в кишечнике, стимулирует выработку SCFA и облегчает симптомы диабета (Zhao et al., 2018). Тем не менее, крысы GK, получавшие продукты ферментации штамма BD3526, не демонстрировали подобного явления, то есть количество микроорганизмов, продуцирующих SCFAs, в группе BD3526 не увеличивалось полностью. Таким образом, можно предположить, что как A. muciniphila , так и микроорганизмы, продуцирующие SCFAs, важны для регуляции уровня глюкозы в крови и ведут себя по-разному.

Akkermansia muciniphila представляет собой анаэробную бактерию, прикрепленную к слизистой оболочке кишечника (Derrien et al., 2004, 2008; Collado et al., 2007; van Passel et al., 2011), и более низкий уровень — A. muciniphila сообщалось о пациентах с ожирением и СД2 по сравнению с нормальными. Кроме того, A. muciniphila может также увеличивать реакцию пациента на лекарства за счет увеличения набора CCR9 + CXCR3 + CD4 + Т-лимфоцитов во время иммунотерапии пациентов с опухолями с PD-1 / PD-L1 и увеличивают выживаемость без прогрессирования (ВБП) пациентов после лечения (Routy et al., 2018). Хотя молекулярный механизм, с помощью которого A. muciniphila улучшает диабет / ожирение, полностью не изучен, широко распространено мнение, что эта бактерия может играть положительную роль в укреплении здоровья, повышая целостность слизистой оболочки кишечника (Derrien et al., 2004 , 2008; Collado et al., 2007).

При СД2, хотя прямой причины синдрома недостаточно для инсулина, секретируемого β-клетками поджелудочной железы, внутренней причиной является воспалительная реакция (Cuman et al., 2001; Naguib et al., 2004). Хронически низкий уровень воспалительных реакций не только вызывает атаку β-клеток поджелудочной железы, но также снижает чувствительность печени и мышц к инсулину, что приводит к инсулинорезистентности (Cerasi, 1995; Kahn, 1998; Bonner-Weir, 2000; Kahn et al. др., 2006). Еще менее оптимистично то, что воспалительная реакция не только вызывает диабет, но также показывает корреляцию между T2DM, инсулинорезистентностью, сердечно-сосудистыми заболеваниями и ожирением (Donath, 2013). Таким образом, уменьшение воспаления является важной стратегией лечения диабета.В нашей работе мы обнаружили, что продукты ферментации штамма BD3526 могут снижать экспрессию воспалительных факторов слизистой оболочки кишечника у крыс GK, а также уровень HaB1c и глюкозы в крови.

В данной работе мы использовали штамм BD3526, выделенный из молока тибетского яка, для ферментации обезжиренного молока (Hang et al., 2016). Хотя наше понимание этого штамма не является исчерпывающим, он уже продемонстрировал некоторый потенциал в укреплении здоровья, например, секретирование противомикробных агентов и левана, который является признанным диетическим волокном (Xu et al., 2016). Поскольку эти продукты ферментации могут облегчить симптомы СД2 и избирательно стимулировать размножение A. muciniphila в кишечнике, мы полагаем, что биологическая функция P. bovis sp. ноя BD3526 может не ограничиваться лечением диабета. Поскольку только метаболиты P. bovis sp. ноя В этой работе используются BD3526 в обезжиренном молоке, влияние самой бактерии на кишечник до сих пор неизвестно и заслуживает дальнейшего изучения.

Авторские взносы

ZQ, JH, ZW и ZL разработали и разработали эксперименты. JH, HF, MY, CG, JW и CY проводили эксперименты. ZQ, HZ, CG и CY проанализировали данные. ZQ и JH написали рукопись. Все авторы прочитали и одобрили окончательный вариант рукописи.

Финансирование

Этот проект спонсировался Шанхайским инженерным центром биотехнологии молочной промышленности (16DZ2280600) и Шанхайской программой восходящих звезд (18QB1400100).

Заявление о конфликте интересов

ZQ, JH, HF, CG, JW, CY, ZL и ZW были наняты компанией Bright Dairy & Food Co., ООО

Остальные авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы хотели бы поблагодарить Huifang An из Sinotech Genome Technology Co., Ltd. за анализ данных секвенирования 16S рРНК для этой работы.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fmicb.2018.03292/full#supplementary-material

Сноски

  1. http://drive5.com/uparse/
  2. http://www.mothur.org/wiki/Schloss_SOP#Alpha_diversity
  3. http://networkx.github.io

Список литературы

Андре-Шмутц, И., Хинделанг, К., Бенуа, К., и Матис, Д. (2010). Клеточные и молекулярные изменения, сопровождающие прогрессирование инсулита в диабет. евро.J. Immunol. 29, 245–255. DOI: 10.1002 / (SICI) 1521-4141 (199901) 29:01 <245 :: AID-IMMU245> 3.0.CO; 2-O

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Боннер-Вейр, С. (2000). Рост и развитие островков у взрослого человека. J. Mol. Эндокринол. 24, 297–302. DOI: 10.1677 / jme.0.0240297

CrossRef Полный текст | Google Scholar

Баффингтон, С., Диприско, Г. В., Рочтунг, Т., Аджами, Н., Петросино, Дж., И Коста-Маттиоли, М. (2016).Восстановление микробов устраняет вызванные материнской диетой социальные и синаптические дефициты у потомства. Cell 165, 1762–1775. DOI: 10.1016 / j.cell.2016.06.001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Cani, P. D., Bibiloni, R., Knauf, C., Waget, A., Neyrinck, A. M., Delzenne, N. M., et al. (2008). Изменения в микробиоте кишечника контролируют воспаление, вызванное метаболической эндотоксемией, у мышей с ожирением и диабетом, вызванным диетой с высоким содержанием жиров. Диабет 57, 1470–1481.DOI: 10.2337 / db07-1403

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чанг, Л., Орберг, Э. Т., Гейс, А. Л., Чан, Дж. Л., Фу, К., Дестефано, К. С. и др. (2018). Bacteroides fragilis токсин координирует проканцерогенный воспалительный каскад, воздействуя на эпителиальные клетки толстой кишки. Cell Host Microbe 23, 203.e5–214.e5. DOI: 10.1016 / j.chom.2018.01.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Колладо, М.К., Дерриен, М., Изолаури, Э., де Вос, В. М. и Салминен, С. (2007). Целостность кишечника и Akkermansia muciniphila , разлагающий муцин член кишечной микробиоты, присутствующий у младенцев, взрослых и пожилых людей. заявл. Environ. Microbiol. 73, 7767–7770. DOI: 10.1128 / AEM.01477-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кофлин, С. С., Калле, Э. Э., Терас, Л. Р., Петрелли, Дж., И Тун, М. Дж. (2004). Сахарный диабет как предиктор смертности от рака в большой когорте взрослого населения США. г. J. Epidemiol. 159, 1160–1167. DOI: 10.1093 / AJE / kwh261

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Куман, Р. К., Берсани-Амадо, К. А., и Фортес, З. Б. (2001). Влияние диабета 2 типа на воспалительную реакцию у крыс. Inflamm. Res. 50, 460–465. DOI: 10.1007 / PL00000271

PubMed Аннотация | CrossRef Полный текст | Google Scholar

де ла Куэста-Сулуага, Дж., Мюллер, Н. Т., Корралес-Агудело, В., Веласкес-Меджиа, Э.П., Кармона, Дж. А., Абад, Дж. М. и др. (2017). Метформин связан с более высоким относительным содержанием муцин-разлагающих Akkermansia muciniphila и нескольких микробиоты, продуцирующей короткоцепочечные жирные кислоты, в кишечнике. Уход за диабетом 40, 54–62. DOI: 10.2337 / DC16-1324

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Dejea, C. M., Fathi, P., Craig, J. M., Boleij, A., Taddese, R., Geis, A. L., et al. (2018). Пациенты с семейным аденоматозным полипозом содержат биопленки толстой кишки, содержащие онкогенные бактерии. Наука 359, 592–597. DOI: 10.1126 / science.aah4648

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дерриен, М., Колладо, М. К., Бенамор, К., Салминен, С., и де Вос, В. М. (2008). Деградатор муцина Akkermansia muciniphila широко распространен в кишечном тракте человека. заявл. Environ. Microbiol. 74, 1646–1648. DOI: 10.1128 / AEM.01226-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дерриен, М., Воган, Э. Э., Плугге, К. М., и де Вос, В. М. (2004). Akkermansia muciniphila gen. nov., sp. nov., кишечная бактерия, разлагающая муцин человека. Внутр. J. Syst. Evol. Microbiol. 54, 1469–1476. DOI: 10.1099 / ijs.0.02873-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Динарелло, К. А. (2009). Иммунологические и воспалительные функции семейства интерлейкинов-1. Annu. Rev. Immunol. 27, 519–550. DOI: 10.1146 / annurev.immunol.021908.132612

CrossRef Полный текст | Google Scholar

Донат М. Ю., Стёрлинг Дж., Мэдлер К. и Мандруппулсен Т. (2003). Медиаторы воспаления и недостаточность бета-клеток островков: связь между диабетом 1 и 2 типа. J. Mol. Med. 81, 455–470. DOI: 10.1007 / s00109-003-0450-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эзес, Дж. А., Эллингсгаард, Х., Бёншнетцлер, М., и Донат, М. Ю. (2009). Воспаление островков поджелудочной железы при диабете 2 типа: от компенсации альфа- и бета-клеток до дисфункции. Arch. Int. Physiol. 115, 240–247. DOI: 10.1080 / 13813450

5879

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эверард, А., Белцер, К., Геуртс, Л., Оуверкерк, Дж. П., Друарт, К., Биндельс, Л. Б. и др. (2013). Перекрестное взаимодействие между Akkermansia muciniphila и кишечным эпителием контролирует ожирение, вызванное диетой. Proc. Natl. Акад. Sci. США 110, 9066–9071. DOI: 10.1073 / pnas.1219451110

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Форслунд, К., Hildebrand, F., Nielsen, T., Falony, G., Le, C.E., Sunagawa, S., et al. (2017). Выявление противоречий между диабетом 2 типа и метформином в микробиоте кишечника человека. Природа 545: 116. DOI: 10.1038 / природа22318

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Грир, Р. Л., Донг, X., Мораес, А. К. Ф., Зильке, Р. А., Фернандес, Г. Р., Перемыслова, Э. и др. (2016). Akkermansia muciniphila опосредует отрицательные эффекты IFNγ на метаболизм глюкозы. Нац. Commun. 7: 13329. DOI: 10.1038 / ncomms13329

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hang, F., Liu, P., Wang, Q., Han, J., Wu, Z., Gao, C., et al. (2016). Высокая активность свертывания молока, выраженная недавно выделенными Paenibacillus spp. Штамм BD3526. Молекулы 21:73. DOI: 10.3390 / молекулы21010073

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сяо, Э. Ю., Макбрайд, С. В., Сянь, С., Шэрон, Г., Хайд, Э. Р., МакКью, Т. и др. (2013). Микробиота модулирует поведенческие и физиологические аномалии, связанные с нарушениями развития нервной системы. Cell 155, 1451–1463. DOI: 10.1016 / j.cell.2013.11.024

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Jourdan, T., Godlewski, G., Cinar, R., Bertola, A., Szanda, G., Liu, J., et al. (2013). Активация воспаления Nlrp3 при инфильтрации макрофагов эндоканнабиноидами опосредует потерю бета-клеток при диабете 2 типа. Нац. Med. 19, 1132–1140. DOI: 10,1038 / нм 3265

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кан, Б. Б. (1998). Диабет 2 типа: когда секреция инсулина не может компенсировать инсулинорезистентность. Cell 92, 593–596. DOI: 10.1016 / S0092-8674 (00) 81125-3

CrossRef Полный текст | Google Scholar

Карлссон, Ф. Х., Тремароли, В., Нукау, И., Бергстрем, Г., Бер, К. Дж., Фагерберг, Б., и др. (2013). Метагеном кишечника у европейских женщин с нормальным, нарушенным и диабетическим контролем уровня глюкозы. Природа 498, 99–103. DOI: 10.1038 / природа12198

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ларсен, Н., Фогенсен, Ф. К., Фв, В. Д. Б., Нильсен, Д. С., Андреасен, А. С., Педерсен, Б. К. и др. (2010). Микробиота кишечника взрослых людей с диабетом 2 типа отличается от взрослых людей, не страдающих диабетом. PLoS One 5: e0009085. DOI: 10.1371 / journal.pone.0009085

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лернер, А.Г., Аптон, Дж. П., Правин, П. В., Гош, Р., Накагава, Ю., Игбариа, А. и др. (2012). IRE1α индуцирует взаимодействующий с тиоредоксином белок, чтобы активировать инфламмасому NLRP3 и способствовать запрограммированной гибели клеток во время стресса эндоплазматического ретикулума. Cell Metab. 16, 250–264. DOI: 10.1016 / j.cmet.2012.07.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мастерс, С. Л., Данн, А., Субраманиан, С. Л., Халл, Р. Л., Таннахилл, Г. М., Шарп, Ф. А. и др. (2010).Активация инфламмасомы Nlrp3 островковым амилоидным полипептидом обеспечивает механизм повышения уровня IL-1β при диабете 2 типа. Нац. Иммунол. 11, 897–904. DOI: 10.1038 / ni.1935

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нагиб, Г., Аль-Машат, Х., Деста, Т., и Грейвс, Д. Т. (2004). Диабет продлевает воспалительный ответ на бактериальный стимул за счет дисрегуляции цитокинов. J. Invest. Дерматол. 123, 87–92. DOI: 10.1111 / j.0022-202X.2004.22711.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ословски, К. М., Хара, Т., О’Салливанмерфи, Б., Канекура, К., Лу, С., Хара, М., и др. (2012). Белок, взаимодействующий с тиоредоксином, опосредует индуцированную стрессом ER гибель β-клеток через инициирование инфламмасомы. Cell Metab. 16, 265–273. DOI: 10.1016 / j.cmet.2012.07.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Цинь, Дж., Ли, Ю., Цай, З., Ли, С., Чжу, Дж., Zhang, F., et al. (2012). Метагеномное ассоциативное исследование микробиоты кишечника при диабете 2 типа. Природа 490, 55–60. DOI: 10.1038 / природа11450

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Роттер В., Нагаев И. и Смит У. (2002). Интерлейкин-6 (IL-6) снижает экспрессию генов и белков IRS-1 и GLUT4 и сверхэкспрессируется в человеческих жировых клетках инсулинорезистентных субъектов. Диабет 51: A303.

Google Scholar

Роути, Б., Le, C.E., Derosa, L., Cpm, D., Alou, M.T., Daillére, R., et al. (2018). Микробиом кишечника влияет на эффективность иммунотерапии на основе PD-1 против эпителиальных опухолей. Наука 359, 91–97. DOI: 10.1126 / science.aan3706

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шин Н. Р., Ли, Дж. К., Ли, Х. Ю., Ким, М. С., Уон, Т. В., Ли, М. С. и др. (2014). Увеличение численности Akkermansia spp. Популяция, индуцированная лечением метформином, улучшает гомеостаз глюкозы у мышей с ожирением, вызванным диетой. Кишечник 63, 727–735. DOI: 10.1136 / gutjnl-2012-303839

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Стерн, М. П. (1995). Диабет и сердечно-сосудистые заболевания. Гипотеза «общей почвы». Диабет 44, 369–374. DOI: 10.2337 / diab.44.4.369

CrossRef Полный текст | Google Scholar

Thaiss, C.A., Levy, M., Korem, T., Dohnalova, L., Shapiro, H., Jaitin, D.A., et al. (2016). В программах суточной ритмичности микробиоты происходят колебания транскриптома. Ячейка 167, 1495.e12–1510.e12. DOI: 10.1016 / j.cell.2016.11.003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

van Passel, M. W., Kant, R., Zoetendal, E. G., Plugge, C. M., Derrien, M., Malfatti, S.A., et al. (2011). Геном Akkermansia muciniphila , специального расщепителя кишечного муцина, и его использование для исследования кишечных метагеномов. PLoS One 6: e16876. DOI: 10.1371 / journal.pone.0016876

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ван, З., Saha, S., Horn, S. V., Thomas, E., Traini, C., Sathe, G., et al. (2018). Различия в микробиоме кишечника у пациентов с СД2, принимающих метформин и лираглутид. Эндокринол. Диабет Метаб. 1: e00009. DOI: 10.1002 / edm2.9

CrossRef Полный текст | Google Scholar

Westwellroper, C., Dai, D. L., Soukhatcheva, G., Potter, K. J., Van, R. N., Ehses, J. A., et al. (2011). Блокада IL-1 ослабляет индуцированное островковым амилоидным полипептидом высвобождение провоспалительных цитокинов и дисфункцию трансплантата островков поджелудочной железы. J. Immunol. 187, 2755–2765. DOI: 10.4049 / jimmunol.1002854

PubMed Аннотация | CrossRef Полный текст | Google Scholar

WestwellRoper, C. Y., Ehses, J. A., and Verchere, C. B. (2014). Резидентные макрофаги опосредуют индуцированную островковым амилоидным полипептидом продукцию IL-1β и дисфункцию β-клеток. Диабет 63, 1698–1711. DOI: 10.2337 / db13-0863

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Wu, H., Esteve, E., Tremaroli, V., Хан, М. Т., Цезарь, Р., Маннерос-Холм, Л. и др. (2017). Метформин изменяет микробиом кишечника людей с диабетом 2 типа, не получавшим лечения, что способствует терапевтическому эффекту препарата. Нац. Med. 23, 850–858. DOI: 10,1038 / нм. 4345

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Xu, X., Gao, C., Liu, Z., Wu, J., Han, J., Yan, M., et al. (2016). Характеристика левана, продуцируемого Paenibacillus bovis sp. nov BD3526 и его иммунологическая активность. Carbohydr. Polym. 144, 178–186. DOI: 10.1016 / j.carbpol.2016.02.049

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Yu, T. C., Guo, F., Yu, Y., Sun, T., Ma, D., Han, J., et al. (2017). Fusobacterium nucleatum способствует химической устойчивости к колоректальному раку, модулируя аутофагию. Ячейка 170, 548.e16–563.e16. DOI: 10.1016 / j.cell.2017.07.008

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чжан, X., Zhao, Y., Xu, J., Xue, Z., Zhang, M., Pang, X., et al. (2015). Модуляция кишечной микробиоты берберином и метформином во время лечения ожирения у крыс, вызванного диетой с высоким содержанием жиров. Sci. Реп. 5: 14405. DOI: 10.1038 / srep14405

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Zhao, L., Zhang, F., Ding, X., Wu, G., Lam, Y. Y., Wang, X., et al. (2018). Кишечные бактерии, избирательно продуцируемые пищевыми волокнами, облегчают диабет 2 типа. Наука 359, 1151–1156.DOI: 10.1126 / science.aao5774

PubMed Аннотация | CrossRef Полный текст | Google Scholar

.
Полная блокада пнпг что это: Блокада ножек пучка Гиса — ПроМедицина Уфа

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *