
Нодулярный дерматит крупного рогатого скота

Нодулярный дерматит крупного рогатого скота (кожная бугорчатка, кожно-узелковая сыпь, узелковая экзантема) — инфекционная болезнь крупного рогатого скота, сопровождающаяся лихорадкой, отеком подкожной соединительной ткани и органов, образованием кожных узлов, поражением глаз, слизистой оболочки дыхательного и пищеварительного трактов.

Вирус нодулярного дерматита крупного рогатого скота обладает выраженным тропизмом к эпителиальным клеткам кожи, слизистой оболочки органов дыхания и пищеварения. Воротами инфекции являются: кожа, слизистые оболочки органов дыхания и пищеварения, конъюнктива глаз, из которых вирус переносится по лимфатическим сосудам в лимфатические узлы, там размножается и с током крови разносится по организму, вызывая специфические узелковые поражения. Вирусемия длиться в течение 1–2 недель, при этом происходит выделение вируса во внешнюю среду с выдыхаемым воздухом, слюной, спермой, молоком, истечениями из носа и глаз, экссудатами, а также при поражениях кожи и слизистых оболочек.

Источником инфекции являются больные животные, переболевшие и скрытие носители. Распространение вируса происходит при перемещении больных животных.

Для профилактики вируса нодулярного дерматита проводят иммунизацию крупного рогатого скота с применением вакцин. Иммунитет длится 1 год.

В 2015 году вирус нодулярного дерматита крупного рогатого скота впервые зарегистрирован на территории России!

В 2016 году на территории России зарегистрирована 251 вспышка нодулярного дерматита крупного рогатого скота!

Неблагополучие фиксировали в десяти регионах Северо-Кавказского и Южного Федеральных округов, в том числе Республике Дагестан, Республике Калмыкия, Краснодарском крае, Астраханской области, Чеченской Республике, Ставропольском крае, Волгоградской области, Республике Ингушетия, Ростовской области, Карачаево-Черкесской республике.

В связи с угрозой широкого распространения по территории России нового вируса, в целях сохранения эпизоотического благополучия территории Санкт‑Петербурга по данной болезни лицам, осуществляющим содержание крупного рогатого скота на территории города, необходимо выполнять комплекс следующих мероприятий:

  • при наличии и приобретении крупного рогатого скота производить его регистрацию в ветеринарных станциях тех районов Санкт‑Петербурга, где осуществляется содержание животных;
  • при приобретении и ввозе в Санкт‑Петербург поголовья крупного рогатого скота из других регионов России согласовывать перевозку животных с государственной ветеринарной службой Санкт‑Петербурга;
  • осуществлять перевозку крупного рогатого скота только при наличии ветеринарных сопроводительных документов;
  • всех вновь поступивших животных содержать изолированно в течение 30 дней
    , выполнять требования специалистов государственной ветеринарной службы при проведении мероприятий по карантинированию животных;
  • своевременно информировать государственную ветеринарную службу обо всех случаях заболевания крупного рогатого скота, в том числе при подозрении на нодулярный дерматит (телефоны: 527-50-43, 527-09-46, 717-52-10).

Общая информация

Нодулярный дерматит — это вирусная высоконтагиозная эмерджентная трансграничная болезнь крупного рогатого скота, характеризующаяся лихорадкой, поражением лимфатической системы, отеками подкожной клетчатки, образованием кожных узлов (бугров), поражением глаз и слизистых оболочек органов дыхания и пищеварения.

«Кодексом здоровья наземных животных МЭБ 2015г» инкубационный период при нодулярном дерматите определен в 28 дней. При экспериментальном заражении животных инкубационный период составляет 6-10 дней. При первичных вспышках заболевает от 50 до 100% животных. Летальность от 10 до 45 %(обычно от 1 до 5%). Естественное выздоровление происходит в 90% случаев. Болезнь продолжается около 4 недель.

Восприимчивые животные — крупный рогатый скот:

  • Bos taurus,
  • Bos indicus.
  • Азиатские буйволы
  • Животные молочных пород более восприимчивы, чем мясной скот

История и нозоареал болезни

Впервые заболевание было обнаружено в Замбии в 1929 году, как аллергическая реакция на множественные укусы насекомых. 1943г – инфекционная болезнь. Длительное время основным нозоареалом были страны Африки. В конце второго тысячелетия были отмечены вспышки заболевания в странах Азии. В настоящее время НД эндемичен в Африке и на Ближнем Востоке. В 2014 году нодулярный дерматит регистрировался: Турция -230 очагов; Ливан -32 очагов; Азербайджан и Ирак – по 16 очагов; Иран и Египет – по 6 очагов. В 2015 году НД диагностировался в Греции и на Кипре.

Экономический ущерб

  • Резкое снижение молочной продуктивности;
  • Потеря живой массы;
  • Аборты и мертворождения;
  • Повреждение шкуры;
  • Бесплодие;
  • Гибель животных от секундарных инфекций;
  • Затраты на лечение и проведение ветеринарно-санитарных мероприятий.

Возбудителем нодулярного дерматита является:

  • ДНК содержащий оболочечный вирус, относящийся к группе Neethling рода Capripoxvirus семейства Poxviridae.
  • Род Capripoxvirus включает вирусы оспы овец и коз, а также нодулярного дерматита.
  • Вирус нодулярного дерматита антигенно родственный вирусам оспы овец и коз.

Источником возбудителя является больной КРС, ткани которого служат элективной средой для размножения вируса. Вирус способен выделятся из организма КРС в стадии реконвалесценции. Вирус выделяется с выдыхаемым воздухом, слюной, спермой, молоком, истечениями из носовой полости и глаз, эксудатами и пораженными участками кожи и слизистых.

Распространение вируса за пределы очага:

  • Зараженными животными находящимися в инкубационном периоде, активными продуцентами возбудителя, реже реконвалесцентами.
  • Пассивными (механическими) переносчиками вируса: контаминированные корма, вода, транспортные средства, насекомыми, клещами и воздушными потоками.
  • Гемоконтактный механизм заражения.
  • Обслуживающий персонал.

Сохраняемость вируса

Вирус нодулярного дерматита сохраняется в пораженных участках кожи и слизистых оболочках(до 39 дней),крови(5- 22 дней), молоке и сперме(до 42-60 дней), слюне(15-18 дней), истечениях из носа(12-21 дней) и глаз(15 дней) от инфицированных животных. Вирус сохраняется при 4 С в течение 6 месяцев. Вирус инактивируется при 55 С в течение 2 часов, а при 65 С в течение 30 минут. Возбудитель устойчив при рН 6,6- 8,6. Вирус инактивируется растворами 1% формалина, 2% фенола, 2-3% гипохлорида натрия, щелочи, биоцидов группы альдегидов, третичных аминов и хлорсодержащими препаратами

Воротами инфекции при нодулярном дерматите являются: кожа, слизистые оболочки органов дыхания, пищеварения и конъюнктивы глаз, из которых вирус переносится по лимфатическим сосудам в лимфатические узлы, там размножается и с током крови разносится по организму, вызывая специфические для болезни узелковые поражения.

Патологоанатомические изменения:

  • На коже, на поверхности и в толще мышц видны характерные узелки.
  • Лимфатические узлы отечны и сочны на разрезе.
  • На слизистых оболочках носовой полости, гортани и трахеи – язвы и эрозии.
  • Отек легких, узелки различного размера.
  • Воспаление слизистых оболочек ЖКТ.

Диагностика нодулярного дерматита

Диагностика НД базируется на результатах эпизоотологического обследования, данных клинического осмотра больных животных, выявленных патологоанатомических изменениях и результатах лабораторных исследований патологического материала. Диагноз на нодулярный дерматит счита ется установленым, если в пробах от больных или подозреваемых в заболевании животных обнаружен вирус нодулярного дерматита КРС или его антиген и геном. С этой целью используются ПЦР, ИФА, РСК(РДСК).

Мероприятия по предотвращению заноса вируса нодулярного дерматита:

  • Проводятся охранные меры по недопущению заноса (завоза) в хозяйство животных источников-возбудителя.
  • Периодическая обработка КРС репеллентами и инсектицидами.
  • В угрожаемой зоне и зоне наблюдается проводится активный и пассивный мониторинг.
  • Проводится обучение ветеринарных специалистов и владельцев животных по проблеме НД.

Подозрением на НД служат: данные эпизоотологического обследования стада; выявление у животных характерных для нодулярного дерматита клинических признаков и патологоанатомических изменений.

Обязанность владельцев животных: немедленно сообщить ветеринарному специалисту о подозрении; изолировать больных, подозреваемых и контактировавших животных; прекратить все передвижения и перегруппировки КРС; исключить возможность контакта персонала, обслуживающего больных и подозреваемых животных с другими животными. Исключить вынос вируса с транспортом.

Обязанности государственного ветеринарного специалиста муниципального района:

  • в течение дня выехать на территорию предполагаемого очага;
  • провести эпизоотологическое обследование хозяйства и клинический осмотр животных, выяснить вероятные источники и пути заноса и распространения возбудителя НД;
  • организовать отбор проб патологического материала для отправки в диагностическую лабораторию;
  • немедленно сообщить о результатах обследования руководителю органа исполнительной власти субъекта в области ветеринарии и главе муниципального образования.

Руководитель исполнительной власти субъекта в области ветеринарии обязан:

  • после получения сообщения немедленно командировать уполномоченных должностных лиц госветслужбы для:
  • клинического осмотра животных и проведения эпизоотологического обследования предполагаемого очага инфекции;
  • отбора проб патматериала и уточнения вероятных источников и предполагаемое время заноса вируса НД уточнения границ предполагаемого очага и возможные пути распространения инфекции;
  • организации комплекса мероприятий по ликвидации очага НД.

Госветслужба субъекта и администрация муниципального образования обязаны:

  • довести информацию до населения о подозрении на НД; до владельцев животных о требованиях Правил по профилактике и борьбе с НД; до специалистов госветслужбы и глав администраций субъектов о предполагаемом очаге НД.
  • Организовать: проведение дезинсекции, дезинфекции, дезакаризации и дератизации в помещениях(территория), где содержаться больные животные.
  • Провести обработку животных репеллентами.
  • Обеспечить охрану территории предполагаемого очага.

После получения лабораторного подтверждения диагноза на НД руководитель госветслужбы субъекта в течение 24 часов направляет Руководителю администрации субъекта представление об установлении ограничительных(карантин) и «План мероприятий по ликвидации очага нодулярного дерматита…».

По условиям карантина в очаге запрещены:

  • все перемещения животных;
  • посещение хозяйства посторонними;
  • убой животных и реализацию продуктов убоя;
  • выезд автотранспорта без дезинфекции;
  • при возникновении первых случаев заболевания НД в стаде проводят изъятие больных и непосредственно контактировавших животных, которых под контролем специалистов госветслужбы подвергают убою бескровным методом. Трупы павших и убитых животных, остатки кормов и подстилку уничтожают в пределах неблагополучного пункта;
  • Молоко, полученное от животных в очаге перерабатывают на месте или обеззараживают пастеризацией при 85 С в течение 30 минут или кипячением в течение не менее 5 мин.
  • В очаге проводят трехкратную дезинфекцию зарегистрированными для этих целей в РФ химическими веществами;
  • Оставшиеся в очаге корма сжигают или утилизируют другими методами;
  • Навоз обрабатывают дезинфицирующими средствами и проводят буртование на территории фермы(хозяйства).Бурт подвергают наружной дезинфекции.
  • Мойку и дезинфекцию транспортных средств, находящихся в очаге проводят на специально отведенном месте с использованием средств обеспечивающих инактивацию вируса НД.
  • Верхнюю одежду, спецодежду и резиновую обувь обеззараживают парами формальдегида в пароформалиновой камере.

Лечение больных животных

Средств специфической терапии при НД не существует. Для предотвращения осложнений по причине секундарных инфекций может применятся антибиотикотерапия или химиотерапия.

Мероприятия в угрожаемой зоне (3км):

  • в угрожаемой зоне запрещено перемещение животных;
  • проводят ежедневно проводят клинический осмотр КРС и обработка репелентами для отпугивания насекомых.
  • всех восприимчивых животных подвергают иммунизации гомологичной (из вируса нодулярного дерматита) или гетерологичной вакциной из вируса оспы овец в соответствии с инструкциями по их применению.

Меры в зоне наблюдения (10 км):

  • В зоне наблюдения проводится ежедневный клинический осмотр стад КРС, дезинсекция и обработка животных репелентами.

Отмена карантина

  • карантин с неблагополучного по нодулярному дерматиту крупного рогатого скота хозяйства снимается через 30 дней после выздоровления последнего животного в эпизоотическом очаге и проведения других мероприятий по уничтожению вируса НД;
  • после снятия карантина запрещается вывозить КРС за пределы бывшего неблагополучного пункта, кроме поставок для убоя на мясокомбинат;
  • на территории бывшего неблагополучного пункта в течение года за 1 месяц до начала лета насекомых. проводят поголовную вакцинацию КРС гомологичным или гетерологичным препаратами.

Для борьбы с нодулярным дерматитом используют аттенуированные штаммы каприпоксвируса в том числе: штамм вируса нодулярного дерматита (гомологичный) и штаммы вируса оспы овец и коз.

Все штаммы каприпоксвируса, которые используются в качестве вакцины, могут продуцировать сильную реакцию в месте инокуляции. Рекомендуемая прививная доза из гомологичного вируса -2,5lg 50/cm3. Рекомендуемая прививная доза гетерологичной вакцины из вируса оспы овец и коз – 3,5lg 50/cm3/. При плановой вакцинации первую иммунизацию проводят 3 месячного молодняка. Ревакцинацию проводят через 12 месяцев. В неблагополучном пункте и в хозяйствах угрожаемой зоны вакцинируют животных всех здоровых животных, независимо от срока предыдущей иммунизации. Молодняк в возрасте до 6 месяцев прививают двукратно с интервалом в 14 суток.

Нодулярный дерматит

1 Антибиотикотерапия (препараты на выбор в соответствии с чувствительностью выделенной микрофлоры) — проводится с целью профилактики и лечения осложнений, вызванных секундарной микрофлорой Азитронит 1, 2, 9, 10 дни в/м, 1 мл/20 кг м.ж.
Нитокс Форте 1,6,11 дни в/м, 1 мл/10 кг м.ж.
Цефтонит Форте1 1, 8 дни п/к, 1мл/30 кг м.ж.
Нитокс 200 1, 4, 7, 10 дни в/м, 1 мл/10 кг м.ж.
2 Симптоматическая терапия (в случае повышения температуры выше физиологической нормы) Кетопрофен 10% в/м, в/в, 3 мл/100 кг м.ж., 1 раз в сутки 1-3 дня. Применять со всеми антибиотиками, в случае применения Нитокс Форте препарат Кетопрофен 10% применяют на 2-ые сутки
Флунекс в/м или в/в, 2 мл/45 кг м.ж., 3-5 дней подряд, затем перерыв 5 дней и курс можно повторить. Применять со всеми антибиотиками, в случае применения Нитокс Форте, препарат Флунекс применяют на 2-е сутки после введения Нитокс Форте
3 Антисептик  (Местная обработка афт с целью воздействия на секундарную микрофлору и закрытие ворот инфекции) Септо-спрей
местная обработка афт   
4 Заместительная терапия и стимуляция обмена веществ Нитамин  1,30 дни в/м  или п/к  0,25 мл /10 кг м.ж., однократно
Бутофан  1,15 дни в/м  10-25 мл/гол
5 Дезинфекция помещений (с целью уничтожения возбудителя в окружающей среде)   ГАН 0,5% раствор (профилактика), 1% раствор (вынужденная дезинфекция)
Фулгард 0,15% раствор (профилактика), 0,3% раствор (вынужденная дезинфекция)
6 Дезинсекция (с целью уничтожения насекомых, которые являются переносчиками инфекции) Цифлунит 10 мл на животное наружно вдоль позвоночного столба, однократно       
Цифлунит-ON Дезинсекция помещений и прилегающих территорий согласно инструкции

Россельхознадзор / ООК / Нодулярный дерматит и Оспа овец и коз

1. Инструкция/меры борьбы и профилактики Приказ Минсельхоза России от 05.04.2017 N 166 «Об утверждении Ветеринарных правил осуществления профилактических, диагностических, лечебных, ограничительных и иных мероприятий, установления и отмены карантина и иных ограничений, направленных на предотвращение распространения и ликвидацию очагов заразного узелкового дерматита крупного рогатого скота« (Зарегистрировано в Минюсте России 07.06.2017 N 46974)
Постановление Правительства РФ от 26.05.2006 N 310 «Об отчуждении животных и изъятии продуктов животноводства при ликвидации очагов особо опасных болезней животных»
2. Ответственность «Кодекс Российской Федерации об административных правонарушениях» от 30.12.2001 N 195-ФЗ (ред. от 29.06.2015). В ЧАСТИ КАСАЮЩЕЙСЯ НАРУШЕНИЙ В ОБЛАСТИ ВЕТЕРИНАРИИ И ПРОТИВ ПОРЯДКА УПРАВЛЕНИЯ
«Уголовный кодекс Российской Федерации» от 13.06.1996 N 63-ФЗ (ред. от 08.06.2015) (с изм. и доп., вступ. в силу с 01.07.2015)
Права Федеральный закон от 26.12.2008 N 294-ФЗ (ред. от 01.05.2017) «О защите прав юридических лиц и индивидуальных предпринимателей при осуществлении государственного контроля (надзора) и муниципального контроля» (с изм. и доп., вступ. в силу с 01.07.2017)
3. Отчетность Приказ Минсельхоза РФ от 02.04.2008 N 189 (ред. от 27.09.2011) «О Регламенте предоставления информации в систему государственного информационного обеспечения в сфере сельского хозяйства» (Зарегистрировано в Минюсте РФ 18.04.2008 N 11557). В ЧАСТИ КАСАЮЩЕЙСЯ ОСОБООПАСНЫХ, ЗАРАЗНЫХ БОЛЕЗНЕЙ ЖИВОТНЫХ.
4. Диагностика Chapter 3.4.12 Lumpy skin disease (NB: Version adopted in May 2017)
5. Мониторинг Приказ Минсельхоза РФ от 14.04.2009 N 137 (ред. от 21.03.2011) «Об Административном регламенте исполнения Министерством сельского хозяйства Российской Федерации государственной функции организации проведения противоэпизоотических мероприятий» (Зарегистрировано в Минюсте РФ 15.07.2009 N 14353)
6. Международные требования Рекомендации по болезням списка МЭБ и другим важным для международной торговли болезням.
Том II. Глава 11.9. Заразный узелковый дерматит


С сентября 2015 года на территории Российской Федерации зарегистрирован нодулярный дерматит среди поголовья крупного рогатого скота, ранее указанная заразная болезнь жвачных в России не выявлялась.

Приказом Минсельхоза от 20.07.2016 № 317 внесены изменения в Перечень заразных, в том числе особо опасных, болезней животных, по которым могут устанавливаться ограничительные мероприятия (карантин), утвержденный приказом Минсельхоза России от 19.12.2011 № 476 – указанный перечень дополнен пунктом 29.1. Заразный узелковый дерматит крупного рогатого скота.

Нодулярный дерматит крупного рогатого скота (кожная бугорчатка, узелковая экзантема, заразный узелковый дерматит, Dermatitis nodulares, Lumpy skin disease) — контагиозная инфекционная болезнь, характеризующаяся персистентной лихорадкой, поражением лимфатической системы, отеками подкожной клетчатки и внутренних органов, образованием кожных узлов (бугорков), поражением глаз и слизистых оболочек органов дыхания и пищеварения. Наряду с крупным рогатым скотом нодулярным дерматитом болеют и другие животные в том числе: жирафы, импалы, овцы и козы. Имеются отдельные сообщения об изучении чувствительности некоторых диких жвачных животных к вирусу нодулярного дерматита. Человек к вирусу нодулярного дерматита не восприимчив.

Источником инфекции являются больные и латентно переболевшие животные. Вирус выделяется с выдыхаемым воздухом, слюной, истечениями из носа, рта и глаз, через пораженные кожные покровы, спермой и молоком.

Одним из основных путей распространения вируса является механический перенос членистоногими различных видов (клещами, москитами, мухами и др.), в том числе и кровососущими. Вирус заразного узелкового дерматита от больных животных может передаваться путем прямых и непрямых контактов. Заражение животных возможно через инфицированные корма, воду, воздух, а также через инфицированные молоко и сперму.

Клинические признаки: инкубационный период при заразном узелковом дерматите крупного рогатого скота составляет 28 дней. При острой форме заразного узелкового дерматита крупного рогатого скота в течение недели после заражения у крупного рогатого скота отмечают повышение температуры тела до 41 С, на 7-12 дни в области средней трети шеи, плеч, конечностей, живота, промежности, паха, мошонки, морды, молочной железы и вокруг глаз выявляются узелки диаметром 2-5 см, которые в последующие 2 недели могут некротизироваться. Болезнь переходит в генерализованную форму, воспаление захватывает не только кожу, но и подкожную клетчатку, иногда и мышечную ткань. У больных животных отмечается длительная лихорадка, депрессия, снижение аппетита, учащенное дыхание, тахикардия, гиперемия слизистой в ротовой и носовой полостях. Водянистое истечение из глаз сменяется слизистым, с последующим образованием подсыхающих корочек. На веках появляются эрозии и изъязвления. Регистрируются конъюнктивиты, роговица мутнеет, что приводит к слепоте. У большинства больных животных из носовой полости выделяется сначала серозно-слизистый экссудат, а затем гнойная слизь зловонного запаха. При осложнениях вторичной микрофлорой в области подгрудка и путовых суставов развиваются отеки подкожной клетчатки. На отдельных участках тела происходит слияние узелков. Пораженные участки кожи болезненны. Региональные лимфоузлы могут увеличиваться, не вскрывшиеся узелки часто сохраняются в неизменном виде в течение года, а затем могут рассасываться. Выздоровление при тяжелой форме течения болезни протекает медленно из-за истощения животных, пневмонии, мастита, длительно не заживающих некротических кожных поражений, являющихся предпочтительным объектом нападения кровососущих членистоногих.

Больные животные теряют живую массу. У больных стельных коров регистрируются аборты, а у быков-производителей — временная импотенция или полное бесплодие. У переболевших коров и телок отмечается низкий уровень оплодотворяемости. Больные коровы не приходят в охоту. У больных коров снижается, а затем прекращается образование молока. Молоко, полученное от больных коров, часто приобретает розовый цвет, густой консистенции.

Болезнь чаще проявляется в период установления теплой влажной погоды, что связано с увеличением численности и распространенности в этот период года популяции переносчиков возбудителя. При первичных вспышках болезни может заболевать от 50-75% до 100% животных (особенно высокопродуктивных европейских пород). У 50% животных болезнь протекает типично. У тонкокожих пород крупного рогатого скота молочных заболевание протекает в более тяжелой форме. Летальность при заразном узелковом дерматите колеблется от 10 до 45%, но обычно составляет от 1 до 5%. Естественное выздоровление наступает в 90% случаев. Болезнь продолжается около 4 недель, а при осложнениях и дольше.

Профилактика и меры борьбы. Переболевшие животные иммунны к повторному заражению. Надлежащих средств специфической профилактики нет. Для иммунизации КРС против нодулярного дерматита, применяют 3 кенийских штамма вируса оспы овец Обычный вирус оспы овец иммунитета против нодулярного дерматита не дает. Для борьбы с нодулярным дерматитом в качестве вакцины используют как гомологичные живые аттенуированные вирусные вакцины из штамма Neethling, так и гетерологичные живые аттенуированные вирусные вакцины из штаммов каприпоксвирусов, полученных от овец и коз (Lumpy Skin Disease. Technical disease cards. World Organization for Animal Health (OIE)). Вакцину вводят подкожно; длительность иммунитета 1 года. Для недопущения заноса на территорию хозяйства данного заболевания, необходимо обеспечить работу санпропускников и пароформалиновых камер, въездных дезбарьеров. Обеспечить огораживание или оканавливание территорий ферм, обеспечить обслуживающий персонал спецодеж­дой и спец обувью. Регулярно проводить обработку восприимчивого поголовья против кровососущих насекомых.При появлении заболевания в ранее благополучных районах немедленно убивают всех заболевших и подозрительных по заболеванию животных и проводят тщательную дезинфекцию и дезинсекцию. Строго выполняют все правила ветеринарно-санитарных и карантинно-ограничительных мероприятий. В стационарно-неблагополучных районах больных и подозрительных по заболеванию животных тщательно изолируют, обеспечивают их полноценными витаминизированными кормами. Лечение симптоматическое.


1. Гуненков В.В. Заразный узелковый дерматит крупного рогатого скота // Сб. научных трудов ВГНКИ. -М., 2005. — Т. 66. — С. 46-54.

2. Еще раз о нодулярном дерматите / Вести республики. — 2016. — № 123 (2807). — URL: http://vesti95.ru/2016/06/eshhe-raz-o-nodulyarnom-dermatite/ (дата обращения: 14.07.16).

3. Нодулярный дерматит // Инфекционная патология животных / под ред. А.Я. Самуйленко, Б.В. Соловьева, Е.А. Непоклонова, Е.С. Воронина. — М.: Академкнига, 2006. — Т. 1. — С. 782-786.

4. Нодулярный дерматит крупного рогатого скота (обзор литературы) / О.А. Рябикина, В.И. Диев, М.С. Кукушкина // Актуальные вопросы ветеринарной вирусологии. — 2015. — № 4. — С. 45-52.

5. Проблема нодулярного дерматита крупного рогатого скота / А.В. Мищенко, В.А. Мищенко, В.Н. Шевкопляс [и др.] // Ветеринария Кубани. — 2015. — № 5. — С. 3-6.

6. В Греции уничтожены 200 голов скота из-за актиномикозного дерматита / Meatinfo. — URL: http://meatinfo.ru/news/v-gretsii-unichtogeni-200-golov-skota-iz-za-aktinomikoznogo-dermatita-349623 (дата обращения: 18.04.16).

7. Власти Болгарии усиливают меры профилактики нодулярного дерматита. — URL: http://www.focus-fen.net/news/2015/08/20/381191/bulgaria-authorities-stepping-up-preventive-measures-against-lumpy-skin-disease.html.

8. Внимание, нодулярный дерматит крупного рогатого скота! / ГБУ «Ветуправление Приморско-Ахтарского района». — URL: http://www.prahtarsk.ru/presscenter/announcement/vnimanie-nodulyarnyy-dermatit-krupnogo-rogatogo-skota-/?type=special (дата обращения: 14.07.16).

9. Не дружеский привет из Африки / Сетевое издание VOLGOGRAD.RU. — URL: http://www.volgogradru.com/news/common/2015/619728.news (дата обращения: 18.04.16).

10. Нодулярный дерматит крупного рогатого скота // Информационный портал «Пигинфо». — URL: http://piginfo.ru/news/ (дата обращения: 13.07.16).

11. Россельхознадзор озабочен распространением болезней рогатого скота в Европе // Информационное агентство «РАПСИ-ньюс». — URL: http://rapsinews.ru/incident_news/20160419/275892684. html#ixzz46ITavGPg (дата обращения: 19.04.16).

12. Случаи нодулярного дерматита больше не выявляются на территории страны // Эхо — общественнополитическая газета. — URL: http://www.echo.az/article.php?aid=77204 (дата обращения: 18.04.16).

13. Al-Sughair S. Viral disease threatens livestock in Al-Ahsa // Arab News. — 2 August 2015. — URL: http://www.arabnews.com/saudi-arabia/news/785321 (дата обращения: 18.04.16).

14. Coetzer J.A.W., Tuppurainen E. Lumpy skin disease // AfriVIP. — 2014. — URL: http://www.afrivip.org/education/livestock/high-impact/vector-borne-diseases/lumpy-skin/2014/materials (дата обращения: 21.11.14).

15. Emergence of lumpy skin disease in the Eastern Mediterranean Basin countries / S. Wainwright, A. El Idrissi, R. Mattioli [et al.] // EMPRES WATCH. — 2013. — Vol. 29. — URL: http://www.fao.org/docrep/019/aq706e/aq706e.pdf (дата обращения: 18.11.14).

16. Gale P., Roberts H. Lumpy skin disease in Greece. Preliminary outbreak assessment. — URL: https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/455707/poa-lumpy-skin-greece.pdf (дата обращения: 18.04.16).

17. Malawi: Over 280,000 livestock perish since December // Orange StarAfrica. — URL: http://en.starafrica.com/news/malawi-over-280000-livestock-perish-since-december.html (дата обращения: 18.04.16).

18. Roberts H. Lumpy skin disease in Turkey (European side) Preliminary outbreak assessment. — URL: https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/437163/poa-lumpy-skin-turkey-201506. pdf (дата обращения: 18.04.16).

19. Scientific Opinion on lumpy skin disease / EFSA AHAW Panel (EFSA Panel on Animal Health and Welfare) // EFSA J. — 2015. — Vol. 13 (1):3986; doi: 10.2903/j.efsa.2015.3986.

20. World Organization for Animal Health (OIE). -2012-2015. — URL: http://www.oie.int/ (дата обращения: 13.07.16).

Нодулярный дерматит

При несоблюдении санитарных норм содержания КРС возможно заражение животных разного рода инфекционными заболеваниями. Это, в свою очередь, приводит к падению продуктивности, падежу скота, а, следовательно, и к снижению рентабельности ферм. Болезней, поражающих именно КРС, существует множество. При этом одной из самых опасных является нодулярный дерматит.

Немного истории. Болезнь это относительно новая. Наши предки подобной проблемы с КРС не знали. Впервые нодулярный дерматит был зафиксирован в 1929 г. на Мадагаскаре и в Северной Родезии. В 1945 г. заражение скота зарегистрировали в Трансваале и Кении. В 1963 г. были инфицированы коровы в Румынии. Ныне эта болезнь в особенности распространена в Индии, а также в Южной и Восточной Африке.

Вирус в России и на территории бывшего СССР. В нашей стране впервые заболевшие нодулярным дерматитом животные были выявлены на территории Чечни в 2015 г., осенью. Совсем недавно, в начале июня 2016 г. было обнаружено такое заболевание, как нодулярный дерматит КРС в Краснодарском крае (в Тбилисском районе). Имеются также сведения об инфицированных ранее животных в Дагестане, Южной Осетии и Азербайджане. Что вызывает происходит заражение КРС нодулярным дерматитом при попадании в организм животных ДНК-содержащих вирусов Neethling, Allerton или BLD. Относятся они к роду Capripoxvirus, семейству Poxviridae. Причем чаще всего заражение вызывается Neethling. Репродуцируется этот вирус в почечной или тестикулярной ткани. Его опасность заключается, помимо всего прочего, в том, что он способен выдерживать до 3 циклов замораживания. При температуре в 4 градуса он может сохранять жизнеспособность в течение 6 месяцев.

Источники заражения. К сожалению, распространиться эта болезнь может в том числе и при соблюдении санитарных норм содержания КРС в коровниках. Дело в том, что ее переносчиками часто становятся комары и слепни. Таким образом, заражение может произойти даже и при выпасе скота. Собственно, в окружающую среду нодулярный дерматит крупного рогатого скота (вирус Neethling) попадает с отпадающими с язв кусочками кожи животных, с молоком, слюной, спермой или кровью. Дополнительные сложности — это заболевание доставляет еще и из-за отсутствия видимой закономерности в распространении. То есть в некоторых случаях животное, находящееся рядом с инфицированным, не заражается. При этом может заболеть корова или бык из стада в нескольких километрах. Как уже можно понять из всего вышесказанного, наибольшее количество инфицированных животных наблюдается в местах скопления кровососущих насекомых. Иногда нодулярный дерматит крупного рогатого скота (вирус) может переноситься и птицами. В особенности водоплавающими. Выделяется вирус дерматита и с дыханием зараженных животных. В некоторых случаях он может передаваться через корма и воду.

Симптомы. Инкубационный период болезни может длиться от 3 до 30 дней. Поскольку в этот период нодулярный дерматит никак себя не проявляет, животные не изолируются. А, следовательно, значительно возрастает риск распространения инфекции.

Проявляться болезнь может в двух формах: острой и хронической. Известен также атипичный нодулярный дерматит. При острой форме у заболевшего животного резко поднимается температура тела (до 40 градусов). При этом у коровы или быка снижается аппетит, текут слезы и появляются слизистые выделения из носа. Через двое суток на коже животного образуются узелки диаметром от 0.5 до 7 см и высотой до 0.5 см. Количество их может колебаться от 10 до нескольких сотен. В некоторых случаях они сливаются. На ощупь узелки плотные. Через несколько часов по их контуру начинает отслаиваться эпидермис. При этом в центре каждого узелка образуется ямка. С нее начинает распространяться некроз. Пораженные места окаймлены валиком из грануляционной ткани шириной до 3 мм. Через неделю некротизированный участок, имеющий форму цилиндра размером примерно 1*2 см, подсыхает и отпадает. В последующем образовавшаяся на коже животного полость заполняется тканью и зарастает лишенной пигмента кожей с шерстью. Но происходит так только в случае отсутствия осложнений. Бывает и так, что на коже животного образуются язвы. Некоторые узелки могут не отсыхать по году и более. Помимо кожных образований, нодулярный дерматит крупного рогатого скота (фото больных животных можно видеть на странице) характеризуют следующие симптомы:

— Розовый цвет молока. Сдаивается оно очень тяжело — по каплям. При нагревании молоко зараженного животного приобретает гелеобразный вид. Скармливать его телятам можно после пастеризации при температуре 85 градусов в течение получаса.

— Исхудание животного вследствие потери аппетита.

— Появление на веках коровы или быка язвочек, или эрозии.

— Текущая слюна изо рта и гнойная зловонная слизь из носа.

— Помутнение роговицы и снижение зрения у животного.

Иногда изъязвления появляются и в дыхательных путях коровы либо быка. В этом случае животное может погибнуть от удушья.

Атипичная форма нодулярного дерматита протекает без образования узелков. Проявляется она только у новорожденных телят.

Как ставится диагноз. Определяют заражение прежде всего на основе общей клинической картины. Помимо этого, проводится и лабораторная диагностика такого заболевания, как нодулярный дерматит крупного рогатого скота. Сан-экспертиза при этом выполняется с предварительным отбором биоматериала подозрительных животных. Установленным заболевание считается при обнаружении вируса нодулярного дерматита, его антигена или генома. В особо тяжелых случаях диагноз ставится на основании патологоанатомических исследований.

Симптомы нодулярного дерматита схожи с проявлениями крапивницы, дерматофилеза, оспы, демодекоза и лимфонгита. Иногда эту болезнь путают даже с банальными укусами насекомых. Поэтому при появлении на коже животных каких-либо узелков проводить лабораторные исследования стоит обязательно.

Патолого-анатомические изменения. При вскрытии павшего животного, перенесшего нодулярный дерматит крупного рогатого скота, методы лечения которого до сих пор не разработаны, могут обнаруживаться следующие изменения:

— увеличенные, отечные, сочные на разрезе лимфатические узлы;

— кровоизлияния размером до 1 см под висцеральной плеврой;

— отечность легких; застойное полнокровие на слизистой носа;

— некроз эпидермиса;

— тромбы в венах под узелками;

— кровоизлияние в слизистой кишечника.


Какой ущерб может нанести болезнь. Нодулярный дерматит крупного рогатого скота, лечение которого, к сожалению, не проводится, может поражать от 5 до 50% животных стада. Иногда случается и так, что болезнь затрагивает и 100% КРС. Падеж из-за инфицирования обычно составляет не более 10%, а чаще всего от 1 до 5%.

Хотя эта болезнь не «выкашивает» стадо целиком, относят ее к одной из самых опасных. Дело в том, что при ее распространении значительно снижается продуктивность животных. Происходят значительные убытки на продаже как молока, так и мяса, а также шкур. Крайне негативно это заболевание сказывается и на размножении КРС. Инфицированные быки становятся временно стерильными. У заболевших же коров нарушается половая цикличность. У беременных животных случаются аборты и рождаются мертвые детеныши.

Профилактика. К сожалению, как уже упоминалось, предотвратить эпидемию нодулярного дерматита очень сложно. Передается это заболевание просто моментально. Ответа же на вопрос о том, чем можно лечить нодулярный дерматит у коров, не существует. К тому же иммунитет после перенесенной инфекции вырабатывается довольно-таки плохо. То есть переболевшее животное при возникновении благоприятных обстоятельств может заразиться снова.

Предотвратить инфицирование скота дерматитом очень сложно. Однако свести риск возникновения болезни к минимуму все же можно. Иммунизацию коров проводят с использованием штамма схожего с Neethlin вируса овечьей оспы. Выращивается последний в тканях семенников ягнят. Только такой вирус дает иммунитет от нодулярного дерматита. Обычный овечий подобным эффектом не отличается.

Помимо собственно прививок, к профилактическим мерам можно отнести:

— недопущение развития сырости и, как следствие, появления большого количества кровососущих насекомых в коровниках;

— обработку животных и стойл репеллентами;

— недопущение ввоза в благополучные хозяйства животных неизвестного происхождения без соответствующих документов;

— в личных хозяйствах предоставление ветеринарам доступа в сараи для осмотра животных по требованию.

Схема вакцинации. Вводят штамм КРС подкожно. Первую прививку молодняку колют в трехмесячном возрасте. Делают это двукратно с промежутком в 2 недели. Далее вакцину вводят с периодичностью в год. В случае обнаружения болезни прививаться должны все без исключения животные вне зависимости от того, когда именно проводилась их иммунизация прежде.

Нодулярный дерматит коров: опасность для человека и других животных.    Прививать от этого заболевания полагается только КРС. К счастью, случаев передачи этой болезни от них к МРС выявлено до сих пор не было. Также совершенно неопасен вирус нодулярного дерматита и для человека.

Как предотвратить распространение. Нодулярный дерматит крупного рогатого скота, лечение которого невозможно, имеет свойство быстро распространяться. Поэтому при обнаружении заболевших животных следует полностью исключить контакт с ними других коров и быков, а также обслуживающего персонала. Помимо этого, нужно принять меры по недопущению вывоза частичек зараженной ткани за территорию хозяйства транспортом. Все покидающие территорию автомобили должны быть предварительно продезинфицированы. Этой же процедуре подвергается верхняя одежда и обувь обслуживающего персонала (с использованием паров формальдегида).

Выявленных больных животных, а также коров и быков, непосредственно контактировавших с ними, забивают бескровным методом. Трупы КРС, а также остатки кормов и подстилку уничтожают. В самом хозяйстве должна быть проведена трехкратная дезинфекция. Навоз из стойла буртуют и также обеззараживают.

Для сдерживания эпидемии, помимо всего прочего, должны быть приняты ограничения:

— на перемещение всех животных;

— на посещение хозяйства посторонними лицами;

— на убой животных и реализацию продукции. 

Нумулярная экзема — Американский остеопатический колледж дерматологии (AOCD)

Нуммулярный экзематозный дерматит (нуммулярная экзема или нуммулярный дерматит) — это стойкая зудящая сыпь, которая образует на коже пятна в форме монеты (на латыни nummular означает «монета»). Повреждения по мере взросления могут очищаться в центре или становиться чешуйчатыми и затем напоминать гриб (стригущий лишай) или псориаз . Состояние, как правило, хроническое, с периодами, когда оно становится намного лучше или хуже.

Причина неизвестна. Лишь изредка это оказывается аллергией на лекарства, хотя это часто учитывается при обследовании. Чаще встречается зимой. Нуммулярная экзема часто связана с сухой кожей. Шерсть, мыло и частое купание (чаще одного раза в день) часто ухудшают состояние. У людей с экземой часто бывает сухая кожа, которую легко раздражают мыло, моющие средства и грубая одежда. Одежда, выстиранная или высушенная с использованием жидких или мягких средств для белья, таких как Kling, также может вызывать раздражение кожи.Жаркая и холодная погода часто усугубляет экзему. Определенные аллергии могут усугубить экзему, но не вызывают ее. Это не то же самое, что атопическая экзема , гораздо более распространенная проблема кожи, которая может быть аллергической.

К сожалению, лекарства нет. Однако есть эффективные способы контролировать это. Очень сильная рецептурная сила . Мази с кортизоном , наносимые на кожу, являются лучшими лекарствами для борьбы с нумной экземой. При использовании в течение длительного периода времени или на больших участках тела необходимы периодические дерматологические осмотры.Сильные мази с кортизоном нельзя наносить на лицо, подмышки, пах или ректальную область. При использовании мазей с кортизоном всегда не забывайте наносить немного и хорошо массировать. В большинстве случаев применение один раз в день приносит столько же пользы, сколько и более частое его использование.

При стойкой чешуйчатой ​​нуммулярной экземе фармацевт может добавить каменноугольную смолу в мазь. Хотя это может быть полезно, оно пачкает одежду и пахнет. Места нуммулярного дерматита предрасположены к инфекции («стафилококк»), и часто бывает очень полезна неделя или две пероральных антибиотиков.Тяжелые случаи можно успокоить внутренним лечением кортизоном внутрь или инъекциями. Вспышки стойкого зуда можно контролировать с помощью лечения ультрафиолетом, проводимого в отделении дерматологии.

В общем, держите кожу смазанной. После душа нанесите на кожу масло, такое как масло для тела Neutrogena или масло Alpha-Keri. Вазелин даже более полезен, если не слишком жирный. Не принимайте более одной ванны или душа в день. Используйте теплую воду, так как горячая вода сушит кожу. Вытирая полотенцем насухо, не трите.Промокните кожу, чтобы на коже оставалось немного воды. Мыло раздражает и сушит кожу, поэтому держите его подальше от экземы. При купании ограничьте использование мыла лица, подмышек, области гениталий и ступней. Для мыла используйте Cetaphil, Olay Oil, Dove или Basis. Избегайте контакта с шерстью или грубой одеждой. Лучше всего подойдет одежда из хлопка (100%). При стирке одежды не используйте кондиционер для белья, Клинг или сушилки. Стирайте одежду моющими средствами без красителей и отдушек, такими как моющее средство «Все бесплатно».Можно найти схему лечения, которая контролирует нумулярную экзему.

Вернуться к индексу

Медицинская информация, представленная на этом сайте, предназначена только для образовательных целей и является собственностью Американского остеопатического колледжа дерматологии. Он не предназначен и не подразумевает замену профессиональной медицинской консультации и не должен создавать отношения между врачом и пациентом. Если у вас есть конкретный вопрос или беспокойство по поводу поражения или заболевания кожи, обратитесь к дерматологу.Любое использование, воссоздание, распространение, пересылка или копирование этой информации строго запрещено, если иное не дано письменным разрешением Американского остеопатического колледжа дерматологии.

Модульный вид цитокиновых сетей при атопическом дерматите

  • 1.

    Леунг Д.Ю., Бибер Т. (2003) Атопический дерматит. Ланцет 361 (9352): 151–160

    PubMed Статья Google Scholar

  • 2.

    Leung DY, Boguniewicz M, Howell MD, Nomura I, Hamid QA (2004) Новые взгляды на атопический дерматит.J Clin Invest 113 (5): 651–657

    PubMed CAS Google Scholar

  • 3.

    Leung DY (2000) Атопический дерматит: новые идеи и возможности терапевтического вмешательства. J Allergy Clin Immunol 105 (5): 860–876

    PubMed Статья CAS Google Scholar

  • 4.

    Soumelis V, Reche PA, Kanzler H, Yuan W., Edward G, Homey B et al (2002) Эпителиальные клетки человека запускают опосредованное дендритными клетками аллергическое воспаление, продуцируя TSLP.Nat Immunol 3 (7): 673–680

    PubMed CAS Google Scholar

  • 5.

    Ю Дж, Омори М., Дьярмати Д., Чжоу Б., Айе Т., Брюер А. и др. (2005) Спонтанный атопический дерматит у мышей, экспрессирующих индуцируемый трансген стромального лимфопоэтина тимуса, специфически в коже. J Exp Med 202 (4): 541–549

    PubMed Статья CAS Google Scholar

  • 6.

    Zhou B, Comeau MR, De Smedt T, Liggitt HD, Dahl ME, Lewis DB et al (2005) Тимический стромальный лимфопоэтин как ключевой инициатор аллергического воспаления дыхательных путей у мышей.Nat Immunol 6 (10): 1047–1053

    PubMed Статья CAS Google Scholar

  • 7.

    Gao PS, Rafaels NM, Mu D, Hand T, Murray T., Boguniewicz M et al (2010) Генетические варианты стромального лимфопоэтина тимуса связаны с атопическим дерматитом и герпетической экземой. J Allergy Clin Immunol 125 (6): 1403–1407

    PubMed Статья CAS Google Scholar

  • 8.

    Wang YH, Angkasekwinai P, Lu N, Voo KS, Arima K, Hanabuchi S. et al (2007). IL-25 усиливает иммунные ответы типа 2, увеличивая распространение и функции активированных TSLP-DC клеток памяти Th3. J Exp Med 204 (8): 1837–1847

    PubMed Статья CAS Google Scholar

  • 9.

    Симидзу М., Мацуда А., Янагисава К., Хирота Т., Акахоши М., Иномата Н. и др. (2005) Функциональные SNP в дистальном промоторе гена ST2 связаны с атопическим дерматитом.Hum Mol Genet 14 (19): 2919–2927

    PubMed Статья CAS Google Scholar

  • 10.

    Moritz DR, Rodewald HR, Gheyselinck J, Klemenz R (1998) Антиген Т1, связанный с рецептором IL-1, экспрессируется на незрелых и зрелых тучных клетках и на предшественниках тучных клеток крови плода. J Immunol 161 (9): 4866–4874

    PubMed CAS Google Scholar

  • 11.

    Xu D, Chan WL, Leung BP, Huang F, Wheeler R, Piedrafita D et al (1998) Селективная экспрессия стабильной молекулы клеточной поверхности на хелперных Т-клетках типа 2, но не на типе 1.J Exp Med 187 (5): 787–794

    PubMed Статья CAS Google Scholar

  • 12.

    Schmitz J, Owyang A, Oldham E, Song Y, Murphy E, McClanahan TK et al (2005) IL-33, интерлейкин-1-подобный цитокин, который передает сигнал через белок, связанный с рецептором IL-1. ST2 и индуцирует цитокины, ассоциированные с Т-хелпером 2 типа. Иммунитет 23 (5): 479–490

    PubMed Статья CAS Google Scholar

  • 13.

    Angelova-Fischer I, Fernandez IM, Donnadieu MH, Bulfone-Paus S, Zillikens D, Fischer TW et al (2010) Повреждение рогового слоя индуцирует in vivo экспрессию стромального лимфопоэтина тимуса человека в эпидермисе. J Invest Dermatol 130 (10): 2505–2507

    PubMed Статья CAS Google Scholar

  • 14.

    Miyata M, Hatsushika K, Ando T., Shimokawa N, Ohnuma Y, Katoh R et al (2008) Регулирование экспрессии эпителиального TSLP тучными клетками играет важную роль в развитии аллергического ринита.Eur J Immunol 38 (6): 1487–1492

    PubMed Статья CAS Google Scholar

  • 15.

    Bogiatzi SI, Fernandez I, Bichet JC, Marloie-Provost MA, Volpe E, Sastre X et al (2007) Передний край: провоспалительные цитокины и цитокины Th3 взаимодействуют друг с другом, вызывая выработку тимических стромальных лимфопоэтинов кератиноцитами кожи человека. J Immunol 178 (6): 3373–3377

    PubMed CAS Google Scholar

  • 16.

    Allakhverdi Z, Comeau MR, Jessup HK, Delespesse G (2009) Тимический стромальный лимфопоэтин как медиатор перекрестных помех между гладкими мышцами бронхов и тучными клетками. J Allergy Clin Immunol 123 (4): 958–960, e2

    PubMed Статья CAS Google Scholar

  • 17.

    Vu AT, Baba T, Chen X, Le TA, Kinoshita H, Xie Y et al (2010) Staphylococcus aureus мембрана и диацилированный липопептид индуцируют тимический стромальный лимфопоэтин в кератиноцитах через Toll-подобный рецептор 2- Путь к Toll-подобному рецептору 6.J Allergy Clin Immunol 126 (5): 985–993

    PubMed Статья CAS Google Scholar

  • 18.

    Ito T, Wang YH, Duramad O, Hori T, Delespesse GJ, Watanabe N. et al (2005) TSLP-активированные дендритные клетки индуцируют воспалительный ответ T-хелперов типа 2 через лиганд OX40. J Exp Med 202 (9): 1213–1223

    PubMed Статья CAS Google Scholar

  • 19.

    Allakhverdi Z, Comeau MR, Jessup HK, Yoon BR, Brewer A, Chartier S. et al (2007) Стромальный лимфопоэтин тимуса высвобождается эпителиальными клетками человека в ответ на микробы, травму или воспаление и сильно активирует тучную ткань. клетки.J Exp Med 204 (2): 253–258

    PubMed Статья CAS Google Scholar

  • 20.

    Аль-Шами А., Спольски Р., Келли Дж., Кин-Майерс А., Леонард В. Дж. (2005) Роль TSLP в развитии воспаления в модели астмы. J Exp Med 202 (6): 829–839

    PubMed Статья CAS Google Scholar

  • 21.

    He R, Oyoshi MK, Garibyan L, Kumar L, Ziegler SF, Geha RS (2008) TSLP действует на инфильтрирующие эффекторные Т-клетки, вызывая аллергическое воспаление кожи.Proc Natl Acad Sci U S A 105 (33): 11875–11880

    PubMed Статья CAS Google Scholar

  • 22.

    Lu N, Wang YH, Arima K, Hanabuchi S, Liu YJ (2009) TSLP и IL-7 используют два разных механизма для регуляции гомеостаза CD4 + Т-клеток человека. J Exp Med 206 (10): 2111–2119

    PubMed Статья CAS Google Scholar

  • 23.

    Fort MM, Cheung J, Yen D, Li J, Zurawski SM, Lo S et al (2001) IL-25 индуцирует IL-4, IL-5, IL-13 и Th3-ассоциированные патологии в естественным образом.Иммунитет 15 (6): 985–995

    PubMed Статья CAS Google Scholar

  • 24.

    Angkasekwinai P, Park H, Wang YH, Chang SH, Corry DB, Liu YJ et al (2007) Интерлейкин 25 способствует инициации проаллергических реакций 2 типа. J Exp Med 204 (7): 1509–1517

    PubMed Статья CAS Google Scholar

  • 25.

    Ikeda K, Nakajima H, Suzuki K, Kagami S, Hirose K, Suto A et al (2003) Тучные клетки продуцируют интерлейкин-25 при активации Fc-эпсилон RI.Кровь 101 (9): 3594–3596

    PubMed Статья CAS Google Scholar

  • 26.

    Hvid M, Vestergaard C, Kemp K, Christensen GB, Deleuran B, Deleuran M (2010) IL-25 при атопическом дерматите: возможная связь между воспалением и дисфункцией кожного барьера? J Invest Dermatol 131 (1): 150–157

    PubMed Статья Google Scholar

  • 27.

    Basham TY, Nickoloff BJ, Merigan TC, Morhenn VB (1985) Рекомбинантный гамма-интерферон дифференциально регулирует экспрессию и биосинтез антигена класса II на культивируемых нормальных кератиноцитах человека.J Interferon Res 5 (1): 23–32

    PubMed Статья CAS Google Scholar

  • 28.

    О’Реган Г.М., Ирвин А.Д. (2010) Роль филаггрина при атопическом диатезе. Clin Exp Allergy 40 (7): 965–972

    PubMed Статья Google Scholar

  • 29.

    Allakhverdi Z, Smith DE, Comeau MR, Delespesse G (2007) Передний край: лиганд ST2 IL-33 сильно активирует и стимулирует созревание тучных клеток человека.J Immunol 179 (4): 2051–2054

    PubMed CAS Google Scholar

  • 30.

    Мекори Ю.А., Меткалф Д.Д. (2000) Тучные клетки в врожденном иммунитете. Immunol Rev 173: 131–140

    PubMed Статья CAS Google Scholar

  • 31.

    Navi D, Saegusa J, Liu FT (2007) Тучные клетки и иммунологические кожные заболевания. Clin Rev Allergy Immunol 33 (1-2): 144–155

    PubMed Статья CAS Google Scholar

  • 32.

    Schreibelt G, Tel J, Sliepen KH, Benitez-Ribas D, Figdor CG, Adema GJ et al (2010) Экспрессия и функция толл-подобных рецепторов в подмножествах дендритных клеток человека: последствия для противораковой иммунотерапии на основе дендритных клеток. Cancer Immunol Immunother 59 (10): 1573–1582

    PubMed Статья CAS Google Scholar

  • 33.

    Kang JY, Nan X, Jin MS, Youn SJ, Ryu YH, Mah S. et al (2009) Распознавание липопептидных структур гетеродимером Toll-подобного рецептора 2-Toll-подобного рецептора 6.Иммунитет 31 (6): 873–884

    PubMed Статья CAS Google Scholar

  • 34.

    Jin MS, Kim SE, Heo JY, Lee ME, Kim HM, Paik SG et al (2007) Кристаллическая структура гетеродимера TLR1-TLR2, индуцированная связыванием триацилированного липопептида. Ячейка 130 (6): 1071–1082

    PubMed Статья CAS Google Scholar

  • 35.

    Grewe M, Gyufko K, Schopf E, Krutmann J (1994) Поражающая экспрессия гамма-интерферона при атопической экземе.Ланцет 343 (8888): 25–26

    PubMed Статья CAS Google Scholar

  • 36.

    Johnson-Huang LM, McNutt NS, Krueger JG, Lowes MA (2009) Дендритные клетки, продуцирующие цитокины, в патогенезе воспалительных заболеваний кожи. J Clin Immunol 29 (3): 247–256

    PubMed Статья CAS Google Scholar

  • 37.

    Ван Б., Фелициани С., Хауэлл Б. Г., Фрид И., Цай К., Ватанабе Х. и др. (2002) Вклад IL-18, полученный из клеток Лангерганса, в контактную гиперчувствительность.J Immunol 168 (7): 3303–3308

    PubMed CAS Google Scholar

  • 38.

    Грейси Дж. А., Робертсон С. Е., Макиннес И. Б. (2003) Интерлейкин-18. J Leukoc Biol 73 (2): 213–224

    PubMed Статья CAS Google Scholar

  • 39.

    Homey B, Steinhoff M, Ruzicka T, Leung DY (2006) Цитокины и хемокины организуют атопическое воспаление кожи. J Allergy Clin Immunol 118 (1): 178–189

    PubMed Статья CAS Google Scholar

  • 40.

    Наканиши К., Цуцуи Х., Йошимото Т. (2010) Важность IL-18-индуцированных супер-Th2-клеток для развития аллергического воспаления. Allergol Int 59 (2): 137–141

    PubMed Статья CAS Google Scholar

  • 41.

    Sugimoto T, Ishikawa Y, Yoshimoto T., Hayashi N, Fujimoto J, Nakanishi K (2004) Интерлейкин 18 действует на Т-хелперные клетки памяти типа 1, вызывая воспаление дыхательных путей и гиперреактивность у наивной мыши-хозяина.J Exp Med 199 (4): 535–545

    PubMed Статья CAS Google Scholar

  • 42.

    Yoshimoto T, Tsutsui H, Tominaga K, Hoshino K, Okamura H, Akira S. et al (1999) IL-18, хотя и обладает противоаллергическим действием при введении с IL-12, стимулирует высвобождение IL-4 и гистамина базофилами. . Proc Natl Acad Sci U S A 96 (24): 13962–13966

    PubMed Статья CAS Google Scholar

  • 43.

    Yoshimoto T, Min B, Sugimoto T, Hayashi N, Ishikawa Y, Sasaki Y et al (2003) Неизбыточная роль ограниченных CD1d естественных Т-киллеров и обычных CD4 + Т-клеток в индукции антител иммуноглобулина E в ответ на интерлейкин 18 лечение мышей. J Exp Med 197 (8): 997–1005

    PubMed Статья CAS Google Scholar

  • 44.

    Matsui K, Wirotesangthong M, Nishikawa A (2008) Пептидогликан из Staphylococcus aureus индуцирует продукцию IL-4 клетками селезенки мыши посредством IL-18-зависимого механизма.Int Arch Allergy Immunol 146 (3): 262–266

    PubMed Статья CAS Google Scholar

  • 45.

    Swain SL, Weinberg AD, English M, Huston G (1990) IL-4 направляет развитие Th3-подобных вспомогательных эффекторов. J Immunol 145 (11): 3796–3806

    PubMed CAS Google Scholar

  • 46.

    Renauld JC (2001) Новое понимание роли цитокинов при астме. J Clin Pathol 54 (8): 577–589

    PubMed Статья CAS Google Scholar

  • 47.

    Hamelmann E, Gelfand EW (2001) IL-5-индуцированная эозинофилия дыхательных путей — ключ к астме? Immunol Rev 179: 182–191

    PubMed Статья CAS Google Scholar

  • 48.

    Jin H, Oyoshi MK, Le Y, Bianchi T., Koduru S, Mathias CB и др. (2009) IL-21R необходим для эпикутанной сенсибилизации и аллергического воспаления кожи у людей и мышей. J Clin Invest 119 (1): 47–60

    PubMed CAS Google Scholar

  • 49.

    Вурстер А.Л., Роджерс В.Л., Сатоскар А.Р., Уиттерс М.Дж., Янг Д.А., Коллинз М. и др. (2002) Интерлейкин 21 представляет собой цитокин Т-хелперной (Th) клетки 2, который специфически ингибирует дифференцировку наивных Th-клеток в Th2, продуцирующий интерферон гамма. клетки. J Exp Med 196 (7): 969–977

    PubMed Статья CAS Google Scholar

  • 50.

    Нуриева Р., Ян ХО, Мартинез Дж., Чжан Й., Панопулос А.Д., Ма Л. и др. (2007) Существенная аутокринная регуляция IL-21 в генерации воспалительных Т-клеток.Nature 448 (7152): 480–483

    PubMed Статья CAS Google Scholar

  • 51.

    Sarra M, Monteleone I, Stolfi C, Fantini MC, Sileri P, Sica G et al (2010) Клетки, экспрессирующие гамма-интерферон, являются основным источником интерлейкина-21 при воспалительных заболеваниях кишечника. Воспаление кишечника 16 (8): 1332–1339

    PubMed Google Scholar

  • 52.

    Chtanova T, Tangye SG, Newton R, Frank N, Hodge MR, Rolph MS et al (2004) T-фолликулярные хелперные клетки экспрессируют характерный транскрипционный профиль, отражающий их роль как эффекторных клеток, не относящихся к Th2 / Th3, которые оказать помощь В-клеткам.J Immunol 173 (1): 68–78

    PubMed CAS Google Scholar

  • 53.

    Peluso I, Fantini MC, Fina D, Caruso R, Boirivant M, MacDonald TT и др. (2007) IL-21 противодействует опосредованному регуляторными T-клетками подавлению CD4 + T-лимфоцитов человека. J Immunol 178 (2): 732–739

    PubMed CAS Google Scholar

  • 54.

    Костанцо А., Кименти М.С., Ботти Е., Карузо Р., Сарра М., Монтелеоне Г. (2010) ИЛ-21 в патогенезе и лечении кожных заболеваний.J Dermatol Sci 60 (2): 61–66

    PubMed Статья CAS Google Scholar

  • 55.

    Konforte D, Simard N, Paige CJ (2009) IL-21: исполнитель судьбы В-клеток. J Immunol 182 (4): 1781–1787

    PubMed Статья CAS Google Scholar

  • 56.

    Dillon SR, Sprecher C, Hammond A, Bilsborough J, Rosenfeld-Franklin M, Presnell SR et al (2004) Интерлейкин 31, цитокин, продуцируемый активированными Т-клетками, вызывает дерматит у мышей.Nat Immunol 5 (7): 752–760

    PubMed Статья CAS Google Scholar

  • 57.

    Sonkoly E, Muller A, Lauerma AI, Pivarcsi A, Soto H, Kemeny L et al (2006) IL-31: новая связь между Т-клетками и зудом при атопическом воспалении кожи. J Allergy Clin Immunol 117 (2): 411–417

    PubMed Статья CAS Google Scholar

  • 58.

    Bilsborough J, Leung DY, Maurer M, Howell M, Boguniewicz M, Yao L et al (2006) IL-31 связан с кожными лимфоцитарными антигенположительными Т-клетками кожи у пациентов с атопическим дерматитом.J Allergy Clin Immunol 117 (2): 418–425

    PubMed Статья CAS Google Scholar

  • 59.

    Raap U, Wichmann K, Bruder M, Stander S, Wedi B, Kapp A et al (2008) Корреляция уровней IL-31 в сыворотке с тяжестью атопического дерматита. J Allergy Clin Immunol 122 (2): 421–423

    PubMed Статья CAS Google Scholar

  • 60.

    Cheung PF, Wong CK, Ho AW, Hu S, Chen DP, Lam CW (2010) Активация человеческих эозинофилов и эпидермальных кератиноцитов цитокином IL-31 Th3: значение для иммунопатогенеза атопического дерматита.Int Immunol 22 (6): 453–467

    PubMed Статья CAS Google Scholar

  • 61.

    Antonysamy MA, Fanslow WC, Fu F, Li W, Qian S, Troutt AB et al (1999) Доказательства роли IL-17 в отторжении аллотрансплантата органа: IL-17 способствует функциональной дифференциации дендритных клетки-предшественники. J Immunol 162 (1): 577–584

    PubMed CAS Google Scholar

  • 62.

    Милованович М., Дрозденко Г., Вайз С., Бабина М., Червь М. (2010) Интерлейкин-17А способствует выработке IgE в В-клетках человека.J Invest Dermatol 130 (11): 2621–2628

    PubMed Статья CAS Google Scholar

  • 63.

    Toda M, Leung DY, Molet S, Boguniewicz M, Taha R, Christodoulopoulos P et al (2003) Поляризованная экспрессия IL-11 и IL-17 in vivo между острыми и хроническими повреждениями кожи. J Allergy Clin Immunol 111 (4): 875–881

    PubMed Статья CAS Google Scholar

  • 64.

    Koga C, Kabashima K, Shiraishi N, Kobayashi M, Tokura Y (2008) Возможная патогенная роль клеток Th27 при атопическом дерматите. J Invest Dermatol 128 (11): 2625–2630

    PubMed Статья CAS Google Scholar

  • 65.

    Guttman-Yassky E, Lowes MA, Fuentes-Duculan J, Zaba LC, Cardinale I, Nograles KE et al (2008) Низкая экспрессия пути IL-23 / Th27 при атопическом дерматите по сравнению с псориазом. J Immunol 181 (10): 7420–7427

    PubMed CAS Google Scholar

  • 66.

    Lee FE, Georas SN, Beck LA (2010) IL-17: важен для защиты хозяина, аутоиммунитета и аллергии? J Invest Dermatol 130 (11): 2540–2542

    PubMed Статья CAS Google Scholar

  • 67.

    Ferretti S, Bonneau O, Dubois GR, Jones CE, Trifilieff A (2003) IL-17, продуцируемый лимфоцитами и нейтрофилами, необходим для индуцированной липополисахаридом нейтрофилии дыхательных путей: IL-15 в качестве возможного триггера. J Immunol 170 (4): 2106–2112

    PubMed CAS Google Scholar

  • 68.

    Uhlig HH, McKenzie BS, Hue S, Thompson C, Joyce-Shaikh B, Stepankova R et al (2006) Дифференциальная активность IL-12 и IL-23 при патологии слизистой оболочки и системной врожденной иммунной патологии. Иммунитет 25 (2): 309–318

    PubMed Статья CAS Google Scholar

  • 69.

    Cua DJ, Tato CM (2010) Врожденные клетки, продуцирующие IL-17: стражи иммунной системы. Nat Rev Immunol 10 (7): 479–489

    PubMed Статья CAS Google Scholar

  • 70.

    Hueber AJ, Asquith DL, Miller AM, Reilly J, Kerr S, Leipe J et al (2010) Тучные клетки экспрессируют IL-17A в синовиальной оболочке ревматоидного артрита. J Immunol 184 (7): 3336–3340

    PubMed Статья CAS Google Scholar

  • 71.

    Wang YH, Voo KS, Liu B, Chen CY, Uygungil B, Spoede W et al (2010) Новое подмножество CD4 (+) T (H) 2 клеток памяти / эффекторных клеток, которые продуцируют воспалительный IL- 17 цитокинов и способствуют обострению хронической аллергической астмы.J Exp Med 207 (11): 2479–2491

    PubMed Статья CAS Google Scholar

  • Атопический дерматит: основы практики, история вопроса, патофизиология

  • Spergel JM. От атопического дерматита до астмы: атопический марш. Ann Allergy Asthma Immunol . 2010 августа 105 (2): 99-106; викторина 107-9, 117. [Medline].

  • Карлстен С., Димич-Уорд Х., Фергюсон А., Уотсон В., Руссо Р., Дибунцио А. и др.Атопический дерматит в когорте высокого риска: естественное течение, связанные с ним аллергические исходы и факторы риска. Ann Allergy Asthma Immunol . 2013 Январь 110 (1): 24-8. [Медлайн].

  • [Рекомендации] Eichenfield LF, Tom WL, Chamlin SL, Feldman SR, Hanifin JM, Simpson EL, et al. Рекомендации по лечению атопического дерматита: раздел 1. Диагностика и оценка атопического дерматита. J Am Acad Dermatol . 2014 Февраль 70 (2): 338-51. [Медлайн].

  • Heller M, Shin HT, Orlow SJ, Schaffer JV.Микофенолят мофетил при тяжелом детском атопическом дерматите: опыт у 14 пациентов. Br J Dermatol . 2007 Июль 157 (1): 127-32. [Медлайн].

  • Van Velsen SG, Haeck IM, Bruijnzeel-Koomen CA. Тяжелый атопический дерматит лечится эверолимусом. J Dermatolog Treat . 2009. 20 (6): 365-7. [Медлайн].

  • Фельдман SR. Всегда необходимо учитывать приверженность лечению: действительно ли эверолимус неэффективен для лечения атопического дерматита? J Dermatolog Treat . 2009. 20 (6): 317-8. [Медлайн].

  • Хуанг Дж. Т., Абрамс М., Тлуган Б., Радемейкер А., Паллер А.С. Лечение колонизации золотистого стафилококка при атопическом дерматите снижает тяжесть заболевания. Педиатрия . 2009 Май. 123 (5): e808-14. [Медлайн].

  • Jansen CT, Haapalahti J, Hopsu-Havu VK. Иммуноглобулин Е в атопической коже человека. Arch Dermatol Forsch . 1973 28 мая. 246 (4): 209-302. [Медлайн].

  • Кога С., Кабашима К., Сираиси Н., Кобаяши М., Токура Ю. Возможная патогенная роль клеток Th27 при атопическом дерматите. Дж. Инвест Дерматол . 2008 ноябрь 128 (11): 2625-30. [Медлайн].

  • Molfino NA, Gossage D, Kolbeck R, Parker JM, Geba GP. Молекулярное и клиническое обоснование терапевтического воздействия на интерлейкин-5 и его рецептор. Clin Exp Allergy . 2011 г. 23 сентября [Medline].

  • Хершко А.Ю., Сузуки Р., Чарльз Н., Альварес-Эррико Д., Сарджент Дж. Л., Лоуренс А. и др.Продукция интерлейкина-2 тучными клетками способствует подавлению хронического аллергического дерматита. Иммунитет . 2011 28 октября. 35 (4): 562-71. [Медлайн].

  • Ким Б.С., Сиракуза М.К., Саенс С.А., Ноти М., Монтичелли Л.А., Зонненберг Г.Ф. и др. TSLP вызывает независимые от IL-33 ответы врожденных лимфоидных клеток, способствуя воспалению кожи. Научный перевод медицины . 2013 30 января. 5 (170): 170ra16. [Медлайн].

  • Ким Б.С., Ван К., Сиракуза М.С., Саенс С.А., Брестофф Дж.Р., Монтичелли Л.А. и др.Базофилы стимулируют врожденные реакции лимфоидных клеток в воспаленной коже. Дж. Иммунол . 2014 Октябрь 1. 193 (7): 3717-25. [Медлайн].

  • Рёдигер Б., Кайл Р., Йип К. Х., Сумария Н., Гай Т. В., Ким Б. С. и др. Кожный иммунный надзор и регуляция воспаления с помощью врожденных лимфоидных клеток 2-й группы. Нат Иммунол . 2013 14 июня (6): 564-73. [Медлайн].

  • Имаи Й, Ясуда К., Сакагути Ю., Ханеда Т., Мизутани Х., Йошимото Т. и др. Специфическая для кожи экспрессия IL-33 активирует врожденные лимфоидные клетки 2-й группы и вызывает у мышей воспаление, подобное атопическому дерматиту. Proc Natl Acad Sci U S A . 2013 20 августа. 110 (34): 13921-6. [Медлайн].

  • Salimi M, Barlow JL, Saunders SP, Xue L, Gutowska-Owsiak D, Wang X и др. Роль врожденных лимфоидных клеток типа 2, управляемых IL-25 и IL-33, в атопическом дерматите. J Exp Med . 2013 16 декабря. 210 (13): 2939-50. [Медлайн].

  • Ким Б.С. Врожденные лимфоидные клетки кожи. Дж. Инвест Дерматол . 2015 Март 135 (3): 673-8. [Медлайн].

  • Cevikbas F, Wang X, Akiyama T., Kempkes C, Savinko T., Antal A, et al.Сенсорный нейрон-экспрессируемый рецептор IL-31 опосредует зависимый от Т-хелперных клеток зуд: вовлечение TRPV1 и TRPA1. J Allergy Clin Immunol . 2014 Февраль 133 (2): 448-60. [Медлайн].

  • Oetjen LK, Mack MR, Feng J, et al. Сенсорные нейроны кооптируют классические иммунные сигнальные пути для облегчения хронического зуда. Ячейка . 2017 21 сентября 171 (1): 217-228.e13. [Медлайн].

  • Осава Р., Акияма М., Симидзу Х. Дефекты гена филаггрина и риск развития аллергических расстройств. Аллергол Инт . 2011 Март 60 (1): 1-9. [Медлайн].

  • Smith FJ, Irvine AD, Terron-Kwiatkowski A, et al. Мутации с потерей функции в гене, кодирующем филаггрин, вызывают вульгарный ихтиоз. Нат Генет . 2006 Март 38 (3): 337-42. [Медлайн].

  • Palmer CN, Irvine AD, Terron-Kwiatkowski A, et al. Распространенные варианты с потерей функции белка эпидермального барьера филаггрина являются основным предрасполагающим фактором для атопического дерматита. Нат Генет . 2006 апр. 38 (4): 441-6. [Медлайн].

  • Hvid M, Vestergaard C, Kemp K, Christensen GB, Deleuran B, Deleuran M. IL-25 при атопическом дерматите: возможная связь между воспалением и дисфункцией кожного барьера ?. Дж. Инвест Дерматол . 2011 январь 131 (1): 150-7. [Медлайн].

  • Савинко Т., Матикайнен С., Саариалхо-Кере У, Лехто М., Ван Г., Лехтимяки С. и др. IL-33 и ST2 при атопическом дерматите: профили экспрессии и модуляция запускающими факторами. Дж. Инвест Дерматол . 2012 май. 132 (5): 1392-400. [Медлайн].

  • Soumelis V, Reche PA, Kanzler H, Yuan W., Edward G, Homey B и др. Эпителиальные клетки человека запускают опосредованное дендритными клетками аллергическое воспаление, продуцируя TSLP. Нат Иммунол . 2002 июл.3 (7): 673-80. [Медлайн].

  • Brandt EB, Sivaprasad U. Цитокины Th3 и атопический дерматит. Дж. Clin Cell Immunol. . 2011 10 августа. 2 (3): [Medline]. [Полный текст].

  • Марголис Д. Д., Ким Б., Аптер А. Дж., Гупта Дж., Хоффстад О., Пападопулос М. и др. Изменение стромального лимфопоэтина тимуса, потеря функции филаггрина и стойкость атопического дерматита. JAMA Dermatol . 2014 Март 150 (3): 254-9. [Медлайн].

  • Кубо А., Нагао К., Амагаи М. Дисфункция эпидермального барьера и кожная сенсибилизация при атопических заболеваниях. Дж. Клин Инвест . 2012 г. 1. 122 (2): 440-7. [Медлайн]. [Полный текст].

  • Sun LD, Xiao FL, Li Y, et al. Полногеномное ассоциативное исследование выявило два новых локуса восприимчивости к атопическому дерматиту у китайской ханьской популяции. Нат Генет . 2011, 12 июня. 43 (7): 690-4. [Медлайн].

  • Патерностер Л., Стэндл М., Чен С.М. и др. Мета-анализ полногеномных ассоциативных исследований выявил три новых локуса риска атопического дерматита. Нат Генет . 2011 25 декабря. 44 (2): 187-92. [Медлайн]. [Полный текст].

  • Уильямс Х., Флор С. Как эпидемиология бросила вызов трем преобладающим концепциям атопического дерматита. J Allergy Clin Immunol . 2006 июл.118 (1): 209-13. [Медлайн].

  • Zutavern A, Hirsch T., Leupold W, Weiland S, Keil U, von Mutius E. Атопический дерматит, внешний атопический дерматит и гигиеническая гипотеза: результаты перекрестного исследования. Clin Exp Allergy . 2005 Октябрь, 35 (10): 1301-8. [Медлайн].

  • Вестон С., Халберт А., Ричмонд П., Прескотт С.Л.Эффекты пробиотиков при атопическом дерматите: рандомизированное контролируемое исследование. Арч Дис Детский . 2005 сентябрь 90 (9): 892-7. [Медлайн].

  • Ли Ч., Чуанг Х.Й., Хонг Ч. и др. Постоянное курение сигарет и развитие атопического дерматита у взрослых. Br J Dermatol . 2011 Март 164 (3): 483-9. [Медлайн]. [Полный текст].

  • Хорий К.А., Саймон С.Д., Лю Д.Ю., Шарма В. Атопический дерматит у детей в США, 1997–2004 годы: тенденции посещений, характеристики пациентов и поставщиков медицинских услуг и схемы назначения. Педиатрия . 2007 сентябрь 120 (3): e527-34. [Медлайн].

  • Williams HC, Pembroke AC, Forsdyke H, Boodoo G, Hay RJ, Burney PG. У чернокожих детей из Карибского бассейна, рожденных в Лондоне, повышен риск атопического дерматита. J Am Acad Dermatol . 1995, 32 февраля (2, часть 1): 212-7. [Медлайн].

  • Леунг Д. Ю., Бибер Т. Атопический дерматит. Ланцет . 2003 г. 11 января. 361 (9352): 151-60. [Медлайн].

  • Фокс С.Симптомы атопического дерматита у детей стойкие. Медицинские новости Medscape. Доступно на http://www.medscape.com/viewarticle/823090. Доступ: 15 апреля 2014 г.

  • Margolis JS, Abuabara K, Bilker W, Hoffstad O, Margolis DJ. Стойкость атопического дерматита от легкой до средней степени. JAMA Dermatol . 2014 г. 2 апреля [Medline].

  • Silverberg JI. Сохранение детской экземы во взрослом возрасте. JAMA Dermatol . 2014 г. 2 апреля [Medline].

  • Armstrong AW, Kim RH, Idriss NZ, Larsen LN, Lio PA. Онлайн-видео улучшает клинические результаты у взрослых с атопическим дерматитом: рандомизированное контролируемое исследование. J Am Acad Dermatol . 2011 Март 64 (3): 502-7. [Медлайн].

  • Гармхаузен Д., Хагеманн Т., Бибер Т., Димитриу И., Фиммерс Р., Дипген Т. и др. Характеристика различных течений атопического дерматита у подростков и взрослых. Аллергия . 2013 апр.68 (4): 498-506. [Медлайн].

  • Ханифин Ю.М., Райка Г. Диагностические особенности атопического дерматита. Acta Derm Venereol (Stockh) . 1980. 92 (доп.): 44-7.

  • Чопра Р., Вахария П.П., Сакотт Р., Патель Н., Имманени С., Уайт Т. и др. Уровни тяжести экземы для площади и индекса тяжести (EASI), модифицированного EASI, оценки атопического дерматита (SCORAD), объективного SCORAD, индекса тяжести атопического дерматита и площади поверхности тела у подростков и взрослых с атопическим дерматитом. Br J Dermatol . 2017 ноябрь 177 (5): 1316-1321. [Медлайн].

  • Schram ME, Spuls PI, Leeflang MM, Lindeboom R, Bos JD, Schmitt J. EASI, (цель) SCORAD и POEM для атопической экземы: отзывчивость и минимальная клинически значимая разница. Аллергия . 2012 Январь 67 (1): 99-106. [Медлайн].

  • Сильверберг JI, Гельфанд JM, Марголис DJ, Fonacier L, Boguniewicz M, Schwartz LB, et al. Уровни тяжести POEM, PO-SCORAD и DLQI у взрослых в США с атопическим дерматитом. Ann Allergy Asthma Immunol . 2018 Октябрь 121 (4): 464-468.e3. [Медлайн].

  • Schmitt J, Chen CM, Apfelbacher C, et al. Детская экзема, проблемы со сном и психическое здоровье в возрасте 10 лет: проспективное когортное исследование LISAplus. Аллергия . 2011 марта 66 (3): 404-11. [Медлайн].

  • Nikkels AF, Piérard GE. Скрытая ветряная оспа. Pediatr Infect Dis J . 2009 28 декабря (12): 1073-5. [Медлайн].

  • Haeck IM, Rouwen TJ, Timmer-de Mik L, et al.Актуальные кортикостероиды при атопическом дерматите и риске глаукомы и катаракты. J Am Acad Dermatol . 2011 Февраль 64 (2): 275-81. [Медлайн].

  • Heil PM, Maurer D, Klein B, Hultsch T., Stingl G. Терапия омализумабом при атопическом дерматите: истощение IgE не улучшает клиническое течение — рандомизированное плацебо-контролируемое двойное слепое пилотное исследование. J Dtsch Dermatol Ges . 2010 декабря 8 (12): 990-8. [Медлайн].

  • Бек Л.А., Тачи Д., Гамильтон Дж. Д., Грэм Н. М., Бибер Т., Роклин Р. и др.Лечение дупилумабом у взрослых с атопическим дерматитом средней и тяжелой степени тяжести. N Engl J Med . 2014 10 июля. 371 (2): 130-9. [Медлайн].

  • Тачи Д., Симпсон Э.Л., Бек Л.А., Бибер Т., Блаувельт А., Папп К. и др. Эффективность и безопасность дупилумаба у взрослых с атопическим дерматитом средней и тяжелой степени тяжести, недостаточно контролируемым местными методами лечения: рандомизированное плацебо-контролируемое исследование фазы 2b с определением дозировки. Ланцет . 2016 г. 2 января. 387 (10013): 40-52. [Медлайн].

  • Симпсон Э.Л., Бибер Т., Гутман-Ясский Э., Бек Л.А., Блаувельт А., Корк М.Дж. и др. Две фазы 3 испытаний дупилумаба по сравнению с плацебо при атопическом дерматите. N Engl J Med . 2016 15 декабря. 375 (24): 2335-2348. [Медлайн].

  • Simpson EL, et al. Эффективность и безопасность дупилумаба у подростков с атопическим дерматитом средней и тяжелой степени тяжести: результаты многоцентрового рандомизированного плацебо-контролируемого двойного слепого исследования фазы 3 в параллельных группах (аннотация № 4640).Представлен на 27-м Конгрессе Европейской академии дерматологии и венерологии (EADV). 15 сентября 2018 года. Париж, Франция. [Полный текст].

  • Paller AS, Siegfried E, Gooderham M, Beck LA, Boguniewica M, Sher L, et al. Дупилумаб значительно улучшает лечение атопического дерматита у детей в возрасте от 6 до 12 лет: результаты исследования фазы 3 (LIBERTY AD PEDS) (аннотация 215). Представлено на виртуальной встрече Revolutionizing Atopic Dermatitis 2020. 5 апреля 2020 г. [Полный текст].

  • AnaptysBio.AnaptysBio сообщает о положительных данных о подтверждении концепции Topline из фазы 2a клинического испытания ANB020 при атопическом дерматите. Доступно по адресу http://ir.anaptysbio.com/phoenix.zhtml?c=254208&p=irol-newsArticle&ID=2305583. 10 октября 2017 г .; Дата обращения: 13 ноября 2017 г.

  • Schwartz DM, Bonelli M, Gadina M, O’Shea JJ. Цитокины I / II типа, JAK и новые стратегии лечения аутоиммунных заболеваний. Нат Ревматол . 2016 12 января (1): 25-36. [Медлайн].

  • AbbVie.Упадацитиниб (ABT-494) компании AbbVie отвечает основным критериям исследования фазы 2b при атопическом дерматите. Доступно на https://news.abbvie.com/news/abbvies-upadacitinib-abt-494-meets-primary-endpoint-in-phase-2b-study-in-atopic-dermatitis.htm. 7 сентября 2017 г .; Дата обращения: 13 ноября 2017 г.

  • Эли Лилли и компания. Барицитиниб соответствует основной конечной точке исследования фазы 2 у пациентов с умеренным и тяжелым атопическим дерматитом. Доступно на https://investor.lilly.com/releasedetail.cfm? ReleaseID = 1040434. 14 сентября 2017 г .; Дата обращения: 13 ноября 2017 г.

  • Bissonnette R, Papp KA, Poulin Y, Gooderham M, Raman M, Mallbris L, et al. Тофацитиниб для местного применения при атопическом дерматите: рандомизированное исследование фазы IIa. Br J Dermatol . 2016 ноябрь 175 (5): 902-911. [Медлайн].

  • Paller AS, Tom WL, Lebwohl MG, Blumenthal RL, Boguniewicz M, Call RS, et al. Эффективность и безопасность мази кризаборола, нового нестероидного ингибитора фосфодиэстеразы 4 (PDE4) для местного лечения атопического дерматита (AD) у детей и взрослых. J Am Acad Dermatol . 2016 Сентябрь 75 (3): 494-503.e4. [Медлайн]. [Полный текст].

  • Eucrisa (crisaborole) [листок-вкладыш]. Колледжвилл, Пенсильвания: Anacor Pharmaceuticals, Inc., март 2020 г. Доступно на [Полный текст].

  • Михаил С. Роль пробиотиков при аллергических заболеваниях. Allergy Asthma Clin Immunol . 2009 22 октября. 5 (1): 5. [Медлайн]. [Полный текст].

  • Hand L. Пробиотики могут защитить младенцев от аллергии, но не от астмы. Медицинские новости Медскейп . 19 августа 2013 г. [Полный текст].

  • Elazab N, Mendy A, Gasana J, Vieira ER, Quizon A, Forno E. Введение пробиотиков в раннем возрасте, атопии и астме: метаанализ клинических испытаний. Педиатрия . 19 августа 2013 г. [Medline].

  • Джонсон К. Пробиотики при беременности и лактации уменьшают дерматит. Медицинские новости Медскейп . 25 ноября 2014 г. [Полный текст].

  • [Рекомендации] Fiocchi A, Pawankar R, Cuello-Garcia C, et al.Рекомендации Всемирной организации по аллергии и Университета Макмастера по профилактике аллергических заболеваний (GLAD-P): Пробиотики. World Allergy Organ J . 2015. 8 (1): 4. [Медлайн].

  • Дуглас Д. Анализ метотрексата полезен для некоторых детей с кожными заболеваниями. Медицинские новости Медскейп . 7 января 2014 г. [Полный текст].

  • Рахман С.И., Зигфрид Э., Фланаган К.Х., Армбрехт Э.С. Анализ метотрексата и полиглутамата подтверждает эффективность метотрексата при тяжелых воспалительных заболеваниях кожи у детей. J Am Acad Dermatol . 2013 8 декабря [Medline].

  • Ши В.Ю., Фулад Н., Орнелас Дж. Н., Хассун Л., Монико Дж., Такеда Н. и др. Сравнение влияния отбеливателя и водных ванн на барьерную функцию кожи при атопическом дерматите: рандомизированное контролируемое исследование с разделением тел. Br J Dermatol . 2016 15 февраля. [Medline].

  • [Рекомендации] Американская академия дерматологии. Клинические рекомендации по атопическому дерматиту. Доступно на https://www.aad.org/practicecenter/quality/clinical-guidelines/atopic-dermatitis.2014; Дата обращения: 9 ноября 2018 г.

  • [Рекомендации] Берт-Джонс Дж., Экстон Л.С., Ладоянни Э., Мохд Мустапа М.Ф., Теббс В.М., Йесудиан П.Д. и др. Руководство Британской ассоциации дерматологов по безопасному и эффективному назначению орального циклоспорина в дерматологии, 2018 г. Br J Dermatol . 2019 июнь 180 (6): 1312-1338. [Медлайн]. [Полный текст].

  • Принципы дерматологии — Knowledge @ AMBOSS

    Последнее обновление: 10 августа 2021 г.


    Дерматология — это отрасль медицины, занимающаяся кожей, волосами и ногтями, а также связанными с ними состояниями.Базовые знания дерматологии необходимы каждому врачу, так как примерно 50% консультаций по вопросам кожи первоначально оцениваются недерматологами. В Соединенных Штатах наиболее распространенные состояния, наблюдаемые дерматологами, включают акне, актинический кератоз, немеланомный рак кожи, доброкачественные опухоли и контактный дерматит. Поражения кожи могут быть первичными или вторичными. Первичные поражения (например, пятна или папулы) появляются как прямой результат болезненного процесса. Вторичные поражения, такие как чешуйки или язвы, могут развиваться из первичных поражений или возникать в результате внешней травмы (например,г., инфекции, расчесывание). Дерматологические состояния часто можно диагностировать на основании истории болезни пациента и физического обследования, но для подтверждения диагноза могут потребоваться лабораторные исследования или биопсия. Для лечения дерматологических заболеваний используются лекарства (местные и системные) и такие процедуры, как хирургия, криотерапия, лучевая терапия или фототерапия. Местные методы лечения часто являются первым выбором, поскольку они вызывают меньше системных побочных эффектов и легко поддаются лечению.

    История болезни

    Физикальное обследование

    • Цель: изучить кожу (включая руки, рот и кожу головы) и ногти, чтобы помочь в определении рабочего диагноза или различий, а также любых возможных диагностических / лечебных шагов на основе наблюдений.
    • Методы обследования
      • Осмотр
      • Пальпация: оценка консистенции (например, мягкости, твердости) и глубины
      • Типичные кожные пробы, как указано
      • Осмотр дерматоскопом, как указано

    Руки, рот, кожу головы и ногти нельзя упускать из виду во время дерматологического обследования.

    • Определите тип поражения. См. Ниже первичные поражения кожи, вторичные поражения кожи и сложные поражения кожи.
    • Опишите характеристики поражения
      • Местоположение
      • Номер (один / несколько)
      • Размер
      • Цвет: например, розоватое обесцвечивание
      • Текстура: например, атрофическая, мозолистая, твердая, бородавчатая
      • Форма: например, круглая, овальная, кольцевая
      • Распределение
        • Симметричная / асимметричная
        • Односторонняя / двусторонняя
        • Диффузная / сгруппированная
      • Вторичные изменения (например, в результате царапания)

    Гвоздь экзамен

    Многие системные заболевания могут проявляться при обнаружении на руках пациента.

    Первичные поражения кожи

    (дерматология плоская) поражение кожи размером> 1 см, которое отличается по цвету от окружающей кожи (например, врожденный невус) 59

    Каталожные номера: [2] [3]

    Вторичные поражения кожи

    Обзор наиболее распространенных первичных поражений кожи
    Первичные поражения Описание


    A dermology
    Узелок (дерматология)
    • Возвышенное образование, оба диаметра> 1 см и глубина
    Зубной налет (дерматология)
    Везикула (дерматология)
    расщелина) Neros
    Обзор наиболее распространенных вторичных поражений кожи
    Вторичные поражения Описание
    Масштаб (дерматология)
    Язва (дерматология)
    • Более глубокие поражения округлой или неправильной формы, возникающие в результате потери эпидермиса и некоторой части дермы.
    Раздражение (царапины)
    • Истирание, вызванное механической силой, обычно затрагивающей эпидермис (но иногда достигающей внешнего слоя дермы)
    Атрофия кожи
    • Состоит из новой соединительной ткани, которая заменила утраченное вещество
    • Разрастание рубцовой ткани проявляется как келоид (утолщенная, приподнятая ткань, которая выходит за границы рубца и не показывает регрессии).

    Каталожные номера: [2] [3]

    Сложные поражения кожи

    Диагностические меры

    • Большинство кожных заболеваний можно диагностировать при обследовании кожи
    • Некоторым могут потребоваться дополнительные диагностические меры для подтверждения или мониторинга, в том числе:


    Обзор шагов лечения

    Варианты лечения

    Внешний характер кожи позволяет использовать различные варианты лечения, в том числе:

    • Системные лекарства
    • Местные лекарства
    • Физические процедуры
      • Хирургия
      • Криотерапия (лечение с использованием жидкого азота для воздействия на аномальные ткани очень низких температур и разрушения злокачественных или предраковых клеток; часто используется для лечения кожных поражений)
      • Лучевая терапия
      • Фототерапия

    Типы препаратов местного действия


    Лекарства должны абсорбироваться кожей, чтобы быть эффективными, поэтому выбор правильного типа препарата для местного применения для фармакологического средства очень важен.Примеры включают:

    • Кремы
    • Мази
    • Лосьоны, пены и гели

    Стероиды для местного применения

    Стероиды для местного применения являются наиболее часто используемым местным лечением в дерматологии.

    • Преимущества
      • Высокая терапевтическая ценность
      • Относительно безопасно: мало местных и системных побочных эффектов
    • Наиболее частые побочные эффекты
    • Типичные примеры

    Список литературы

    1. Принципы дерматологической практики — исследование CME кожи. https://www.dermnetnz.org/cme/principles/examination-of-the-skin/ . Обновлено: 1 января 2008 г. Доступ: 3 сентября 2017 г.
    2. Freeman et al. Мозоли и мозоли в результате механического гиперкератоза. Американский семейный врач . 2002 г. .
    3. Описание поражений кожи. http://www.msdmanuals.com/professional/dermatologic-disorders/approach-to-the-dermatologic-patient/description-of-skin-lesions .Обновлено: 1 июня 2016 г. Дата обращения: 15 мая 2017 г.
    4. Модуль первичной помощи в дерматологии, Номенклатура кожных поражений. https://web.pediatrics.wisc.edu/education/derm/text.html . Обновлено: 15 мая 2017 г. Дата обращения: 15 мая 2017 г.
    5. Люнг А.К., Чан К.В. Обследование ребенка с пурпурой. Ам Фам Врач . 2001; 64 (3): с.419-428.
    6. Принципы местной дерматологической терапии. http://www.merckmanuals.com/professional/dermatologic-disorders/principles-of-topical-dermatologic-therapy . Обновлено: 1 марта 2017 г. Доступ: 3 сентября 2017 г.
    7. Маркс Дж. Дж. Младший, Миллер Дж. Дж. Принципы дерматологии Lookingbill и Marks . Сондерс Эльзевир ; 2013
    8. Амирлак Б. Анатомия кожи. В: Caputy GG, Skin Anatomy . Нью-Йорк, штат Нью-Йорк: WebMD. http: // emedicine.medscape.com/article/1294744 . Обновлено: 18 июля 2015 г. Дата обращения: 15 мая 2017 г.
    9. Структура нормальной кожи. http://www.dermnetnz.org/topics/the-structure-of-normal-skin/ . Обновлено: 15 мая 2017 г. Дата обращения: 15 мая 2017 г.
    10. Слои кожи. https://training.seer.cancer.gov/melanoma/anatomy/layers.html . Обновлено: 15 мая 2017 г. Дата обращения: 15 мая 2017 г.
    11. Чжан С-Икс. Атлас гистологии . Springer Science & Business Media ; 2013

    Аморфные наночастицы диоксида кремния модулируют иммунные ответы в модели аллергического контактного дерматита

  • 1.

    Стёбер, В., Финк, А. и Бон, Э. Контролируемый рост монодисперсных сфер кремнезема в диапазоне микронных размеров. Journal of Colloid and Interface Science 26 , 62–69, https://doi.org/10.1016/0021-9797(68)

    -5 (1968).

    ADS Статья Google Scholar

  • 2.

    Osseo-Asare, K. & Arriagada, F. J. Получение наночастиц SiO 2 в неионогенной обратной мицеллярной системе. Коллоиды и поверхности 50 , 321–339, https://doi.org/10.1016/0166-6622(90)80273-7 (1990).

    CAS Статья Google Scholar

  • 3.

    Сульпизи, М., Гайджо, М.-П. И М. Сприк. Граница раздела кремний – вода: как силанолы определяют кислотность поверхности и изменяют свойства воды. Журнал химической теории и вычислений 8 , 1037–1047, https://doi.org/10.1021/ct2007154 (2012).

    CAS Статья PubMed Google Scholar

  • 4.

    Auffan, M. et al. . К определению неорганических наночастиц с точки зрения окружающей среды, здоровья и безопасности. Природные нанотехнологии 4 , 634–641, https://doi.org/10.1038/nnano.2009.242 (2009).

    ADS CAS Статья PubMed Google Scholar

  • 5.

    Contado, C. Наноматериалы в потребительских товарах: сложная аналитическая проблема. Frontiers in Chemistry 3 , 48, https://doi.org/10.3389/fchem.2015.00048 (2015).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 6.

    Сапино, С. и др. . Мезопористый диоксид кремния как актуальные наноносители для кверцетина: характеристика и исследований in vitro . Европейский журнал фармацевтики и биофармацевтики: официальный журнал Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V 89 , 116–125, https://doi.org/10.1016/j.ejpb.2014.11.022 (2015).

    CAS Статья Google Scholar

  • 7.

    Сапино, С., Олиаро-Боссо, С., Зонари, Д., Заттони, А. и Угазио, Э. Мезопористые наночастицы кремнезема как многообещающая система доставки метотрексата через кожу. Международный фармацевтический журнал 530 , 239–248, https://doi.org/10.1016/j.ijpharm.2017.07.058 (2017).

    CAS Статья PubMed Google Scholar

  • 8.

    Нафиси С., Самади Н. и Хушиар М. и Х. И. М. Мезопористые наночастицы кремнезема для улучшенной доставки лидокаина в кожу. Международный фармацевтический журнал . https://doi.org/10.1016/j.ijpharm.2018.08.004 (2018).

    Артикул PubMed Google Scholar

  • 9.

    Робинсон, К. Дж. и др. . Модифицированные кремнийорганические наночастицы Core-Shell для стабильного определения pH в биологических растворах. Датчики ACS 3 , 967–975, https://doi.org/10.1021/acssensors.8b00034 (2018).

    CAS Статья PubMed Google Scholar

  • 10.

    Дементо, С. Л. и др. . Наночастицы, активирующие инфламмасомы, как модульные системы для оптимизации эффективности вакцин. Vaccine 27 , 3013–3021, https://doi.org/10.1016/j.vaccine.2009.03.034 (2009).

    CAS Статья PubMed PubMed Central Google Scholar

  • 11.

    Вибово, Н. и др. . Совместное введение наночастиц, не являющихся носителями, усиливает антигенный иммунный ответ, не требуя конъюгации белков. Vaccine 32 , 3664–3669, https://doi.org/10.1016/j.vaccine.2014.04.043 (2014).

    CAS Статья PubMed Google Scholar

  • 12.

    Наварро-Товар, Г., Палестино, Г. и Росалес-Мендоза, С. Обзор роли материалов на основе диоксида кремния в разработке вакцины. Экспертная оценка вакцин 15 , 1449–1462, https://doi.org/10.1080/14760584.2016.1188009 (2016).

    CAS Статья PubMed Google Scholar

  • 13.

    Scheiblhofer, S. et al. . Возможности наночастиц для аллерген-специфической иммунотерапии — использование наночастиц кремнезема в качестве платформы для вакцинации. Экспертное заключение по доставке лекарств 13 , 1777–1788, https://doi.org/10.1080/17425247.2016.1203898 (2016).

    CAS Статья PubMed Google Scholar

  • 14.

    Бранденбергер, К. и др. . Созданные наночастицы диоксида кремния действуют как адъюванты для усиления аллергических заболеваний дыхательных путей у мышей. Токсикология частиц и волокон 10 , 26, https://doi.org/10.1186/1743-8977-10-26 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 15.

    Хан, Х. и др. . Токсическое и адъювантное действие наночастиц диоксида кремния на вызванное овальбумином аллергическое воспаление дыхательных путей у мышей. Респираторные исследования 17 , 60, https://doi.org/10.1186/s12931-016-0376-x (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 16.

    Моррис А. С. и др. . Аминовая модификация непористых наночастиц кремнезема снижает воспалительную реакцию после интратрахеальной инстилляции в легкие мыши. Письма о токсикологии 241 , 207–215, https://doi.org/10.1016/j.toxlet.2015.11.006 (2016).

    CAS Статья PubMed Google Scholar

  • 17.

    Parveen, A. et al. . Интраназальное воздействие наночастиц кремнезема вызывает изменения в провоспалительной среде головного мозга крысы. Токсикология и промышленное здоровье 33 , 119–132, https://doi.org/10.1177/0748233715602985 (2017).

    CAS Статья PubMed Google Scholar

  • 18.

    Hassankhani, R. et al. . In vivo токсичность перорально вводимых наночастиц диоксида кремния у здоровых взрослых мышей. Экология и исследования загрязнения, международные 22 , 1127–1132, https://doi.org/10.1007/s11356-014-3413-7 (2015).

    CAS Статья PubMed Google Scholar

  • 19.

    Тода, Т. и Йошино, С. Аморфные частицы нанокремнезема блокируют индукцию оральной толерантности у мышей. Журнал иммунотоксикологии 13 , 723–728, https://doi.org/10.3109/1547691x.2016.1171266 (2016).

    CAS Статья PubMed Google Scholar

  • 20.

    Набеши, Х. и др. . Зависимые от размера цитотоксические эффекты аморфных наночастиц кремнезема на клетки Лангерганса. Die Pharmazie 65 , 199–201 (2010).

    CAS PubMed Google Scholar

  • 21.

    Лян, Х. и др. . Цитотоксичность наночастиц кремнезема на клетки HaCaT. Журнал прикладной токсикологии: JAT 34 , 367–372, https://doi.org/10.1002/jat.2953 (2014).

    CAS Статья PubMed Google Scholar

  • 22.

    Набеши, Х. и др. . Системное распределение, проникновение в ядро ​​и цитотоксичность аморфного нанокремнезема после местного применения. Биоматериалы 32 , 2713–2724, https://doi.org/10.1016/j.biomaterials.2010.12.042 (2011).

    CAS Статья PubMed Google Scholar

  • 23.

    Рю, Х. Дж. и др. . Оценка токсичности наночастиц диоксида кремния после местного воздействия в течение 90 дней. Международный журнал наномедицины 9 (Приложение 2), 127–136, https://doi.org/10.2147/ijn.s57929 (2014).

    Артикул PubMed PubMed Central Google Scholar

  • 24.

    Мацуо К., Хиробе С., Окада Н. и Накагава С. Анализ проницаемости кожи и токсикологических свойств частиц аморфного кремнезема. Биологический и фармацевтический бюллетень 39 , 1201–1205, https://doi.org/10.1248/bpb.b16-00258 (2016).

    CAS Статья Google Scholar

  • 25.

    Luckhaupt, S. E. et al. . Распространенность дерматита среди работающего населения, США, Национальное опросное обследование состояния здоровья, 2010 г. Американский журнал промышленной медицины 56 , 625–634, https://doi.org/10.1002/ajim.22080 (2013).

    Артикул PubMed Google Scholar

  • 26.

    Лэндис, Э. Т., Дэвис, С. А., Тахери, А. и Фельдман, С. Р. Лучшие дерматологические диагнозы по возрасту. Интернет-журнал дерматологии 20 , 22368 (2014).

    PubMed Google Scholar

  • 27.

    Хелмик, К. Г., Ли-Хан, Х., Хирш, С. К., Бэрд, Т. Л. и Бартлетт, К. Л. Распространенность псориаза среди взрослых в США: Национальные обследования здоровья и питания в 2003–2006 и 2009–2010 годах. Американский журнал профилактической медицины 47 , 37–45, https://doi.org/10.1016/j.amepre.2014.02.012 (2014).

    Артикул PubMed PubMed Central Google Scholar

  • 28.

    Роберсон, Э. Д. и Боукок, А.М. Генетика псориаза: преодоление барьера. Тенденции в генетике: TIG 26 , 415–423, https://doi.org/10.1016/j.tig.2010.06.006 (2010).

    CAS Статья PubMed Google Scholar

  • 29.

    Де Бенедетто, А. и др. . Дефекты плотного соединения у пациентов с атопическим дерматитом. Журнал аллергии и клинической иммунологии 127 , 773-786.e771-777, https://doi.org/10.1016 / j.jaci.2010.10.018 (2011).

  • 30.

    Вольф, Р., Орион, Э., Руокко, Э. и Руокко, В. Аномальный эпидермальный барьер в патогенезе псориаза. Клиники дерматологии 30 , 323–328, https://doi.org/10.1016/j.clindermatol.2011.08.022 (2012).

    Артикул PubMed Google Scholar

  • 31.

    Лайонс, Дж. Дж., Милнер, Дж. Д. и Стоун, К. Д. Атопический дерматит у детей: клинические особенности, патофизиология и лечение. Клиники иммунологии и аллергии Северной Америки 35 , 161–183, https://doi.org/10.1016/j.iac.2014.09.008 (2015).

    Артикул PubMed Google Scholar

  • 32.

    Джатана, С., Палмер, Б. К., Фелан, С. Дж. И ДеЛуиз, Л. А. Иммуномодулирующие эффекты наночастиц на кожу. Аллергия. Научные отчеты 7 , 3979, https://doi.org/10.1038/s41598-017-03729-2 (2017).

    ADS CAS Статья PubMed Google Scholar

  • 33.

    Хонда Т., Эгава Г., Граббе С. и Кабашима К. Обновление иммунных событий в модели контактной гиперчувствительности мышей: к пониманию аллергического контактного дерматита. Журнал следственной дерматологии 133 , 303–315, https://doi.org/10.1038/jid.2012.284 (2013).

    CAS Статья PubMed Google Scholar

  • 34.

    Askenase, P. W. & Tsuji, R. F. B-1 B-клеточные IgM-антитела инициируют Т-клеточную активацию контактной чувствительности. Актуальные темы микробиологии и иммунологии 252 , 171–177 (2000).

    CAS PubMed Google Scholar

  • 35.

    Askenase, P. W. et al. . Подмножество зависимых от СПИДа клеток B-1a инициирует гиперчувствительность и устойчивость к пневмококковой пневмонии. Анналы Нью-Йоркской академии наук 1362 , 200–214, https://doi.org/10.1111/nyas.12975 (2015).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 36.

    Phanuphak, P., Moorhead, J. W. & Claman, H. N. Переносимость и контактная чувствительность к DNFB у мышей. I. In vivo обнаружение по отеку уха и корреляция со стимуляцией клеток in vitro . Журнал иммунологии 112 , 115–123 (1974).

    CAS Google Scholar

  • 37.

    Welzel, J., Metker, C., Wolff, H.H. & Wilhelm, K.P. Раздраженная SLS кожа человека не обнаруживает корреляции между степенью пролиферации и увеличением TEWL. Архив дерматологических исследований 290 , 615–620 (1998).

    CAS Статья Google Scholar

  • 38.

    Краузе К., Мец М., Макрис М., Цубербьер Т. и Маурер М. Роль интерлейкина-1 в расстройствах, связанных с аллергией. Текущее мнение в области аллергии и клинической иммунологии 12 , 477–484, https://doi.org/10.1097/ACI.0b013e3283574d0c (2012).

    CAS Статья PubMed Google Scholar

  • 39.

    Дилулио, Н.А. и др. . Рекрутинг нейтрофилов, опосредованный Groalpha, необходим для выявления контактной гиперчувствительности. Европейский журнал иммунологии 29 , 3485–3495, 10.1002 / (sici) 1521-4141 (199911) 29:11 <3485 :: help-immu3485> 3.0.co; 2-b (1999).

  • 40.

    Бидерманн, Т. Тучные клетки контролируют рекрутирование нейтрофилов во время опосредованных Т-клетками реакций гиперчувствительности замедленного типа через фактор некроза опухоли и воспалительный белок макрофагов 2. 192 , 1441–1452 (2000).

  • 41.

    Кондо, С., Маккензи, Р. С. и Саудер, Д. Н. Интерлейкин-10 подавляет фазу выявления аллергической контактной гиперчувствительности. Журнал следственной дерматологии 103 , 811–814, https://doi.org/10.1111/1523-1747.ep12413470 (1994).

    CAS Статья PubMed Google Scholar

  • 42.

    Watanabe, H. et al. . Активация инфламмасомы, обрабатывающей IL-1β, вызывает контактную гиперчувствительность. Журнал следственной дерматологии 127 , 1956–1963, https://doi.org/10.1038/sj.jid.5700819 (2007).

    CAS Статья PubMed Google Scholar

  • 43.

    Girard-Madoux, M. J., Kel, J. M., Reizis, B. & Clausen, B. E. IL-10 контролирует индуцированную дендритными клетками реактивацию Т-клеток в коже для ограничения контактной гиперчувствительности. Журнал аллергии и клинической иммунологии 129 , 143-150.e141-110, https://doi.org/10.1016/j.jaci.2011.08.032 (2012).

  • 44.

    Grone, A. Кератиноциты и цитокины. Ветеринарная иммунология и иммунопатология 88 , 1–12 (2002).

    CAS Статья Google Scholar

  • 45.

    Кассателла М.А. и др. . Регулируемая продукция хемокина, индуцируемого гамма-интерфероном, протеином-10 (IP-10) нейтрофилами человека. Европейский журнал иммунологии 27 , 111–115, https: // doi.org / 10.1002 / eji.1830270117 (1997).

    CAS Статья PubMed Google Scholar

  • 46.

    Дюфур, Дж. Х. и др. . Мыши с дефицитом IFN-гамма-индуцируемого белка 10 (IP-10; CXCL10) обнаруживают роль IP-10 в генерации и транспортировке эффекторных Т-клеток. Журнал иммунологии 168 , 3195–3204 (2002).

    CAS Статья Google Scholar

  • 47.

    Krathwohl, M. D. и Anderson, J. L. Хемокин CXCL10 (IP-10) достаточен для запуска иммунного ответа на введенные антигены в мышиной модели. Vaccine 24 , 2987–2993, https://doi.org/10.1016/j.vaccine.2005.11.032 (2006).

    CAS Статья PubMed Google Scholar

  • 48.

    Vocanson, M. et al. . Вклад CD4 (+) и CD8 (+) Т-клеток в контактную гиперчувствительность и аллергический контактный дерматит. Обзор клинической иммунологии 1 , 75–86, https://doi.org/10.1586/1744666x.1.1.75 (2005).

    CAS Статья PubMed Google Scholar

  • 49.

    Vocanson, M. et al. . CD8 + Т-клетки являются эффекторными клетками контактного дерматита по отношению к обычным кожным аллергенам у мышей. Журнал исследовательской дерматологии 126 , 815–820, https://doi.org/10.1038/sj.jid.5700174 (2006).

    CAS Статья PubMed Google Scholar

  • 50.

    Прокш, Э., Бранднер, Дж. М. и Йенсен, Дж. М. Кожа: непременный барьер. Экспериментальная дерматология 17 , 1063–1072 (2008).

    Артикул Google Scholar

  • 51.

    Ларезе Филон, Ф., Мауро, М., Адами, Г., Бовензи, М. и Крозера, М. Поглощение наночастиц кожей: новые аспекты оценки профиля безопасности. Нормативная токсикология и фармакология 72 , 310–322, https://doi.org/10.1016/j.yrtph.2015.05.005 (2015).

    CAS Статья PubMed Google Scholar

  • 52.

    Доктер Д. и др. . Белковая корона защищает от размерной и дозозависимой токсичности наночастиц аморфного кремнезема. Beilstein J Nanotechnol 5 , 1380–1392, https://doi.org/10.3762/bjnano.5.151 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 53.

    Энгеман, Т., Горбачев, А.В., Киш, Д. и Фэйрчайлд, Р. Л. Интенсивность инфильтрации нейтрофилов контролирует количество примированных антигеном CD8 Т-клеток, рекрутированных в участки кожного заражения антигеном. Журнал биологии лейкоцитов 76 , 941–949, https://doi.org/10.1189/jlb.0304193 (2004).

    CAS Статья PubMed Google Scholar

  • 54.

    Ван, Т. и др. . Усиленные слизистые и системные иммунные ответы, полученные с помощью наночастиц пористого диоксида кремния, используемых в качестве адъюванта пероральной вакцины: влияние архитектуры диоксида кремния на иммунологические свойства. Международный фармацевтический журнал 436 , 351–358, https://doi.org/10.1016/j.ijpharm.2012.06.028 (2012).

    CAS Статья PubMed Google Scholar

  • 55.

    Моди, К. Т. и др. .Наночастицы мезопористого диоксида кремния в качестве носителей антигена и адъювантов для доставки вакцин. Nanoscale 5 , 5167–5179, https://doi.org/10.1039/c3nr00357d (2013).

    ADS CAS Статья PubMed Google Scholar

  • 56.

    Скрастина Д. и др. . Наночастицы кремнезема в качестве адъюванта для иммунизации мышей с использованием ядерных вирусоподобных частиц гепатита В. PloS one 9 , e114006, https: // doi.org / 10.1371 / journal.pone.0114006 (2014).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 57.

    Тода, Т. и Йошино, С. Усиление овальбумин-специфических иммунных ответов Th2, Th3 и Th27 аморфными наночастицами кремнезема. Международный журнал иммунопатологии и фармакологии 29 , 408–420, https://doi.org/10.1177/0394632016656192 (2016).

    Артикул PubMed PubMed Central Google Scholar

  • 58.

    Хираи, Т. и др. . Наночастицы аморфного кремнезема в зависимости от размера усугубляют поражения кожи, похожие на атопический дерматит, после внутрикожной инъекции. Токсикология частиц и волокон 9 , 3, https://doi.org/10.1186/1743-8977-9-3 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 59.

    Yanagisawa, R. et al. . Наночастицы диоксида титана усугубляют поражение кожи, подобное атопическому дерматиту, у мышей NC / Nga. Экспериментальная биология и медицина (Мэйвуд, Нью-Джерси) 234 , 314–322, https://doi.org/10.3181/0810-rm-304 (2009).

    CAS Статья Google Scholar

  • 60.

    Smulders, S., Golanski, L., Smolders, E., Vanoirbeek, J. & Hoet, P.H. Nano-TiO2 модулирует способность динитрохлорбензола к сенсибилизации кожи после местного воздействия. Британский дерматологический журнал 172 , 392–399, https: // doi.org / 10.1111 / bjd.13295 (2015).

    CAS Статья PubMed Google Scholar

  • 61.

    Hirai, T. et al. . Воздействие на кожу агломератов наночастиц диоксида кремния и аллергена приводит к иммунному ответу, обусловленному IgE, и повышенной чувствительности к анафилаксии у мышей. Токсикология частиц и волокон 12 , 16, https://doi.org/10.1186/s12989-015-0095-3 (2015).

    CAS Статья PubMed PubMed Central Google Scholar

  • 62.

    Островски, А. и др. . Наночастицы диоксида кремния, функционализированные AHAPS, не модулируют аллергический контактный дерматит у мышей. Письма о наноразмерных исследованиях 9 , 524, https://doi.org/10.1186/1556-276x-9-524 (2014).

    ADS Статья PubMed PubMed Central Google Scholar

  • 63.

    Бхол, К. и Шехтер, П. Дж. Крем с нанокристаллическим серебром для местного применения подавляет воспалительные цитокины и индуцирует апоптоз воспалительных клеток на мышиной модели аллергического контактного дерматита. Британский дерматологический журнал 152 , 1235–1242, https://doi.org/10.1111/j.1365-2133.2005.06575.x (2005).

    CAS Статья PubMed Google Scholar

  • 64.

    Вемула, П. К., Андерсон, Р. Р. и Карп, Дж. М. Наночастицы уменьшают аллергию на никель, улавливая ионы металлов. Nature nanotechnology 6 , 291–295, https://doi.org/10.1038/nnano.2011.37 (2011).

    ADS CAS Статья PubMed Google Scholar

  • 65.

    Мортенсен, Л. Дж. и др. . Количественная оценка проникновения квантовых точек в кожу мышей с нарушением УФИ-барьера. Нанотоксикология 7 , 1386–1398, https://doi.org/10.3109/17435390.2012.741726 (2013).

    CAS Статья PubMed Google Scholar

  • 66.

    Джатана, С., Каллахан, Л. М., Пентланд, А. П. и ДеЛуиз, Л. А. Влияние косметических лосьонов на проникновение наночастиц через ex vivo C57BL / 6 Голая мышь и кожа человека: сравнительное исследование. Косметика 3 , https://doi.org/10.3390/cosmetics3010006 (2016).

  • 67.

    Jatana, S., Palmer, BC, Phelan, SJ, Gelein, R. & DeLouise, LA In vivo количественная оценка системного транспорта квантовых точек у безволосых мышей C57BL / 6 после нанесения на кожу пост-ультрафиолетового излучения . Токсикология частиц и волокон 14 , 12, https://doi.org/10.1186/s12989-017-0191-7 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 68.

    Хираи, Т. и др. . Кожная абсорбция частиц аморфного нанокремнезема после местного воздействия в течение трех дней. Die Pharmazie 67 , 742–743 (2012).

    CAS PubMed Google Scholar

  • 69.

    Тан, Л., Чжан, К., Сонг, Г., Цзинь, X. и Сюй, З. In vivo проникновение в кожу и метаболический путь квантовых точек. Наука Китая . Науки о жизни 56 , 181–188, https: // doi.org / 10.1007 / s11427-012-4404-x (2013 г.).

    CAS Статья PubMed Google Scholar

  • 70.

    Wei, J. C. J. et al. . Аллометрическое масштабирование толщины кожи, эластичности, вязкоупругости по массе для перевода микромедицинских устройств: от мышей, крыс, кроликов, свиней к людям. Научные отчеты 7 , 15885, https://doi.org/10.1038/s41598-017-15830-7 (2017).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 71.

    Филон, Ф. Л. и др. . Проникновение в кожу человека наночастиц золота через неповрежденную и поврежденную кожу. Nanotoxicology 5 , 493–501, https://doi.org/10.3109/17435390.2010.551428 (2011).

    CAS Статья PubMed Google Scholar

  • 72.

    Ранкан, Ф. и др. . Проникновение в кожу и поглощение клетками аморфных наночастиц кремнезема с переменным размером, функционализацией поверхности и коллоидной стабильностью. ACS nano 6 , 6829–6842, https://doi.org/10.1021/nn301622h (2012).

    CAS Статья PubMed Google Scholar

  • 73.

    Ахамед, М. Цитотоксичность, окислительный стресс и апоптоз, индуцированная наночастицами кремнезема в культивируемых клетках A431 и A549. Человек и экспериментальная токсикология 32 , 186–195, https://doi.org/10.1177/0960327112459206 (2013).

    CAS Статья Google Scholar

  • 74.

    Саху Р. П. и др. . Воздействие сигаретного дыма подавляет контактную гиперчувствительность за счет образования агонистов фактора активации тромбоцитов. Журнал иммунологии (Балтимор, Мэриленд: 1950) 190 , 2447–2454, https://doi.org/10.4049/jimmunol.1202699 (2013).

    CAS Статья Google Scholar

  • 75.

    Mytych, J., Wnuk, M. & Rattan, S. I. Низкие дозы наноалмазов и наночастиц кремнезема оказывают благоприятное горметическое действие на нормальные фибробласты кожи человека в культуре. Chemosphere 148 , 307–315, https://doi.org/10.1016/j.chemosphere.2016.01.045 (2016).

    ADS CAS Статья PubMed Google Scholar

  • 76.

    Lin, C. et al. . Активация транскрипции фоллистатина с помощью Nrf2 защищает эпителиальные клетки легких от окислительного стресса, вызванного наночастицами кремнезема. Научные отчеты 6 , 21133, https://doi.org/10.1038/srep21133, https: // www.nature.com/articles/srep21133#supplementary-information (2016).

  • 77.

    Каплан Д. Х. Ранние события в индукции аллергического контактного дерматита. 12 , 114-124, https://doi.org/10.1038/nri3150.

  • 78.

    Эль Али, З. и др. . Аллергическое воспаление кожи, вызванное химическими сенсибилизаторами, контролируется фактором транскрипции Nrf2. Токсикологические науки: официальный журнал Общества токсикологов 134 , 39–48, https: // doi.org / 10.1093 / toxsci / kft084 (2013).

    CAS Статья Google Scholar

  • 79.

    Marquardt, C., Fritsch-Decker, S., Al-Rawi, M., Diabate, S. & Weiss, C. Аутофагия, вызванная наночастицами кремнезема, защищает макрофаги RAW264.7 от гибели клеток. Токсикология 379 , 40–47, https://doi.org/10.1016/j.tox.2017.01.019 (2017).

    CAS Статья PubMed Google Scholar

  • 80.

    Шнайдер, К. А., Расбанд, В. С. и Элисейри, К. В. NIH Image to ImageJ: 25 лет анализа изображений. Природные методы 9 , 671–675 (2012).

    CAS Статья Google Scholar

  • Смесь полифенолов и антоцианов из Vaccinium uliginosum L. облегчает атопический дерматит, индуцированный DNCB, у мышей NC / Nga

    Vaccinium uliginosum L . (VU) обладает различными биологическими свойствами, такими как антиоксидантные и защитные эффекты против фотостарения кожи, вызванного VU.Целью данного исследования является оценка эффектов перорального введения смеси полифенолов и антоцианов, полученных из VU, на 2,4-динитрохлорбензол (DNCB-), индуцированный атопическим дерматитом (AD) у мышей NC / Nga. Мы оценивали анти-AD эффекты на мышиной модели NC / Nga в течение 9 недель. Пероральное введение смеси значительно облегчило кожные симптомы и клинические признаки, похожие на AD, включая толщину ушей и поведение почесывания. Смесь, вводимая перорально, снижала уровень IgE и IgG1, тогда как она увеличивала уровень IgG2a дозозависимым образом.Расчетное соотношение IgG1 / IgG2a для каждой мыши показало, что смесь, полученная из VU, также значительно снижает соотношение Th3 / Th2, IL-4 и IL-13 (как цитокины Th3), IFN-, γ и IL-12 (как цитокин Th2) в селезенке. Кроме того, он значительно снижал экспрессию генов, таких как IL-4, IL-5, CCR3, эотаксин-1, IL-12, IFN-, γ , MCP-1 и IL-17, в AD-подобных поражениях и подавленный Th27. Гистологический анализ показал, что толщина эпидермиса и количество воспалительных клеток значительно уменьшились.В заключение подтверждено, что пероральное введение смеси при AD, вызванном DNCB, улучшает течение болезни AD у мышей.

    1. Введение

    Атопический дерматит (БА) — это хроническое и рецидивирующее воспалительное заболевание кожи, зависящее от взаимодействия экологических, иммунологических и генетических факторов [1]. Заболеваемость БА постоянно растет во всем мире, с уровнем распространенности примерно 10–20%, и чаще встречается среди младенцев и детей. БА — многофакторное кожное заболевание со сложным взаимодействием иммунных врожденных и адаптивных иммунных ответов, основанных на сильной генетической предрасположенности и вызванных факторами окружающей среды [2]. Vaccinium uliginosum L . (VU), известная как болотная черника, обладает антиоксидантным и защитным действием против фотостарения кожи, вызванного VU [3, 4]. Предыдущее исследование показало, что ягоды обладают противовоспалительным действием [5]. Мы исследуем эффекты полифенолов и антоцианов, полученных из VU. В коже с БА расчесы вызывают выработку цитокинов и хемокинов и усиливают экспрессию молекул адгезии. Эти процессы сопровождаются инфильтрацией поражений кожи лимфоцитами, тучными клетками, эозинофилами и нейтрофилами.БА — двухфазное воспалительное заболевание кожи, которое можно разделить на две фазы [6]. В острой фазе поражения кожи при БА преимущественно секретируют цитокины Th3 IL-4, IL-5 и IL-13, тогда как в хронической фазе клетки Th2 секретируют IFN-γ [7, 8]. БА провоцируется иммунными ответами Th2 / Th3 [9]. Нарушение баланса иммунных ответов Th2 и Th3 играет важную роль в развитии БА [10, 11]. Воспалительный инфильтрат БА преимущественно состоит из дендритных клеток (ДК) и CD4 + Т-клеток памяти.По существу, все Т-клетки, инфильтрирующие кожные поражения, экспрессируют кожный антиген, связанный с лимфоцитами (CLA). Недавнее открытие особой субпопуляции Т-хелперов, называемой клетками Th27, на основе их продукции IL-17 привело к трансформации парадигмы Th2 / Th3 иммунитета в новую точку зрения [12]. Мы также измеряем цитокины Th2, Th3 и Th27, чтобы определить эффективность смеси полифенолов и антоцианов. Самый высокий процент клеток, продуцирующих ИЛ-17, был обнаружен у пациентов с БА.Эти активности IL-17 могут способствовать фиброзу тканей и хроническому развитию воспалительного процесса [13]. Хорошо известно, что патогенез БА демонстрирует родственные, но различные свойства IgE-опосредованной гиперчувствительности, отражающие комплексное участие экологических, генетических и неиммунологических факторов [14, 15]. Первоначальные механизмы, вызывающие воспаление кожи у пациентов с БА, неизвестны [16]. Местные стероиды, смягчающие средства и пероральные антигистаминные препараты используются в качестве терапии первой линии для лечения AD; однако многих пациентов беспокоит длительное использование этих препаратов [17].Следовательно, существует потребность в новом реагенте с минимальными побочными эффектами. Цель нашего исследования — показать эффект смешанной фракции у мышей NC / Nga, получавших ДНКБ, на индукцию БА.

    Vaccinium uliginosum L . (VU) обладает различными биологическими свойствами, такими как антиоксидантные и защитные эффекты против фотостарения кожи, вызванного VU. Целью данного исследования является оценка эффектов перорального введения смеси полифенолов и антоцианов, полученных из VU, на 2,4-динитрохлорбензол (DNCB-), индуцированный атопическим дерматитом (AD) у мышей NC / Nga.Мы оценивали анти-AD эффекты на мышиной модели NC / Nga в течение 9 недель. Пероральное введение смеси значительно облегчило кожные симптомы и клинические признаки, похожие на AD, включая толщину ушей и поведение почесывания. Смесь, вводимая перорально, снижала уровень IgE и IgG1, тогда как она увеличивала уровень IgG2a дозозависимым образом. Расчетное соотношение IgG1 / IgG2a для каждой мыши показало, что смесь, полученная из VU, также значительно снижает соотношение Th3 / Th2, IL-4 и IL-13 (как цитокины Th3), IFN-, γ и IL-12 (как цитокин Th2) в селезенке.Кроме того, он значительно снижал экспрессию генов, таких как IL-4, IL-5, CCR3, эотаксин-1, IL-12, IFN-, γ , MCP-1 и IL-17, в AD-подобных поражениях и подавленный Th27. Гистологический анализ показал, что толщина эпидермиса и количество воспалительных клеток значительно уменьшились. В заключение подтверждено, что пероральное введение смеси при AD, вызванном DNCB, улучшает течение болезни AD у мышей.

    2. Материалы и методы
    2.1. Приготовление
    Vaccinium uliginosum L .Фракции

    Vaccinium uliginosum L . (VU) — это вид растений Vaccinium , который представляет собой род кустарников или карликовых кустарников из семейства вересковых, обитающих в Северной Корее, Европе и Америке. Известно, что VU содержит органические кислоты, витамины, гликозиды и антоцианы и обладает антиоксидантной активностью [18, 19]. Водный раствор упаривали и хранили при -40 ° C до использования. Водные экстракты VU были дополнительно разделены на полифенольные, антоциановые (пигментные) и сахар / кислотные фракции с использованием этилацетата, кислого метанола (MeOH) и 0.01 N HCl.

    2.2. Фракционирование
    Vaccinium uliginosum L . Экстракты с использованием картриджа C18 Sep-Pak

    Для исследования состава экстракта было выполнено простое фракционирование с использованием предварительно кондиционированных картриджей C18 Sep-Pak для отделения антоцианов от фенольных соединений, не являющихся антоцианинами. Vaccinium uliginosum L . растворяется в дистиллированной воде. Подготовленный путем последовательного элюирования с использованием этилацетата, кислого метанола (MeOH) и 0,01 N HCl, соответственно, через картриджи приготовленный общий экстракт загружали в катриджи.Удалите фракции сахара / кислоты с помощью 0,01 N водной HCl. Картриджи элюировали этилацетатом (слой фенольных соединений), а затем фенольные соединения собирали в пробирку. Абсорбированный антоцианин элюировали из картриджей абсолютным МеОН с 0,1% (об. / Об.) HCl и собирали в пробирки. Растворители фракций удаляли с помощью роторного испарителя при пониженном давлении при 20 ° C и 40 ° C соответственно. Следовательно, мы можем получить полифенолы и антоцианы из VU, который равен 1.8% и 4,1% экстракта соответственно. Практикуйте фракционирование Vaccinium uliginosum L . экстракты во время лечения 1 раз в неделю. Такое окисление антоциана не стоило внимания.

    2.3. Животное

    Четырехнедельные самцы мышей NC / Nga были приобретены в SLC (Сидзуока, Япония) и помещены в индивидуально вентилируемые клетки (IVC) при ° C и влажности% с циклом свет-темнота от 12 до 12 часов (свет 7:30 — 19:30) в условиях СПФ в экспериментальном периоде.Животных содержали в постоянных условиях окружающей среды и кормили стандартной лабораторной диетой (Jongang Lab Animal, Сеул, Корея) с водой ad libitum. Все экспериментальные процедуры проводились в соответствии с протоколом, утвержденным директивой Институционального комитета по уходу и использованию животных Университета Кён Хи.

    2.4. Индукция AD у мышей NC / Nga

    Хлор-2,4-динитробензол (DNCB) (Sigma-Aldrich, Сент-Луис, Миссури, США) использовали для индукции AD-подобного дерматита в отрицательном контроле, положительном контроле и группы лечения мышей NC / Nga [20].Вкратце, спинные волосы мышей NC / Nga удаляли с помощью электробритвы и крема для удаления волос, содержащего тиогликолевую кислоту, дважды в неделю. На следующий день после последней эпиляции кожу спины и правое ухо мышей NC / Nga сенсибилизировали 200 мкл л 1% смеси DNCB (1% DNCB, растворенный в ацетоне и этаноле (2: 3 об. / Об.)). Через четыре дня 200 мкл л 1% смеси ДНКБ обрабатывали еще раз для второй сенсибилизации. Через неделю после первой сенсибилизации в кожу спины и правое ухо мышей NC / Nga вводили 150 мкл л 0.Смесь 4% DNCB (0,4% DNCB, растворенного в ацетоне и оливковом масле (3: 1 об. / Об.)). Обработку 0,4% смесью DNCB повторяли три раза в неделю в течение 9 недель.

    2,5. Пероральное введение смеси полифенолов и антоцианов

    Индукция AD-подобных поражений кожи через 9 недель мышей разделили на шесть групп в соответствии с дозой смеси полифенолов и антоцианов: 0 (нормальный), 0 (отрицательный контроль), 0 (положительный контроль), поли + анто мк г / кг · мт. Фракции растворяли в 10% твине 80.Для групп нормального и отрицательного контроля вводили 10% твин 80 вместо смеси фракций. Кроме того, группу положительного контроля лечили преднизолоном (3 мг / кг · м.т.), растворенным в 10% твине 80.

    2.6. Измерение степени тяжести кожи и толщины ушей

    После обработки образцов тяжесть дерматита оценивалась макроскопически слепым методом с использованием следующей процедуры подсчета баллов [21]. Вкратце, поражения кожи спины и ушей оценивали по следующим критериям.Оценка рассчитывалась как сумма индивидуальных оценок следующих пяти симптомов: сухость, лихенификация (шелушение), экскориация, эритема / отек и эрозия. Для каждого кожного симптома индивидуальная оценка оценивалась следующим образом: 0 (симптомы отсутствуют), 1 (легкие), 2 (умеренные) и 3 (тяжелые). Степень тяжести кожи оценивалась одним опытным человеком за 1 час до обработки образца. Толщина уха измерялась три дня в неделю с помощью измерителя толщины (Mitutoyo Corporation, Токио, Япония) на правом ухе каждой мыши.

    2.7. Измерение поведения царапания Тест

    Общее количество царапин измеряли три раза в неделю, как описано ранее с небольшими изменениями [22]. Вкратце, после перорального введения смеси или преднизолона мышей каждой группы помещали в новую прозрачную пластиковую клетку на 1 час привыкания. После привыкания количество эпизодов расчесывания в течение 30 мин подсчитывали макроскопически [23]. За один царапающий эпизод засчитывалась серия царапающих движений только задней лапой.Каждый эпизод царапанья оценивался от 0 до 4: 0 (царапание отсутствует), 2 (царапание менее 1,5 с) и 4 (царапание более 1,5 с) [24]. Общее количество царапин рассчитывалось как сумма индивидуальных баллов.

    2,8. Анализ сывороточного иммуноглобулина

    Уровни иммуноглобулина в сыворотке определяли с использованием наборов для твердофазного иммуноферментного анализа. Сыворотку IgE определяли с помощью набора мышиного IgE ELISA (Shibayagi, Япония), а IgG1, IgG2a определяли с помощью наборов мышиных IgG1, IgG2a (Австралия и Новая Зеландия).ELISA выполняли в соответствии с инструкциями производителя. После последней обработки мышей анестезировали диэтиловым эфиром и перед умерщвлением собирали образец крови из нижней полой вены и давали возможность свернуться в течение 30 минут при комнатной температуре. Сыворотку получали центрифугированием и хранили при -70 ° C до использования. Нижние пределы обнаружения IgE, IgG1 и IgG2a составляли 1, 7,8 и 7,8 нг / мл соответственно.

    2.9. Продукция цитокинов селезенки

    После последней обработки мышей умерщвляли смещением шейных позвонков и получали селезенки каждой мыши.В засеянный 24-луночный планшет при концентрации клеток / лунку в среде RPMI 1640 добавляли 10% FBS, 100 Ед / мл пенициллина и 50 мкл мкг / мл стрептомицина. Спленоциты стимулировали 5 мкг мкг / мл Con A и инкубировали в течение 72 часов. После инкубации среду из каждой лунки аспирировали, супернатант собирали центрифугированием и хранили при -70 ° C до использования. Уровни IL-4, IFN-, γ , IL-12 и IL-13 в супернатанте измеряли с помощью коммерческих наборов ELISA (Австралия и Новая Зеландия, Сан-Диего, Остин, Техас и Сан-Диего) в соответствии с рекомендациями каждого производителя. инструкции.Нижние пределы обнаружения для IL-4, IFN-, γ , IL-12 и IL-13 составляли 7,8, 7,8, 15,6 и 10 пг / мл соответственно.

    2.10. Анализ ПЦР в реальном времени

    В каждом эксперименте использовали не менее пяти мышей на группу. Суммарную РНК выделяли из тканей кожи с использованием реагента TRIzol (Invitrogen) в соответствии с протоколом производителя. После завершения количественного анализа РНК была проведена обратная транскрипция с использованием Oligo dT (Promega), обратной транскриптазы M-MLV (Promega), 10 мМ смеси dNTP, 5-кратного буфера синтеза кДНК и ингибитора РНКазы.Амплификацию проводили следующим образом: начальная активация фермента при 40 циклах: 42 ° C в течение 1 часа, 94 ° C в течение 5 минут и 4 ° C в течение 1 часа. Препараты кДНК смешивали со смесью супермикса SYBR Green (TaKaRa) и анализировали 5 мкМ праймеров на машине для ПЦР в реальном времени (TaKaRa Laboratories). Согласно сравнительному методу Ct, экспрессия гена была нормализована до экспрессии гена домашнего хозяйства β -актина [25]. Следующие праймеры были использованы для реакций ПЦР (5’– 3 ‘) (Таблица 1).Относительную экспрессию каждого гена (кратное изменение к контролю) рассчитывали согласно сравнительному методу Ct по формуле: с [26].

    Обзор сложных повреждений кожи [4]
    Сложные поражения Описание


    9 Вызвано кровотечением в подкожную клетчатку, мышцу, ткань органа или полость
    • Сразу после травмы: красный
    • Через 24–96 ч: темно-красный; фиолетовый; синий / черный
      • Причина: кровь свертывается и гемоглобин разлагается до желчного пигмента.
    • Через 4–7 дней: темно-зеленый
    • Через 7 дней: желтый; коричневатый
    Подтипы гематом = пурпура Непальпируемая пурпура


      6 7 Плоские, красно-пурпурные, более крупная форма петехий, размером> 5 мм
    Пальпируемая пурпура
    • Выступающие красно-пурпурные очаги
    Высыпания Экзантема
    • 72 Расширенная равномерная сыпь (локализованная или генерализованная
    • Покраснение кожи в результате расширения сосудов (бледнеет при надавливании)
    • Общее покраснение кожи
    Макулопапулезная сыпь
    Дальнейшие поражения Лихенификация
    • Утолщение кожи с подчеркнутыми отметинами на коже

    Ген Метод количественной оценки Последовательность (5′-3 ‘) Tm (° C)

    Обратный праймер TTGTGTAAGGTAAGGTGTGC 55

    Эотаксин-1 / CCL11 Прямой праймер CACCCTGAAAGCCATAGTGT 57
    Обратный праймер TGTGTACCTGGGAAATTAG 53

    ИЛ-4 Прямой праймер GTCTGCTGTGGCATATTCTG 57
    Обратный праймер GGCATTTCTCATTCAGATTC 53

    ИФН-гамма- Прямой передний эр CTCTGAGACAATGAACGCTACACACT 61
    Обратный праймер TGGCAGTAACAGCCAGAAACAG 60

    ИЛ-5 Прямой праймер GGCTACACAGAGAAACCCTGT 59
    Обратный праймер CATGCATACACAGGTAGTTCA 55

    CCR4 Прямой праймер TCGCCTTGTTTCAGTCAGG 57
    Обратный праймер CTTGCCATGGTCTTGGTTTT 55

    Обратный праймер AAAGAGCCGAAGGTGTTTCC 57

    ATC 9-23 MCPAC 9-23 MCPAC CGAG 57
    Обратный праймер TGAATGTGAAGTTGACCCGT 55

    Ил-17 Прямой праймер AAGGCAGCAGCGATCATCC 59
    Обратный праймер GGAACGGTTGAGGTAGTCTGAG 61

    2.11. Гистологический анализ

    После окончания эксперимента кожу спины и ушей фиксировали 10% формалином и заливали парафином. Срезы окрашивали H и E и толуидиновым синим для обнаружения эозинофилов и подсчета толщины эпидермиса, а также эозинофилов или тучных клеток и дегранулированных тучных клеток.

    2.12. Функциональный тест печени и почек

    Сывороточные уровни активности GPT и BUN определяли с использованием наборов для анализа. Набор был выполнен в соответствии с инструкциями производителя.

    2.13. Статистический анализ

    Данные были выражены как среднее ± стандартное отклонение (SD). Различия между группами оценивали с помощью критерия Стьюдента. Статистически значимым считалось значение A <0,05.

    3. Результат
    3.1. Оценка AD-подобных симптомов, вызванных лечением DNCB
    Было показано, что у мышей

    NC / Nga при повторном применении DNCB в течение 9 недель развиваются поражения кожи, подобные AD. В нормальной группе не было никаких физических признаков дерматита, тогда как в группе с вызванной кожей AD было пять симптомов сухости, лихенификации (шелушения), экскориации, эритемы / отека и эрозии на ушах и спине.Оценка дерматита у мышей NC / Nga увеличивалась после повторного применения DNCB. Мы получили оценку дерматита в диапазоне от 11 до 12 после 9 недель лечения DNCB в группе атопического дерматита, и был измерен общий уровень IgE в сыворотке каждой мыши. Уровень общего IgE в группе AD составил 7849 нг / мл, что намного выше, чем в нормальной группе (37 нг / мл) (Рисунок 1). На основании этих результатов экспериментальные группы были разделены на шесть групп. Таким образом, был успешно индуцирован AD-подобный дерматит.

    3.2. Аллервирующий эффект смеси на тяжесть кожи.

    NC / Nga оценивали на наличие AD-подобных симптомов, вызванных обработкой DNCB. Мы рассматривали полное развитие AD через 9 недель (оценка> 11). У мышей NC / Nga развилась AD, вызванная местным нанесением DNCB, что привело к клиническим признакам и симптомам сухости, лихенификации (шелушения), экскориации, эритемы / отека и эрозии на ушах и спине, тогда как у нормальной контрольной группы никаких кожных повреждений не наблюдалось ( Рисунок 3). Баллы рассчитывались на основе суммы баллов по пяти симптомам: 15 баллов указывают на наиболее тяжелое состояние.Общий балл клинической тяжести значительно увеличивался со временем и достиг клинического балла выше, чем у индуцированной группы по сравнению с нормальной группой. После лечения в течение 4 недель шесть групп в соответствии с дозой смеси и группа положительного контроля значительно снизили общий балл клинической тяжести по сравнению с группой отрицательного контроля, и нормальная группа не показала никаких физических признаков симптомов дерматита; это исследование показывает, что положительный контроль или комбинированная обработка (поли + анто 2,56 + 7.31, 5,12 + 14,62, 10,25 + 29,25 мкг г / кг · мт) группы подавляли AD-подобные поражения, подобные этой нормальной группе (рис. 2 (а)).

    3.3. Влияние смеси на толщину уха

    Толщина уха была значительно увеличена после индукции атопического дерматита с помощью DNCB. Чтобы исследовать влияние смеси на степень толщины ушей у мышей NC / Nga, вызванных AD, смесь полифенолов и антоцианов или преднизолон в качестве положительного контроля вводили перорально ежедневно в течение 30 дней.Таким образом, толщина ушей была уменьшена за счет смешанной группы (поли + анто 2,56 + 7,31, 5,12 + 14,62, 10,25 + 29,25) и лечения преднизолоном (3 мг / кг · м.т.). Скорость уменьшения толщины ушей в группах, обработанных смесью поли + анто 2,56 + 7,31, 5,12 + 14,62, 10,25 + 29,25, и группе положительного контроля (прединизолон 3 мг / кг · м.т.) через 4 недели составила 24, 32, 35 и 34. % соответственно (рис. 2 (б)). После последней обработки в группе поли + анто 10,25 + 29,25 наблюдалось уменьшение толщины ушей, тогда как в группе положительного контроля (прединизолон 3 мг / кг · м.т.) этого не наблюдалось.

    3.4. Ингибирующее действие фракций смеси на поведение царапин

    Атопический дерматит характеризуется сильным зудом и повторяющимися эпизодами расчесывания. Чтобы оценить влияние царапания, количество эпизодов царапания в течение 30 минут подсчитывали макроскопически через 1 час после лечения три раза в неделю. Число царапин подсчитывали, как описано ранее, с небольшими изменениями. После обработки смесью и преднизолоном группы показали подавленное поведение почесывания в зависимости от времени.На последней неделе лечения только группа поли + анто 10,25 + 29,25 показала значительное подавление числа царапин по сравнению с группой отрицательного контроля. Группы поли + анто 2,56 + 7,31, 5,12 + 14,62 показали значительное снижение на второй-третьей неделях, но значимость исчезла на прошлой неделе, тогда как в группе положительного контроля количество эпизодов царапанья значительно уменьшилось на прошлой неделе (рис. 2 (c)).

    3.5. Смесь уменьшила проникновение воспалительных клеток в поражения кожи, вызванные DNCB

    Для исследования влияния смеси на гистопатологические симптомы, подобные AD, у мышей NC / Nga, кожу спины и ушей делали на срезы и окрашивали гематоксилином и эозином (H&E) ( Рисунок 4 (а)) или толуидиновый синий (Рисунок 4 (г)) и наблюдается под микроскопом при увеличении × 400.Толщина эпидермиса AD была, в то время как толщина поли + анто 10,25 + 29,25 составляла мкм м ( P 0,001) (рис. 4 (b)). Инфильтрацию эозинофилов (рис. 4 (c)), тучных клеток и дегранулированных тучных клеток макроскопически подсчитывали в случайно выбранных четырех полях (область обзора × 400). Мы проанализировали опухолевое поражение кожи и инфильтрацию тучных клеток (рис. 4 (е)), дегранулированных тучных клеток (рис. 4 (е)) и эозинофилов. Количество инфильтрированных тучных клеток, дегранулированных тучных клеток и эозинофилов значительно снизилось при обработке поли + анто 2,56 + 7.31, 5,12 + 14,62, 10,25 + 29,25 по сравнению с контрольной группой. Смесь уменьшала инфильтрацию воспалительных клеток в пораженной коже.

    3,6. Влияние смеси на сывороточный иммуноглобулин

    Чтобы исследовать возможные эффекты смеси на сывороточный уровень IgE, применение DNCB значительно продемонстрировало сывороточные уровни IgE по сравнению с нормальной группой. Сенсибилизация 0,4% DNCB сильно увеличивала сывороточный уровень IgE, а обработка смесью полифенолов и антоцианов 2,56 + 7.31, 5,12 + 14,62, 10,25 + 29,25 или преднизолон снижали уровни IgE в сыворотке на 28, 58, 80 и 31% в течение 2 недель. И уровень IgE с показателями 65, 94, 95 и 83% в течение 4 недель соответственно (рис. 5 (а)).

    В сыворотке мышей NC / Nga, получавших DNCB, уровень IgG1 был повышен, а уровень IgG2a подавлен или не изменился. Группа поли + анто 5,12 + 14,62 показала снижение уровня сывороточного IgG1 в качестве группы положительного контроля по сравнению с группой отрицательного контроля, а группа поли + анто 10,25 + 29,25 показала значительное подавление, чем группы положительного контроля (фиг. 5 (b)).Группа поли + анто 5,12 + 14,62 увеличивала уровень сывороточного IgG2a в группе положительного контроля по сравнению с группой отрицательного контроля. Кроме того, группа поли + анто 10,25 + 29,25 значительно повысила уровень, чем положительный контроль (рис. 5 (с)). Кроме того, индуцированная БА, как известно, по дисбалансу соотношения Th2 / Th3, поли + анто 2,56 + 7,31, 5,12 + 14,62, 10,25 + 29,25 и положительный контроль снижали соотношение IgG1 / IgG2a, что приводило к 47, 58, 73 и 57% снижение в каждой группе соответственно (Рисунок 5 (d)). Эти результаты продемонстрировали, что фракции смеси обладают иммунорегулирующим действием.

    3,7. Влияние смеси на продукцию цитокинов селезенки

    Для оценки статистической значимости продукции цитокинов Th2 или Th3 селезенкой, селезенки получали от мышей NC / Nga после скарификации, и изолированные спленоциты стимулировали Con A, инкубируемым в течение 72 часов. Супернатант собирали после инкубации, и уровни IL-4, IL-13 (как цитокины Th3), IFN-, γ и IL-12 (как цитокины Th2) в супернатанте измеряли с помощью наборов для ELISA.Обработка смесью или преднизолоном резко подавляла продукцию цитокинов Th2 и Th3. Скорость снижения в группах поли + анто 2,56 + 7,31, 5,12 + 14,62, 10,25 + 29,25 и группы положительного контроля на 73, 75, 80 и 77% для уровня IL-4, 82, 84, 92 и 82% для IL. -13 уровень 60, 64, 77 и 72% для уровня IFN-, γ и 62, 82, 87 и 77% для уровня IL-12, соответственно (рис. 6). В совокупности группа поли + анто 5,12 + 14,62 подавляла уровни цитокинов Th2 или Th3 в качестве группы положительного контроля по сравнению с группой отрицательного контроля.Кроме того, группа поли + анто 10,25 + 29,25 подавлена, чем группа положительного контроля. В сочетании с производством цитокинов как группы поли + анто 2,56 + 7,31, 5,12 + 14,62, 10,25 + 29,25, так и группа положительного контроля были аналогичны нормальной группе.

    3.8. Смесь полифенолов и антоцианов ингибирует экспрессию генов цитокинов Th2, Th3 и Th27

    Мы проанализировали экспрессию генов, участвующих в атопическом дерматите, в пораженных участках кожи NC / Nga с помощью количественной ПЦР. Для определения продукции цитокинов и хемокинов в пораженной коже, экспрессии мРНК генов Th2, Th3 и Th27, таких как IL-4, IL-5, CCR3, eotaxin-1, IL-12, IFN- γ , MCP-1 , и IL-17.Мы доказали влияние смеси на экспрессию мРНК цитокинов в пораженной коже. Th3, IL-4 и IL-5 проявляются в острой стадии AD, а Th2, IL-12 и IFN-γ проявляются в хронической стадии AD. В этом исследовании пораженная кожа показала гораздо более высокие уровни экспрессии генов Th2, Th3 и Th27, особенно IL-4, IL-5, IL-17 и мРНК IFN-γ , увеличенные по сравнению с нормальной группой (Рисунок 7). В результате подавленная экспрессия IL-4, IL-5, CCR3, эотаксина-1, IL-12, IFN-, γ , MCP-1 и IL-17 при обработке полифенолами и антоцианинами по сравнению с положительной контроль.В частности, группы смеси поли + анто 2,56 + 7,31, 5,12 + 14,62, 10,25 + 29,25 были показаны как аналогичные нормальной группе.

    3.9. Функциональные тесты печени и почек

    Для оценки печеночной дисфункции измеряли активность глутаматпируваттрансаминазы (GPT). Тест на азот мочевины в крови (АМК) — это измерение количества азота в крови в форме мочевины, которое измеряется для оценки дисфункции почек. Их определяли с помощью набора ALT / SGPT и BUN ELISA в сыворотке. Не было повышенных уровней GPT и BUN в сыворотке крови при лечении смесью и преднизолоном (таблица 2).Таким образом, смесь полифенолов и антоцианов не оказывает токсического воздействия на печень и почки.

    9709 972 972 9709 972 972 9709 972

    Группа (мг / мл) МЕ / л мг / дл
    ALT / SGPT BUN 0 9957 9957 9957 29,23 4,85 23,42 3,09
    AD 24,23 2,77 21,32 2,52
    Преднизолон 3 37.45 9,65 23,05 2,15
    Полифенол + антоцианин
    2,56 + 7,31 29,01 7,53 23,27 2,55
    23,27 2,55
    10,25 + 29,25 30,68 3,89 24,96 1,99

    4. Обсуждение

    БА определяется как хроническое воспалительное состояние кожи, характеризующееся интенсивным зудом и серией ремиссий. 27].Заболеваемость БА растет, особенно в промышленно развитых странах [28]. Исследования причин AD продолжаются, и разрабатываются новые методы лечения, но эти агенты имеют серьезные побочные эффекты, которые ограничивают их клиническое применение [29]. В последнее время лечение поражений AD включает использование натуральных агентов, таких как солодка, зеленый чай, соевые бобы, ягоды асаи, куркума и гранат [30]. Сообщается, что плод VU содержит полифенол, антоцианин и сахар / кислоту. Для исследования составляющих экстракта было выполнено простое фракционирование с использованием предварительно подготовленных картриджей C18 Sep-Pak для отделения антоцианов от фенольных соединений, не являющихся антоцианинами.В частности, известно, что полифенолы и антоцианы являются разновидностями флавоноидов. Было признано, что флавоноиды обладают антиоксидантной, антибактериальной и противовирусной способностью и обладают противовоспалительным, антиангиогенным, обезболивающим, гепатопротекторным, цитостатическим, апоптотическим, эстрогенным или антиэстрогенным свойствами, а также противоаллергическим действием [31, 32]. В этом исследовании мы выделяем полифенол и антоцианин из VU с помощью ВЭЖХ, и соединение было идентифицировано как кверцетин и цианидин-3-о-глюкозид с помощью ЯМР-спектроскопии, соответственно (рис. 8).В нашем исследовании in vitro с использованием выделенных спленоцитов мышей фракция полифенолов и антоцианов эффективно ингибировала выработку IL-4 (основного цитокина Th3), который играет важную роль в заболевании атопическим дерматитом (данные не известны). Таким образом, в этом исследовании мы исследовали, как фракции смеси, такие как полифенолы и антоцианы, полученные из VU, облегчают индуцированную DNCB AD на мышиной модели AD. Мы исследовали мышей NC / Nga, у которых наблюдались AD-подобные поражения кожи при старении, в качестве возможной мышиной модели AD [33] и поддерживали их в определенных условиях, свободных от патогенов (SPF).После отрицательного и положительного контрольных групп и обработки смешанными группами индуцировали DNCB, поэтому у мышей NC / Nga с поражениями AD проявляются клинические симптомы, включая сухость, лихенификацию (шелушение), экскориацию, эритему / отек и эрозию, результаты показывают, что контрольная группа также развивались симптомы, тогда как развитие поражений AD уменьшилось в контрольной группе. Дермальная инфильтрация воспалительных клеток является важным патогистологическим признаком атопического дерматита [34]. Активированные тучные клетки выделяют множество биологически активных веществ, которые играют важную роль в аллергических реакциях, таких как БА [35].Воспалительные факторы уменьшились после перорального приема смеси. Лечение смесью облегчило гистопатологические симптомы на коже спины и уха, включая инфильтрацию эозинофилов, тучных клеток и дегранулированных тучных клеток. В коже IgE можно проследить до рецепторов Fc на тучных клетках кожи и на антигенпрезентирующих дендритных клетках (DC). Подавление дегранулированных тучных клеток косвенно коррелировало с пониженным содержанием гистамина, а ингибированная инфильтрация эозинофилов коррелировала со снижением продукции IL-4 и IL-13.Это согласуется с недавним исследованием, которое предположило, что такие цитокины Th3 участвуют в привлечении эозинофилов [36]. Поражение показало высокие уровни IgE в сыворотке за счет переключения B-клеток с IgM и IgE посредством активации IL-4 [37, 38]. Фактически, эффект АД (атопический дерматит) был лучшим результатом в системе in vivo, чем в системе in vitro, в системе . На мой взгляд, причина в другом периоде лечения. Смесь или преднизолон значительно снижали уровень общего сывороточного IgE. БА развивается в последовательную фазу: острые поражения кожи при БА характеризуются местной экспрессией цитокинов Th3, тогда как хронические поражения кожи при БА характеризуются смешанной экспрессией цитокинов как Th3, так и Th2 [39, 40].Недавние исследования предполагают ключевую роль цитокина Th2-типа IFN-γ в хроническом течении поражений БА [41–43]. Хроническую фазу БА сравнивали с состоянием здоровья по продукции IDEC [44]. Сигнал мРНК MCP-1 отсутствовал в исходных условиях [45] и потенциал привлекает моноциты и дендритные клетки in vivo , [46], но он может индуцировать миграцию как Th2-, так и Th3-клеток [39]. Предыдущие исследования показали, что смешанные группы могут подавлять активацию мРНК IL-12, IFN-, γ и MCP-1 в AD-подобных поражениях кожи.При атопическом дерматите Th3-клетки играют важную роль в начальной фазе воспалительных реакций, тогда как на более поздних стадиях Th2-клетки могут быть обнаружены в большем количестве [47]. Повторное лечение DNCB высвобождает цитокины Th2 и Th3 за счет активации хелперных Т-клеток. Мы обнаружили, что обработка смесью фракций из VU значительно снижает как Th2, так и Th3 цитокины в селезенке. Следовательно, мы полагаем, что смесь оказывает действие как на острые, так и на хронические поражения БА. Важным является поражение из-за дисбаланса Th2 / Th3, смещенного в сторону Th3, который играет важную роль в патологии БА [48].Важным моментом является сегрегация изотипов иммуноглобулинов IgG2a и IgG1 в качестве маркеров Th2- и Th3-лимфоцитов соответственно для каждого соотношения [49]. Нам показали смягчающий эффект баланса Th2 / Th3 через соотношение IgG2a и IgG1. Пероральное введение смеси в течение 4 недель подавляло уровни IgG1 и увеличивало уровни IgG2a дозозависимым образом. Оцененное соотношение IgG1 / IgG2a показало, что смесь также значительно снижает соотношение Th3 / Th2. Зуд является одним из основных признаков БА, а расчесывание вызывает рецидив поражения [50, 51].Следовательно, эффективное регулирование зуда и расчесов важно и требуется для пациентов с БА. Использование ПЦР в реальном времени анализа смеси ингибировало экспрессию мРНК IL-4, который является основным цитокином Th3, который активирует В-клетки, эозинофилы и тучные клетки. МРНК интерлейкина-5 также обнаруживается в активированных эозинофилах в тканях пациентов с БА [52–54]. МРНК эотаксина-1 (CCL11) продуцируется эпителиальными и эндотелиальными клетками, причем CCR3 преимущественно локализуется в эозинофилах [55]. Экспрессия мРНК IL-5, CCR3 и эотаксина-1 (CCL11) значительно снизилась в результате обработки смесью.Кроме того, недавно была идентифицирована субпопуляция IL-17-индуцирующих Th-клеток (Th27), и было показано, что они играют важную роль в воспалении тканей [56, 57]. Недавно парадигма Th2 / Th3 в аутоиммунных и аллергических реакциях была пересмотрена, включая роль новой популяции продуцирующих IL-17 Th-клеток (Th27) [46]; Ингеминированное применение DNCB особенно увеличивало экспрессию мРНК Th2 и Th3-родственных генов. Кроме того, в предыдущем исследовании сообщается об увеличении количества клеток Th27 в воспаленной коже пациентов с БА [58].Однако их роль в БА до сих пор неясна. Было высказано предположение о потенциальном участии Th27 Т-клеток в БА [46]. Повышенное содержание Т-клеток IL-17 было обнаружено в срезах тканей поражений AD по сравнению с нормальной кожей [45]. Наша предыдущая работа по хроническим AD-подобным поражениям кожи также доказала повышенную экспрессию IL-17 по сравнению с нормальными группами, а в группах лечения снижалась экспрессия мРНК IL-17. Мы обнаружили, что IL-17 также был связан с острыми и хроническими поражениями AD. В конечном итоге смесь полифенолов и антоцианов оказывает влияние на клиническую гистологическую и иммунологическую экспрессию генов на AD-подобные поражения кожи.Тем не менее, смесь является натуральной и оказывает сильное воздействие на кожные поражения, похожие на AD. Преимущество перорального приема смеси состоит в том, что она не вызывает дисфункции печени и почек. Таким образом, смесь является хорошим кандидатом в качестве препаратов дополнительной и альтернативной медицины против АД.

    5. Заключение

    Смесь полифенолов и антоцианов успешно применялась для лечения AD-подобных поражений, подавления воспаления пораженной кожи, коррекции баланса Th2 / Th3 и снижения уровня IL-17.Это лечение оправдано для выяснения взаимодействия между этими подмножествами Th-клеток при острой и хронической БА [59] у мышей NC / Nga, получавших DNCB. Таким образом, местное применение смеси может быть новым подходом к лечению атопического дерматита.

    AD: Атопический дерматит
    DNCB: 2,4-динитрохлорбензол
    Poly + antho:
    Poly + antho: полифенолин антоцианолин L .
    Окраска H&E: Окраска гематоксилин-эозином
    IL: Интерлейкин
    CCL: Хемокин (мотив CCR) лиганд Хемокин (мотив CCR) лиганд
    MCP-1: Хемоаттрактантный белок моноцитов 1
    Ig: Иммуноглобулин.

    Авторы профессора Янг-Пё Чан (Университет Кён Хи, фармацевтический колледж) по стандартизации антоцианов из Университета штата Вашингтон.

    Влияние перорального приема экстракта корня Scutellaria Baicalensis на поражение кожи, подобное атопическому дерматиту, вызванное оксазолоном у бесшерстных мышей | Прикладная биологическая химия

  • Акдис М., Блазер К. и Акдис К.А. (2005) Т-регуляторные клетки при аллергии: новые концепции патогенеза, профилактики и лечения аллергических заболеваний. J Allergy Clin Immunol 116 , 961–968.

    Артикул CAS Google Scholar

  • Bae IH, Yun JW, Seo JA, Jung KM, Kim K, Noh M et al.(2010) Иммуногистологическое сравнение кожной патологии трех репрезентативных моделей мышиного атопического дерматита. J Dermatol Sci 59 , 57–60.

    Артикул Google Scholar

  • Бибер Т. (2010) Атопический дерматит. Ann Dermatol 22 , 125–137.

    Артикул CAS Google Scholar

  • Braun CM, Huang SK, Bashian GG, Kagey Sobotka A, Lichtenstein LM, and Essayan DM (1997) Кортикостероидная модуляция человеческих, антигенсвязывающих ответов Th2 и Th3. J Allergy Clin Immunol 100 , 400–407.

    Артикул CAS Google Scholar

  • Carmi-Levy I, Homey B и Soumelis V (2011) Модульное представление сетей цитокинов при атопическом дерматите. Clin Rev Allergy Immunol 4 , 245–253.

    Артикул Google Scholar

  • Choi YH, Han EH, Chai OH, Kim YK, Kim KT и Song CH (2010) Scutellaria baicalensis ингибирует анафилактические реакции, опосредованные тучными клетками. Корейский J Phys Anthropol 23 , 217–227.

    Google Scholar

  • Cookson W (2004) Иммуногенетика астмы и экземы: новый взгляд на эпителий. Нат Рев Иммунол 4 , 978–988.

    Артикул CAS Google Scholar

  • Хоказоно Х., Омори Т. и Оно К. (2010) Влияние однократного и комбинированного введения ферментированного экстракта ячменя и гамма-аминомасляной кислоты на развитие атопического дерматита у мышей NC / Nga. Biosci Biotechnol Biochem 74 , 135–139.

    Артикул CAS Google Scholar

  • Исихара К. и Хирано Т. (2002) IL-6 при аутоиммунных заболеваниях и хронических воспалительных пролиферативных заболеваниях. Рост цитокинов F R 13 , 357–368.

    Артикул CAS Google Scholar

  • Isis M van Loon ND (1997) Золотой корень: Клиническое применение флавоноидов scutellaria baicalensis georgi в качестве модуляторов воспалительной реакции. Альтернативная медицина Версия 2 , 472–480.

    Google Scholar

  • Каваками Т., Андо Т., Кимура М., Уилсон Б.С. и Каваками Ю. (2009) Тучные клетки при атопическом дерматите. Курр Опин Иммунол 21 , 666–678.

    Артикул CAS Google Scholar

  • Kim DS, Son EJ, Kim M, Heo YM, Nam JB, Ro JY et al.(2010a) Противоаллергическая травяная композиция из Scutellaria baicalensis и Phyllostachys edulis. Планта Мед 76 , 678–682.

    Артикул CAS Google Scholar

  • Kim DY, Jung JA, Kim TH, Seo SW, Jung SK и Park CS (2009a) Пероральное введение Uncariae rhynchophylla подавляет развитие DNFB-индуцированных атопических дерматитоподобных поражений кожи за счет подавления IFN-гамма у мышей NC / Nga. J Этнофармакол 122 , 567–572.

    Артикул Google Scholar

  • Ким Э. Х., Шим Б., Кан С., Чжон Г., Ли Дж. С., Ю Й.Б. и др. (2009b) Противовоспалительные эффекты экстракта Scutellaria baicalensis посредством подавления иммуномодуляторов и сигнальных молекул MAP-киназы. J Этнофармакол 126 , 320–331.

    Артикул Google Scholar

  • Kim J, Lee I., Park S, and Choue R (2010b) Влияние экстрактов геля Scutellariae radix и алоэ вера на иммуноглобулин E и уровни цитокинов у мышей NC / Nga с атопическим дерматитом. J Этнофармакол 132 , 529–532.

    Артикул Google Scholar

  • Kim MS, Hur YG, Kim WG, Park BW, Ahn KS, Kim JJ et al. (2011) Ингибирующее действие Platycodon grandiflorum на иммунные ответы Th2 и Th3 на мышиной модели поражений кожи, подобных атопическому дерматиту, вызванных 2,4-динитрофторбензолом. Ann Allergy Asthma Immunol 106 , 54–61.

    Артикул Google Scholar

  • Kim SH, Kim HJ и Jung JY (2009c) Влияние байкалеина на контактный дерматит, вызванный пикрилхлоридом, у мышей BALB / c. J Korean Soc Food Sci Nutr 38 , 160–165.

    Артикул CAS Google Scholar

  • Kim YH и Park YS (2006) Влияние водного экстракта Scutellaria baicalensis на антиоксидантную активность и толщину эпидермиса на животной модели аллергического контактного дерматита, индуцированного ДНК. J Korean Soc Food Sci Nutr 35 , 543–548.

    Артикул Google Scholar

  • Киндт Т.Дж., Голдсби Р.А. и Осборн Б.А. (2007) Иммунология.С. 380–386, W.H. Фриман и компания, Нью-Йорк, штат Нью-Йорк.

    Google Scholar

  • Китагаки Х., Фудзисава С., Ватанабе К., Хаякава К. и Шиохара Т. (1995) Реакция гиперчувствительности немедленного типа, за которой следует поздняя реакция, индуцируется повторным подкожным нанесением контактно-сенсибилизирующих агентов у мышей. Дж. Инвест Дерматол 105 , 749–755.

    Артикул CAS Google Scholar

  • Квон Х. К., Ли К. Г., Со Дж. С., Чае С. С., Хван Дж. С., Саху А. и др.(2010) Генерация регуляторных дендритных клеток и CD4 + Foxp3 + Т-клеток при введении пробиотиков подавляет иммунные нарушения. Proc Natl Acad Sci 107 , 2159–2164.

    Артикул CAS Google Scholar

  • Lee HS, Kim SK, Han JB, Choi HM, Park JH, Kim EC et al. (2006) Тормозящие эффекты Rumex japonicus Houtt. о развитии кожных поражений, подобных атопическому дерматиту, у мышей NC / Nga.Br J Dermatol 155 , 33–38.

    Google Scholar

  • Lee JH, Jung KM, Bae IH, Cho S, Seo DB, Lee SJ et al. (2009) Противовоспалительный и барьерно-защитный эффект экстрактов Lithospermum erythrorhizon при хроническом оксазолон-индуцированном атопическом дерматите мышей. J Dermatol Sci 56 , 64–66.

    Артикул CAS Google Scholar

  • Leung DY, Boguniewicz M, Howell MD, Nomura I и Hamid QA (2004) Новые взгляды на атопический дерматит. Дж Клин Инвест 113 , 651–657.

    CAS Google Scholar

  • Li HB, Jiang Y, and Chen F (2004) Методы разделения, используемые для активных компонентов Scutellaria baicalensis . J Хроматограф B Analyt Technol Biomed Life Sci 812 , 277–290.

    CAS Google Scholar

  • Liu FT, Goodarzi H, and Chen HY (2011) IgE, тучные клетки и эозинофилы при атопическом дерматите. Clin Rev Allergy Immunol 41 , 298–310.

    Артикул CAS Google Scholar

  • Man M-Q, Hatano Y, Lee SH, Man M, Chang S, Feingold KR et al. (2008) Характеристика гаптен-индуцированной мышиной модели с множественными признаками атопического дерматита: структурные, иммунологические и биохимические изменения после однократного или множественного введения оксазолона. J Invest Дерматол 128 , 79–86.

    Артикул CAS Google Scholar

  • Мацумото М., Котани М., Фудзита А., Хига С., Кисимото Т., Суэмура М. и др. (2002) Пероральное введение экстракта листьев хурмы облегчает кожные симптомы и трансэпидермальную потерю воды у мышей, моделирующих атопический дерматит, NC / Nga. Br J Дерматол 146 , 221–227.

    Артикул CAS Google Scholar

  • Мацуока Х., Маки Н., Йошида С., Араи М., Ван Дж., Оикава Ю. и др.(2003) Мышиная модель синдрома атопической экземы / дерматита путем повторного применения неочищенного экстракта клеща домашней пыли Dermatophagoides farinae. Аллергия 58 , 139–145.

    Артикул CAS Google Scholar

  • Park EJ, Park KC, Eo H, Seo J, Son M, Kim KH et al. (2007) Подавление спонтанного дерматита на мышиной модели NC / Nga с помощью PG102, выделенного из Actinidia arguta. J Invest Дерматол 127 , 1154–1160.

    Артикул CAS Google Scholar

  • Шиохара Т., Хаякава Дж. И Мизукава Ю. (2004) Животные модели атопического дерматита: имеют ли они отношение к болезни человека? J Dermatol Sci 36 , 1–9.

    Артикул CAS Google Scholar

  • Szegedi A, Barth S, Nagy G, Szodoray P, Gl M, Sipka S et al. (2009) Регуляторные Т-клетки при атопическом дерматите: скопления эпидермальных дендритных клеток могут способствовать их локальному распространению. Br J Дерматол 160 , 984–993.

    Артикул CAS Google Scholar

  • Tomimori Y, Tanaka Y, Goto M, and Fukuda Y (2005) Повторное местное заражение химическим антигеном вызывает устойчивый дерматит у мышей NC / Nga в условиях отсутствия специфических патогенов. J Invest Дерматол 124 , 119–124.

    Артикул CAS Google Scholar

  • Yano S, Umeda D, Yamashita S, Yamada K, and Tachibana H (2009) Диетический апигенин ослабляет развитие кожных поражений, подобных атопическому дерматиту, у мышей NC / Nga. Дж Нутр Биохим 20 , 876–881.

    Артикул CAS Google Scholar

  • Yoon SB, Han HS и Lee YJ (2011) Эффект экстракта Scutellariae radix на провоспалительные медиаторы в клетках Raw 264.7 , индуцированный LPS. Корейский J Herbology 26 , 75–81.

    Google Scholar

  • Yun MY, Yang JH, Kim DK, Cheong KJ, Song HH, Kim DH et al.(2010) Терапевтические эффекты байкалеина на поражение кожи, подобное атопическому дерматиту, у мышей NC / Nga, вызванное dermatophagoides pteronyssinus. Инт Иммунофармакол 10 , 1142–1148.

    Артикул CAS Google Scholar

  • Zheng H, Jeong YJ, Song J, and Ji GE (2011) Пероральное введение гинсенозида Rh2 ингибирует развитие атопических дерматитоподобных повреждений кожи, вызванных оксазолоном, у лысых мышей. Инт Иммунофармакол 11 , 511–518.

    Артикул CAS Google Scholar

  • Ziegler SF (2006) FOXP3: О мышах и людях. Анну Рев Иммунол 24 , 209–226.

    Модулярный дерматит: Нодулярный дерматит крупного рогатого скота
  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *