Содержание

Чёрная редька – Всё про черную редьку. Рецепты из черной редьки

Чёрная редька – наиболее полезная редька из всех многочисленных её разновидностей. Она обладает ярко выраженным лечебным эффектом, содержит много витаминов и микроэлементов.

Многие вспомнят, как сок чёрной редьки, который выделяется при смазывании мякоти мёдом, «прописывали» от кашля врачи старой школы, тем самым признавая высокую эффективность и, что иногда важнее, безопасность народного средства. Чёрной редькой действительно быстро лечили простуды, кашель и даже бронхиты. А ещё соком редьки лечили суставы, ревматизм, невралгии и желчнокаменную болезнь. Чёрная редька не только полезная, но и вкусная. Она непроста в приготовлении, но нам стоит обратить на неё более пристальное внимания хотя бы из-за уникальных лечебных свойств. Ведь всем нам хочется прожить долгую счастливую жизнь и не болеть.

Откуда взялась чёрная редька?

Чёрная редька растёт в Евразии и Северной Америке. Можно сказать, что этот корнеплод знают везде, кроме Африки и Австралии, и в разных местах планеты её готовят по схожему принципу. Чёрную редьку едят сырой, маринуют, обжаривают, варят и делают пюре или добавляют в супы. Даже этих вариантов хватит, чтобы экспериментировать с чёрной редькой достаточно долго. Любопытно, что редька входила в «пищевую корзину» строителей египетских пирамид, а в древнем Китае она была одним из значимых лекарственных растений. Следы выращивания чёрной редьки найдены в древних захоронениях Египта, что ставит её в один ряд с древнейшими овощами и корнеплодами, используемыми человеком. Надо заметить, что древние всегда выращивали лишь то, что особенно ценили. Любое древнее окультуренное растение содержит максимальное количество полезных веществ или способно лечить и делать нас сильней. Сейчас чёрную редьку выращивают в промышленных масштабах в Китае, Японии, Германии, Австрии, Франции, Италии и Голландии.

Чем полезна чёрная редька

В 100 г чёрной редьки содержится 554 мг калия, 105 мг кальция, 100 мг витамина С, 36 мкг витамина В9 и 9 мг натрия. Кроме этого в чёрной редьке есть цинк, медь, марганец и селен. Экстракт или сок редьки содержит антимикробные и антивирусные компоненты, которые успешно борются с лёгочными и кишечными болезнями. Существует исследование, показывающее, что в некоторых случаях сок редьки эффективней пенициллина. Редька содержит много калия, который, по последним исследованиям, так же необходим для здоровья костей и суставов, как и кальций.

Как лечить кашель чёрной редькой

Это очень простой рецепт, известный от Лондона до Пекина. Именно таким способом в древнем мире лечили кашель или тяжёлую простуду.
• Помойте крупную редьку,
• Вырежьте ножом конусообразную глубокую воронку, а основание срежьте, чтобы редька устойчиво стояла,
• Густо смажьте стенки воронки мёдом,
• Пейте выделившийся сок по 1 чайной ложке 3 раза в день,
• Не забывайте дополнительно смазывать редьку мёдом – одной редьки хватит на несколько дней.

Таким нехитрым способом из редьки можно добыть очень полезный сок. Если вам нужно больше сока, то можно измельчить редьку в кухонном комбайне и обильно пересыпать сахаром.

Внимание! Сок редьки противопоказан при язвах желудка и двенадцатипёрстной кишки, при тяжёлых болезнях сердца.

Вкус чёрной редьки

На вкус чёрная редька напоминает редис. Её белая упругая хрустящая мякоть слегка островатая, но более сладкая, нежели редис. Во вкусе можно различить сливочные оттенки, намёк на хрен и репу. Если вы любите редис и салаты из свежего редиса, то чёрная редька может понравиться еще больше. Некоторые виды чёрной редьки могут горчить, но в этом нет ничего страшного, горечь не настолько сильна, чтобы из-за этого лишать себя вкусного витаминного овоща.

С чем есть редьку

Чёрную редьку можно добавить в суп, к картофельному салату, пюре или жареной картошке, смешать с овощами и сделать витаминный салат, нарезать тонкие чипсы и съесть с густым соусом, смешать с мёдом и получить островато-сладкий десерт, отварить с тыквой и приготовить пюре. С редькой можно делать всё то, что мы обычно делаем с корнеплодами с одной оговоркой: сырая редька намного полезней, поэтому, логично в первую очередь делать такие блюда, в которых на редьку будет минимальное температурное воздействие.

Рецепты с чёрной редькой

Жаренная чёрная редька

Жареная редька не так полезна, как свежая, но с этого рецепта можно запросто начать знакомство с этим корнеплодом. Не забывайте, что к жареным овощам всегда хорошо подходит свежая зелень.

Ингредиенты:
2 чёрных редьки среднего размера,
4-6 ст. ложек растительного масла,

Соль.

Приготовление:
Промойте и очистите редьку (снимите слой чёрной кожицы). Нарежьте тонкими кружками и обжарьте на раскаленной сковороде в растительном масле. Готовую редьку посолите и ешьте горячей.

Картофельный салат с редькой

Ингредиенты:
450 г воскового картофеля,
220 г чёрной редьки,
5 зубчиков чеснока,
4 ч. ложки оливкового масла,
2 ч. ложки винного уксуса,
2 ч. ложки мёда,
1 ч. ложка сушёной паприки,
50 г очищенных грецких орехов,
Чёрный перец,
Соль.

Приготовление:
Нарежьте очищенные картофель и редьку соломкой на тёрке для корейской моркови. Это же можно сделать ножом или в кухонном комбайне. Поместите картофель с 3 зубчиками чеснока в пароварку на 10 минут. Редьку пересыпьте солью на время приготовления картофеля, после чего промойте и обсушите. Это уберёт лишнюю горечь редьки. Переложите редьку в салатник, добавьте уксус, масло и пару нашинкованных зубцов чеснока, добавьте тёплый картофель. Аккуратно перемешайте, добавьте орехи и паприку, поперчите и посолите.

Салат из чёрной редьки с овощами и сыром

Ингредиенты:
1 пучок рукколы,
1 чёрная редька,
1 морковь,
1 фенхель,
50-70 г пармезана,
5-6 ст. ложек оливкового масла,
4-5 ст. ложек лимонного сока,
1 ст. ложка лимонной цедры,
Чёрный перец, соль по вкусу.

Приготовление:
Снимите с лимона цедру. Смешайте оливковое масло с лимонным соком, поперчите и посолите смесь. Перемешайте и попробуйте. Если мало соли или перца – добавьте. Очистите фенхель, редьку и морковь. Сделайте тонкие стружки (например, ножом для чистки овощей). Сделайте такие же тонкие стружки сыра. Заправьте соусом и перемешайте. Выложите в салатник, сверху разбросайте рукколу.

Простой салат из свежей чёрной редьки

Ингредиенты:
1 чёрная редька,
капуста, объёмом меньше редьки,
1 небольшая морковь,
1 небольшая луковица,
пара перьев зелёного лука,
1 ст. ложка лимонного сока,
½ ч. ложки сахара,
2 ст. ложки оливкового масла,
пучок зелени (петрушка, мята, укроп или кинза – по настроению),

соль и перец по вкусу.

Приготовление:
Промойте и очистите овощи. Нашинкуйте очень тонко любым способом (острый нож, комбайн, крупная тёрка, тёрка для корейской моркови). Зелень мелко измельчите. Овощи перемешайте с зеленью, добавьте лимонный сок и масло, добавьте сахар, поперчите и посолите. Перемешайте и выкладывайте в салатник.

Салат с чёрной редькой и горчицей

Этот испанский острый салат хорошо подойдёт в качестве острой холодной закуски перед основными блюдами.

Ингредиенты:
2 чёрных редьки,
3 ст. ложки дижонской горчицы,
4 ст. ложки оливкового масла,
1 ч. ложка винного уксуса,
¼ стакана свежей рубленой петрушки,
соль, чёрный перец по вкусу.

Приготовление:
Очистите редьку и натрите на крупной тёрке. В прогретой кипятком чашке или кружке взбейте 3 ложки горчицы с 3 ложками горячей воды (почти кипятка), добавляя понемногу оливковое масло, соль и перец, чтобы получить густой соус. Смешайте редьку с рубленой петрушкой, полейте сверху соусом и подавайте.

Корейское кимчи из чёрной редьки

Кимчи – это маринованные острые овощи, например «корейская морковь», которая продаётся на рынках и в магазинах. Такой способ приготовления отлично подходит для чёрной редьки.

Ингредиенты:
3 чёрных редьки,
2 ч. ложки соли,
1-2 ч. ложки порошка перца чили или кайенского перца,
полторы ст. ложки рисового (или белого винного или яблочного) уксуса,
2 ст. ложки мелко нарезанного зелёного лука,
2 зубчика чеснока,
1 ст. ложка сахара.

Приготовление:
Очищенную редьку нашинкуйте длинными тонкими брусочками, как лапшу или спагетти. Это удобно делать специальной тёркой или в комбайне. Присыпьте редьку солью, дайте постоять 10-20 минут и промойте в холодной воде. Тщательно отожмите редьку от сока. Сок сохраните или выпейте, он полезен, но в кимчи будет лишним. Смешайте в миске редьку, уксус, сахар, чеснок и перец. Тщательно всё перемешайте и дайте постоять пару часов в холодильнике. Готовый салат можно будет есть несколько следующих дней.

Чипсы из чёрной редьки к пиву

Это одна из лучших закусок к пиву, что-то вроде архиклассической савойской капусты, которую подают в британских или германских пабах.

Просто сделайте тонкие чипсы из очищенной сырой чёрной редьки. Проще всего это делать в комбайне, но можно и овощечисткой, если нужны лишь одна-две порции. Посыпьте готовые чипсы крупной морской солью и подавайте к холодному пиву.

Чёрная редька действительно очень вкусный и крайне полезный корнеплод. Вы наверняка оцените способность сока редьки лечить простуду и кашель, а витамины редьки помогут быть здоровым и красивым. Старайтесь есть чёрную редьку свежей в овощных салатах и будьте здоровы!

Алексей Бородин

Польза и вред черной редьки

19 ноября 2020, четверг, 06:59 9665 2020-11-19T06:59:00+02:00 Жизнь 2021-08-15T04:44:56+03:00

Українські Новини

Українські Новини Черная редька от кашля, анемии и лишнего веса: польза и вред осеннего суперфуда

Черная редька. Фото: cookist.com

Черная редька, которая появляется на овощных прилавках в ноябре, самый настоящий суперфуд среди овощей. Многие из нас знают, что сок черной редьки помогает при затяжном кашле, однако этот овощ обладает еще десятком полезных свойств - например, бактерицидным и имунностимулирующим, что так кстати приходится в период роста заболеваемости ОРВИ и простудными заболеваниями. 

На что же способна черная редька:

- улучшить аппетит, наладить обменные процессы в организме, следовательно, позволяет почувствовать себя бодрым и полным сил;

- оказать общеукрепляющее, иммуностимулирующее действие;

- вывести из организма плохой холестерин, избавить от шлаков и токсинов;

- заживить гнойные раны и язвы;

- убрать из организма (вывести) лишнюю жидкость, следовательно, уменьшить отеки;

- нормализовать функцию кишечника;

- избавить от бронхита, а также послужить отхаркивающим средством.

Черная редька. Фото: cookist.com

А также фитонцидов в редьке больше, чем в хрене и луке. Именно поэтому овощ обладает ярко выраженными бактерицидными свойствами, то есть редька — природный антибиотик, который поможет организму естественным способом бороться с болезнетворными микробами и бактериями.

Кому нельзя черную редьку?

Черная редька полезна, но она имеет свои противопоказания.

От редьки стоит отказаться тем, у кого:

  • больное сердце, точнее — перенесенный инфаркт;
  • обнаружены панкреатит в стадии обострения, повышена кислотность желудочного сока;
  • имеются аллергические реакции на вещества, содержащиеся в корнеплоде.

Как сообщали Українські Новини, ранее сообщалось о ТОП-десяти полезных свойствах ноябрьской айвы.

А тем временем, в Украине существенно подорожал картофель, но подешевела хурма. Какие цены на овощи и фрукты на рынке.

Подпишитесь на рассылку самых важных и интересных новостей

Выходит в конце дня, чтение занимает 5-7 минут

Редька чорна - Корисні і небезпечні властивості чорної редьки

Чорна редька найгіркіша, але і найкорисніша. Редька не може похвалитися великою кількістю вітамінів, однак вітамінний склад цього овоча ідеально збалансований.

Чорна редька представляє собою дворічну овочеву рослину, яка широко поширене по всій Європі, Азії, Північній Америці. Переважно висаджують чорну редьку в перегнійний, вологий грунт. Редька має потовщений корінь, який і є харчовим продуктом. Для лікувальних цілей використовують чорну редьку. У їжу вживають як коренеплоди, так і молоде листя редьки, додаючи її в різні салати і супи. Коренеплоди редьки вживають в сирому, вареному і смаженому вигляді, додають в салати, закуски, борщ, супи, різні м’ясні та овочеві страви.

Корисні властивості чорної редьки

Чорна редька містить білки, вуглеводи у вигляді сахарози і фруктози, жири, провітамін А (каротин), ретинол (вітамін А), вітамін В9, К, С, мікроелементи: залізо, кальцій, фосфор, магній, натрій, калій, цинк.

Редька містить корисні органічні кислоти, мінеральні солі, вітаміни, ферменти, фітонциди, ефірні олії, білки і амінокислоти. Вона покращує обмін речовин, підвищує імунітет, сприяє травленню, є природним аналогом антибіотика широкого спектру дії, виводить зайву рідину з організму.

Чорна редька сприяє розчиненню шлаків в жовчних протоках і жовчному міхурі, мінеральних солей в судинах, сечовому міхурі.

Сік чорної редьки – сильне жовчогінне, тому якщо в жовчних протоках міститься багато солей (мінералів), прохід жовчі утруднений, і болі в печінці неминучі. Полегшити їх можна водяною грілкою, покладеною на область печінки. Якщо біль терпима, то процедуру продовжуйте до тих пір, поки сік редьки не закінчиться. Зазвичай біль відчувається тільки на початку курсу, а потім все нормалізується.

При виконанні зазначеної процедури необхідно дотримуватися прісної дієти, уникати гострих і кислих продуктів, але тільки на період вживання соку. Коли сік закінчиться, треба їсти макуху, яка на той час уже скисне. Макуху приймають під час їжі по 1-3 ст. ложки, поки не закінчиться.

Сік зберігайте в холодильнику, макуху перемішайте з медом (в крайньому випадку з цукром) в пропорції: на 1 кг макухи 300 г меду або 500 г цукру і зберігайте в теплі в банках під пресом, щоб не пліснявіла. Сік пийте по 1 ч. ложці за годину після їжі. Якщо болі в печінці відчуватися не будуть, дозу можна поступово збільшувати до 1 ст. ложки, потім до двох і в кінці – до 0,5 склянки.

Макуху, що залишилася, сильно не вичавлювати і ні в якому разі не викидати! З неї можна зробити прекрасні гірчичники, або редечники. Слідуючи цьому рецепту, макуху редьки потрібно використовувати відразу ж після отримання соку. Завернувши макуху в марлю, розподіліть її рівним шаром і прикладіть під лопатку на 15-20 хвилин. І ніякого поліетилену зверху (редечник повинен «дихати»), тільки рушник, прикривши його подушкою. Дуже скоро редечний компрес буде гріти не менше, аніж справжні гірчичники, витягаючи з хворих бронхів накопичений в них в’язкий секрет. Як тільки шкіра порожевіє, редечник потрібно перекласти під іншу лопатку, зробивши чергову порцію ковтків редечного соку. Через кілька днів такої терапії від вашого бронхіту не залишиться і сліду.

Небезпечні властивості чорної редьки

Протипоказано вживання редьки при захворюваннях органів шлунково-кишкового тракту в стадії загострення, гломерулонефриті, і тому, хто недавно переніс інфаркт.

Вживання соку чорної редьки всередину протипоказано при хворобах серця, нирок, запаленнях шлунково-кишкового тракту, при виразковій хворобі шлунка і 12-палої кишки.

Редька черная - Полезные и опасные свойства черной редьки

Черная редька самая горькая, но самая полезная. Редька не может похвастаться большим количеством витаминов, однако витаминный состав этого овоща идеально сбалансирован.

Черная редька представляет двулетнее овощное растение, широко распространенное по всей Европе, Азии, Северной Америке. Предпочтительно высаживать черную редьку в перегнойную, влажноватую почву. Редька имеет утолщенный корень, который и является пищевым продуктом. Для лечебных целей используют черную редьку. В пищу употребляют как корнеплоды, так и молодую листву редьки, добавляя ее в различные салаты и супы. Корнеплоды редьки употребляют в сыром, варенном и жаренном виде, добавляют в салаты, закуски, окрошку, борщ, супы, различные мясные и овощные блюда.

Полезные свойства черной редьки

Черная редька содержит белки, углеводы в виде сахарозы и фруктозы, жиры, провитамин А(каротин), ретинол (витамин А), витамин В9, К, С, микроэлементы: железо, кальций, фосфор, магний, натрий, калий, цинк.

Редька содержит полезные органические кислоты, минеральные соли, витамины, ферменты, фитонциды, эфирные масла, белки и аминокислоты. Она улучшает обмен веществ, повышает иммунитет, способствует пищеварению, является природным аналогом антибиотика широкого спектра действия, выводит лишнюю жидкость из организма.

Черная редька способствует растворению шлаков в желчных протоках и желчном пузыре, минеральных солей в сосудах, почечной лоханке, мочевом пузыре.

Сок черной редьки — сильное желчегонное, поэтому если в желчных протоках содержится много солей (минералов), проход желчи затруднен, и боли в печени неизбежны. Облегчить их можно водяной грелкой, положенной на область печени. Если боль терпимая, то процедуру продолжайте до тех пор, пока сок редьки не закончится. Обычно боль ощущается только в начале курса, а потом все нормализуется.

При выполнении указанной процедуры необходимо соблюдать пресную диету, избегать острых и кислых продуктов, но только на период употребления сока. Когда сок закончится, надо есть жмых, который к тому времени уже прокиснет. Жмых принимают во время еды по 1—3 ст. ложки, пока не закончится.

Сок храните в холодильнике, жмых перемешайте с медом (в крайнем случае с сахаром) в пропорции: на 1 кг жмыха 300 г меда или 500 г сахара и храните в тепле в банках под прессом, чтобы не плесневело. Сок пейте по 1 ч. ложке через час после еды. Если боли в печени ощущаться не будут, дозу можно постепенно увеличивать до 1 ст. ложки, затем до двух и в конце — до 0,5 стакана.

Оставшийся жмых сильно не выжимайте и ни в коем случае не выбрасывайте! Из него можно сделать прекрасные горчичники, или редечники. Следуя этому рецепту, жмых редьки нужно использовать сразу же после получения сока. Завернув жмых в марлю, распределите его ровным слоем и приложите под лопатку на 15–20 минут. И никакого полиэтилена сверху (редечник должен «дышать»), только тряпочку или полотенце, прикрыв его подушкой. Очень скоро редечный компресс будет греть не меньше, чем настоящие горчичники, вытягивая из больных бронхов скопившийся в них вязкий секрет. Как только кожа порозовеет, редечник нужно переложить под другую лопатку, сделав очередную порцию глотков редечного сока. Через несколько дней такой терапии от вашего бронхита не останется и следа.

Опасные свойства черной редьки

Противопоказано употребление редьки при заболеваних органов желудочно-кишечного тракта в стадии обострения, гломерулонефрит, недавно перенесенном инфаркте.

Употребление сока черной редьки внутрь противопоказано при болезнях сердца, почек, воспалениях желудочно-кишечного тракта, при язвенной болезни желудка и 12-перстной кишки.

Автор видео откроет секрет приготовления универсального средства от кашля и заболеваний дыхательных путей из черной редьки и меда. Его ценность в том, что применять это лекарство можно не только для лечения взрослых, но и для лечения детей до 5 лет.

Рейтинг:

9.4/10

Голосов: 7

Смотрите также свойства других овощей:

Редька чёрная - калорийность, полезные свойства, польза и вред, описание

Калории, ккал: 

35

Углеводы, г: 

6.7

Редька чёрная является разновидностью посевной (огородной) редьки, травянистого однолетнего растения семейства Капустные. Чёрная редька имеет крупный практически круглый корнеплод с чёрной кожурой и ярко-белой мякотью. Внутренняя часть редьки чёрной плотная, сочная, хрустящая, с остро-пряным вкусом и запахом.

Чёрная редька распространена повсеместно в Европе, Северной Америке и в некоторых районах Азии, где преобладает умеренный климат. В диком виде редька чёрная не встречается, её начали культивировать в Азии в древности, когда способность овоща долго сохранять свои вкусовые качества и полезные свойства были очень востребованы.

Калорийность редьки чёрной

Калорийность чёрной редьки составляет 35 ккал на 100 грамм продукта.

Состав и полезные свойства чёрной редьки

Редька чёрная содержит неперевариваемые пищевые волокна, которые являются своеобразным скрабом для стенок кишечника и желудка, счищают и выводят из организма шлаки и токсины. Витаминно-минеральный комплекс чёрной редьки внушителен, в нём присутствуют бета-каротин, холин, витамины А, С, К, а также минеральные вещества: калий, кальций, магний, цинк, железо, фосфор и натрий. Корнеплод богат эфирными маслами и фитонцидами, обладает антимикробным и противопростудным действием (calorizator). Сок чёрной редьки с мёдом является традиционным средством от кашля, даже самого застарелого. Острый вкус редьки стимулирует выделение желудочного сока, возбуждая аппетит.

Вред редьки чёрной

Чрезмерное употребление чёрной редьки не рекомендуется при проблемах с желудочно-кишечным трактом, наличии язвенной болезни желудка и гастрита.

Выбор и хранение редьки чёрной

Корнеплоды чёрной редьки должны иметь неповреждённый верхний слой, без признаков ударов, гнили и плесени. Твёрдые на ощупь, увесистые корнеплоды надолго сохраняют сочность и яркий вкус. Хранить редьку нужно в овощном отделении холодильника или в погребе, где овощ отлично долежит до весны и станет источником необходимых витаминов в период авитаминоза.

Редька чёрная в кулинарии

Чёрную редьку правильно употреблять в сыром виде, добавляя её в салаты, окрошки и холодные закуски, в сочетании со свежими овощами, зеленью и ароматным подсолнечным маслом. Сок из редьки обычно смешивают со свекольным и морковным соками, чтобы слегка приглушить остроту вкуса.

Больше о пользе чёрной редьки смотрите в видеоролике «Жизнь под соусом: кто ест редьку, болеет редко» телепередачи «BALANCE-TV».

Специально для Calorizator.ru
Копирование данной статьи целиком или частично запрещено.

Шампунь Farmona Herbal Care Black Radish Shampoo Чорна редька, проти випадіння волосся, 330 мл

Чорна редька здавна відома як ефективний засіб боротьби з підвищеним випаданням волосся. Популярний виробник косметики Farmona з Польщі розробив інноваційний шампунь з натуральним екстрактом редьки. Це засіб без парабенів і парафінових олій зміцнить волосся по всій довжині та допоможе йому швидше регенерувати.

Як діє?

Шампунь Чорна редька включає інгредієнти, здатні забезпечити волоссю шовковисту гладкість, блиск і здоровий вигляд. У складі кошти ви знайдете:

  • екстракт чорної редьки для регенерації, харчування та зміцнення;

  • пребиотик інутек для легкого догляду та здорового вигляду;

  • рідкий кератин для відновлення структури;

  • пшеничний білок для краси і блиску.

М'які миючі компоненти делікатно очищають і насичують вологою. Натуральні екстракти рослин зменшують інтенсивність випадання волосся.

З чим використовувати?

Шампунь з чорною редькою рекомендується використовувати в комплексі з аналогічними кондиціонерами. Для посилення ефекту можна, порадившись з трихологом, застосовувати домашні маски з гірчицею, кропивою, алое та жожоба.

Показати більше

Aqua (Water), Sodium Laureth Sulfate Cocamidopropyl Betaine, Sodium Lauroyl Sarcosinate, Sodium Chloride, Propylene Glycol, Raphanus Sativus (Radish) Root Extract, Inulin, Hydrolyzed Keratin, Cetrimonium Chloride, Lauryldimonium Hydroxypropyl Hydrolyzed Wheat Protein, Lauryldimonium Hydroxypropyl Hydrolyzed Wheat Starch, Potassium Sorbate, Sodium Benzoate, Polyquaternium-10, Lactic Acid, Disodium EDTA, Parfum (Fragrance), Hexyl Cinnamal.

Нанесіть шампунь на вологе волосся масажними рухами. Розподіліть засіб по всій довжині пасом, а потім ретельно змийте водою.

користь і шкода, рецепти, фото, зберігання, властивості ⋆ Жіночий Світ

Користь і шкода чорної редьки — важливе питання для любителів простих овочів з городу. Зустріти редьку можна в будь-якому магазині, доступна вона для всіх, залишається лише розібратися в її характерні властивості та особливості.

Хімічний склад і калорійність чорної редьки

Щоб оцінити користь і шкода чорної редьки для здоров’я, необхідно ознайомитися з складом цього овоча. У ньому містяться:

  • клітковина і крохмаль;
  • зола;
  • моно – і дисахариди;
  • органічні кислоти;
  • бета-каротин;
  • вітаміни К, С і РР;
  • ефірні масла;
  • вітамін Е;
  • глюкозиди;
  • вітаміни групи В;
  • залізо, калій і фосфор;
  • магній, натрій і кальцій.

Калорійність овоча дуже маленька — всього лише 36 калорій в 100 г м’якоті.

Чим корисна чорна редька для організму

Овоч має вкрай корисними для організму властивостями:

  • допомагає швидко перемогти простуду і позбутися кашлю;
  • бореться з бактеріями і вірусами і знімає запалення;
  • служить гарним жовчогінну та сечогінну, може розчиняти дрібні конкременти в жовчному міхурі, нирках або протоках, знімає набряки;
  • регулює роботу кишечника;
  • знижує холестерин, виводить шлаки, зміцнює судини і полегшує роботу печінки;
  • допомагає при хронічних хворобах суглобів;
  • благотворно впливає на функції щитовидної залози і вирівнює гормональний фон.

Високо оцінюють користь чорної редьки для серця — вона зміцнює судини і перешкоджає виникненню серцевих патологій.

Користь чорної редьки для чоловіків

Головна користь редьки для організму чоловіків полягає в тому, що овоч підтримує роботу сечостатевої системи і захищає передміхурову залозу від виникнення пухлин. Крім того, чорна редька для здоров’я чоловіків корисна тим, що допомагає уникнути ранніх інфарктів і інсультів.

Користь чорної редьки для жінок

Представницям прекрасної статі редька допомагає при гінекологічних збої. Її властивості допомагають вирівняти цикл, знижують больові відчуття під час місячних. Вживати овоч корисно при циститі та інших сечостатевих недуг.

Можна редьку вагітним і годуючим

У період виношування дитини вживати овоч не можна. Компоненти в його складі посилюють кровообіг, а це може завдати шкоди, як на ранніх, так і на пізніх термінах.

Обережності слід дотримуватися і під час лактації. Продукт в раціон матері краще вводити через кілька місяців після пологів і в дуже малих кількостях. Від надлишку овоча буде шкода — він викличе коліки у немовлят.

Чорна редька дитині

Вперше пропонувати корисний овоч дітям можна не раніше 3 років, інакше він принесе шкоду. Гострий коренеплід дратує слизові оболонки шлунка і кишечника, і малюки просто не в змозі нормально його засвоїти.

Після 3 років можна пропонувати чорну редьку від кашлю дітям — з додаванням меду. Починати краще з кількох крапель соку, з часом порції можна збільшити до 1 великий ложки.

Важливо! Оскільки при певних недугах овоч завдає шкоди і строго протипоказаний, перед введенням його в дитячий раціон необхідно отримати дозвіл від педіатра.

Чи корисна чорна редька для схуднення

У дієтичному раціоні овоч здатний принести велику користь. Калорійність його зовсім невелика, тому ніякої шкоди фігурі він не завдає. При цьому овоч псує апетит і підсилює перистальтику кишечника, а значить, сприяє позбавленню від зайвої ваги.

Проте вживати овоч у великих кількостях не можна, оскільки його властивості можуть завдати шкоди шлунку.

Користь соку чорної редьки

Користується популярністю сік з редьки. Він містить у собі повний набір вітамінів і мікроелементів, присутніх в овочі, і володіє масою корисних властивостей.

Напій часто застосовують для:

  • лікування кашлю, бронхіту, легеневих недуг — особливо яскраво проявляється користь соку чорної редьки з медом;
  • усунення запалень;
  • зміцнення судин і поліпшення травлення.

Напій володіє антисептичними і загоюючими властивостями, надає відхаркувальну і жарознижувальну дію.

Народні рецепти з чорною редькою для лікування захворювань

Лікувальні властивості чорної редьки часто використовують в домашніх оздоровчих рецептах. Але застосовувати продукт потрібно правильно, не забуваючи про дозуваннях.

Чорна редька з медом від кашлю

Найвідоміший з усіх — рецепт чорної редьки з медом. Роблять ліки так:

  • у свіжого овоча відрізають верхівку і видаляють м’якоть зсередини;
  • в отриману «чашку» заливають мед, а потім накривають зверху зрізаною верхівкою;
  • засіб настоюють кілька годин, поки мед всередині не витягне з овоча сік, і рідина не підніметься до верху «чашки».

Користь чорної редьки з медом полягає в тому, що це чудовий відхаркувальний. Вживати ліки потрібно в невеликих дозах — по 1 великій ложці не частіше 6 разів в день.

Важливо! Чорну редьку від кашлю дітям дають по 1 чайній ложечці за прийом — максимум 6 разів на день.

Чорна редька від застуди та бронхіту

Лікування чорною редькою дуже ефективно при спеці, нежиті, слабкості і бронхіті. Зазвичай роблять розігріваючі компреси з макухи, тобто, м’якоті, з якої вичавлений весь сік.

Макуха загортають у марлю, прикладають до спини або грудній клітці, накривають рушником і тримають, поки не з’явиться відчуття печіння. Властивості такого «гірчичника» сприяють розрідженню мокротиння і допомагають відкашлюватися, а також усувають жар.

Краплі при нежиті та гаймориті

Сік овоча добре прочищає носові пазухи. При закладеності носа засіб слід закапувати в кожну ніздрю двічі на день — не більше 6 крапель.

Засіб від запорів

У продукті присутній багато клітковини, тому він сприяє випорожненню кишечника. При схильності до закрепів рекомендується додавати овоч в салати і гарніри до других страв в кількості не більше 50 г на день.

Суміш при гіпертонії

Від підвищеного тиску добре допомагає такий засіб:

  • 1 велику ложку соку редьки змішують з такою ж кількістю морквяного соку;
  • додають 1 велику ложку соку хріну і буряків;
  • розбавляють засіб соком, вичавленим з одного лимона.

Лікарську суміш розмішують і п’ють по 1 великій ложці натщесерце тричі на день.

При болях у суглобах

Чорна редька для суглобів добре допомагає при артритах і артрозах. Потрібно змішати кілька компонентів в рівних пропорціях сік редьки, спирт, жовч медичну, морську сіль і мед.

Засіб наносять на шматочок марлі і роблять компрес для хворого ділянки на всю ніч, а вранці протирають шкіру горілкою або спиртом. Застосовувати корисні компреси рекомендується не менше 2 тижнів поспіль.

При діабеті

Продукт може знижувати рівень цукру в крові. Тому при діабеті він дуже корисний для вживання, а шкоди його властивості не наносять.

Овоч можна додавати в звичайну їжу, а можна робити цілющий настій з додаванням лаврового листа. Для цього кілька лаврових листочків спочатку заливають окропом і настоюють 3 години, а потім вживають по 100 мл тричі на день. Кожен раз в засіб додають по 20 мл соку редьки.

Від пухлин матки і мастопатії

Властивості овоча сприяють позбавленню від доброякісних і злоякісних пухлин. Зазвичай використовують настоянку — свіжий коренеплід нарізають маленькими шматочками, заливають горілкою і настоюють протягом 2 тижнів, а потім п’ють тричі на день до їди по 1 чайній ложці.

Важливо! Проводити терапію доброякісних і ракових пухлин, необхідно медичними препаратами, редька допускається тільки в якості допоміжного засобу.

Чорна редька для лікування остеохондрозу

Щоб зняти неприємні відчуття і болі в хребті, рекомендується щодня прикладати до хворого місця компреси з тертої шкірки овоча.

Чорна редька від радикуліту

Домашня мазь на основі овоча допоможе зняти біль і повернути рухливість попереку. Готують її так:

  • велику ложку тертої м’якоті потрібно змішати з медом у таких же обсягах;
  • додати щіпку солі;
  • залити засіб половиною столової ложки горілки;
  • перемішати і настояти 2 години.

Готовим засобом розтирають спину і поперек, при больових нападах мазь знімає запалення і заспокоює біль.

Для очищення печінки

Властивості редьки допоможуть вивести з організму накопичені шлаки і покращують роботу печінки.

  1. Свіжий сік овоча потрібно приймати тричі на добу.
  2. На першому тижні разова доза становить велику ложку, але з кожним тижнем обсяг ліки збільшують на 1 ложку.
  3. Таким чином, в останній тиждень редьку приймають вже за 6 ложок за один раз.

Щоб концентрований напій не завдав шкоди шлунку, засіб краще розбавляти водою приблизно на 30% від обсягу.

Чорна редька при різних шкірних захворюваннях

Високо цінуються корисні властивості продукту і в зовнішньому застосуванні. Соком овоча змащують порізи, роздратування і подряпини, можна також приготувати домашню мазь. Для цього м’якоть розминають в кашку і заливають червоним вином, а потім тримають на пару до тих пір, поки вино не випарується повністю.

Залишилася, кашку остуджують і наносять на уражені місця за необхідності. Мазь допомагає від дерматитів та екземи, від прищів і вугрів, сприяє загоєнню ранок і опіків.

Чорна редька в домашній косметології

Корисні властивості продукту використовують для турботи про красу. Овоч благотворно впливає як на волосся, так і на шкіру, запускає процеси оновлення і надає очищаючий ефект.

Маска для волосся

Головна користь продукту для волосся полягає в тому, що маски з редьки зміцнюють локони і зупиняють їх випадання. Застосовують продукт для волосся дуже просто — вичавлюють сік свіжого овоча, а потім втирають у шкіру біля коренів волосся і укутують голову теплим рушником. Через 2 години маску змивають.

Маска для обличчя

Властивості овоча допоможуть прибрати перші зморшки і омолодити шкіру. Корисну маску роблять так: 1 велику ложку натертої м’якоті змішують з такою ж кількістю оливкової олії і нежирної сметани. Суміш розподіляють по чистій шкірі, а через чверть години змивають.

Що можна приготувати з чорної редьки

Гострий корисний овоч добре поєднується з будь-якою зеленню, іншими овочами, фруктами. Найчастіше його можна зустріти в салатах разом з морквою, капустою, буряками. Нерідко додають овоч до м’ясних страв, супів, картоплі або рагу.

Іноді продукт використовують навіть в приготуванні десертів, наприклад, подають до столу з медом.

Смачний і простий салат з чорної редьки

Буквально за декілька хвилин свіжого овоча можна приготувати корисний і приємний на смак салат.

  1. Редьку очищають від жорсткої шкірки і промивають, потім натирають на тертці.
  2. Отриману кашку викладають у друшляк і ошпарюють окропом, щоб усунути можливий неприємний присмак.
  3. Ріпчасту цибулю нарізають, змішують з тертої редькою, причому цибулі повинно бути в 6 разів більше.
  4. Салат заправляють соняшниковою або оливковою олією, солять за смаком, при бажанні додають трохи чорного перцю.

Готову страву можна полити соком свіжого лимона і прикрасити зеленню, після чого подавати на стіл. Користь салату з чорної редьки буде в тому, що він не завдасть шкоди фігурі і благотворно вплине на обмін речовин.

Як прибрати гіркоту з чорної редьки

Недолік овоча полягає в тому, що на смак він злегка гірчить. Однак гіркота можна легко усунути — досить нарізати коренеплід, як слід посолити, витримати 7 хвилин, а потім злити виступив сік і промити продукт під водою.

Скільки чорної редьки можна з’їсти в день

Користь чорної редьки для організму людини залежить від кількості овочів у раціоні. Добова норма не повинна перевищувати 150 м, інакше здоров’ю може бути нанесена шкода.

Як правильно вибирати і зберігати чорну редьку

Вибрати продукт досить просто.

  1. Самі смачні і корисні коренеплоди — середні за розмірами. Занадто великі овочі мають жорсткої м’якоттю з великими прожилками.
  2. Хороший коренеплід має бути пружним і міцним, без тріщин і вм’ятин на шкірці.

Рада! Якщо хочеться купити солодкий продукт, то вибирати потрібно коренеплоди округлі. Витягнута по формі редька зазвичай відрізняється різким гострим присмаком.

Зберігати овоч потрібно в холодильнику в сухому місці, при цьому його рекомендується розміщувати окремо від інших продуктів. Час від часу потрібно витягувати коренеплід і перевіряти, чи не з’явилося на ньому м’яких бочків і цвілевих плям. Зберігається овоч при дотриманні умов протягом місяця.

Висновок

Користь і шкода чорної редьки залежать, головним чином, від дотримання заходів. В надлишкових кількостях овоч призведе до шлункових розладів і завдасть шкоди, але в малих дозах стане смачним елементом раціону і допоможе вилікувати багато недуг.

Відгуки

Петрова Марина Олександрівна, 36 років, р. Єкатеринбург
Чорну редьку від кашлю з медом пам’ятаю ще з дитинства — мені давали її батьки, і засіб завжди допомагало при застуді. Тепер я сама даю чорну редьку від кашлю дітям — і дуже приємно, що це ефективний засіб подобається їм на смак.

Вороніна Людмила Олексіївна, 55 років, Саратов р.
Чорна редька для суглобів чинить мені незамінну допомогу при загостренні артриту — рухатися стає набагато простіше. Крім того, використовую чорну редьку при гаймориті — краплі швидко знімають закладеність носа, а побічних ефектів від застосування немає.

23 декабря 2020 - какой сегодня праздник, приметы и дни рождения, чего сегодня нельзя делать

23 декабря - 357-й день года по григорианскому календарю, до конца года остается 8 дней. В XX и XXI веках этот день соответствует 10 декабря по юлианскому календарю.

Какой праздник 23 декабря 2020 года

В этот день мир отмечает День Снежных ангелов, Праздник человеческого света, Всемирный день сноуборда.

В Украине - День штабов и специальных войск связи, в Канаде - Пьяный вечер, в Швеции - День рождения королевы, в Мексике - Ночь редиса, в США - День семейных корней, Festivalus, в Судане - Детский День, в Египте - День Победы, в Индии - День фермера, в Исландии - Св.День Торлака, в Литве - День Блюкаса, в Британии - вечер Тома Букока.

Памятные даты 23 декабря, годовщины и события

23 декабря 1876 года была принята первая Конституция Османской империи.

В 1900 году Реджинальд Фессенден вел первую в мире аудиопередачу по радио.

В 1913 году Федеральная резервная система США была создана из ряда крупных банков. На сегодняшний день только банки, входящие в состав ФРС, имеют право выпускать доллары.

23 декабря 1947 года считается Днем изобретения транзистора. Первый транзистор был создан американскими физиками Уильямом Шокли, Джоном Бардином и Уолтером Браттейном в лабораториях Bell Labs. Произошло это 16 декабря 1947 года, а через неделю - 23 декабря - состоялась официальная презентация изобретения. В 1956 году ученым была присуждена Нобелевская премия по физике «за исследование полупроводников и открытие эффекта транзистора». Джон Бардин вскоре получил во второй раз Нобелевскую премию за свою теорию сверхпроводимости.Позже транзисторы заменили вакуумные лампы в большинстве электронных устройств, что произвело революцию в создании интегральных схем и компьютеров. Название новому устройству придумал Джон Пирс.

Какой церковный праздник сегодня

Церковь чтит память святых мучеников красноречивой шахты Евграфа и Гермогена / фото ua.depositphotos.com

23 декабря Православная Церковь чтит память святых мучениц Мины Красномовны, Евграфа и Ермоген. Праздник в народе называют Днем Мины.

Чего сегодня не делать

В этот день категорически запрещалось ругаться и повышать голос - это может рассердить святого.

Знаки на 23 декабря

Испокон веков в этот день есть погодные знаки:

- погода ясная - скоро пойдут заморозки;

- снег легко разносится ветром - лето будет без дождя.

День рождения 23 декабря

Дни рождения Анны, Ермогена, Степана, Евграфа, Ангелины, Алексея, Евгения, Якова, Ивана, Стефана, Константина, Александры, Сергея, Татьяны, Петра, Михаила, Григория и Анатолия.

Вас также могут заинтересовать другие новости:

Читайте новости шоу-бизнеса, гороскопы на канале УНИАН Лайт Telegram

Автор: Нана Чорна

Если вы обнаружили ошибку, выделите ее мышью и нажмите Ctrl + Enter.


Источник: Інформаційне Агентство УНІАН от www.unian.ua.

* Статья переведена на основе содержания Информаційне Агентство УНІАН www.unian.ua. Если есть какие-либо проблемы с содержанием, авторскими правами, оставьте, пожалуйста, отчет под статьей.Мы постараемся обработать как можно быстрее, чтобы защитить права автора. Большое спасибо!

* Мы просто хотим, чтобы читатели получали более быстрый и легкий доступ к информации с другим многоязычным контентом, а не с информацией, доступной только на определенном языке.

* Мы всегда уважаем авторские права на контент автора и всегда включаем исходную ссылку на исходную статью. Если автор не согласен, просто оставьте отчет под статьей, статья будет отредактирована или удалена по запросу автор.Спасибо большое! С наилучшими пожеланиями!


Гербицид Золотая Звезда - СоюзАгроТрейд, ООО Новомосковск (Новомосковск) | Купить Гербицид Gold Star Новомосковск (Украина)

Высокоефективный післясходовия гербіцид системї дії для контроля дводольных бурьянів, при этом числ ведут стійкі к 2,4-Д на посіва зерновых колосовых культур.

Діюча реховин.
Трибенурон-метил, 750 г / кг.
Форма препаративная. Водорозчинні на гранулы.
Хімічна группа. Sulfon_lsechovini.
Сум_сн_ст. Сумісны з білшістю засобів захисту Рослина, що використовуются на зерновых культурах, что з рідкой добрива, про-то в кожные специфические випадки необхідно перевірят препарат на сумісніст.

Механизм дії. Это система дія. Препарат подвергается лести и переходит на то, чтобы указать на рост, угнетать фермент ацетолактатсинтазу, що зупиня ростовый клин бурьян.
Диапазон дії. Найчутливіші: гірчак почечуйня, ромашка (ведёт), гірчится полев, гірчится чорна, гірчитсяії, дворник, редис дикий, щірится розлога_ зловічникі, кірчіця розлогаі, кірчіція дикий, зірчіцій дикий, зірчіції ії , Лобода біл, (веди) жабы, мак дикий, (веди) піщанка, смілка конічн, соняшник (падалиця), споришь, сухоребрик, талабан полёвия, жабрій звичайния. Помірночутливі: будяк полівія, волошка Ксина, гірчак березковидний, калачик, говядина молочная, осот поливий, підмаренник чіпкия, рутка лікарск трикрыісалкілка, фірчак березковидний
Стійкі: берізка полев, веронік плющелистов, всі вести злаковый бурьянів.

Культура Норма витрата к препарату, г / га Бурьян Час обробки
Стадія к росту культуре Стадія росту бурьяну
Пшеница

унций,

яхмін

озимия,

жито

15–20 Однорічні дводольні Кущіння Z к фазе сімьядолі

к 6 листк_в

20 Обприскування пос_в_в

від к фазе кущіння

на выход в тубус

к культуре

Пізніші стада ії
20 Падалится к соняшнику 10-15 см
20-25 Будяк полевой, осот жовтия 10-15 см
25 Підмаренник чіпкия К 4-му кілецу
Пшеница Джара,

яхмін ярия

15 Однорічн_

дводольні

Z к фазе 2 - 3 листк_в появе

прапорцевый лист включно

На фаз_ 2-6 листк_в

Максимальный кілкіст обробок - 1.Пер_од очікування к збору врожать не устанавливается.
Норма vitrata robochy розчину -200-300 л / га. Препарат використовуется з даванням ПАРОВОЙ ТАНДЕМ (200 мл на 100 л Води). Z монетный двор одержання по возможности эффективностью необхідно забэзпечить достатні рівноміне обприскування надземної частин бурьянів. Наефективніший період для застосування - фаза інтенсивная к росту бурьянів. В фазе культивирования розвитка к може бут від 2 - 3 листків появу прапорцевого листа.Наиболее эффективными средствами для приготовления теплая погода при достатній вологості повітря и ірнт.

Оптимальная температура повітря від от +15 до +24 ° С. Обробка при низких температурах не впливается в эффективність дії препарату, а лиш дещо збілш тривалість настання загибель бурьянів.

Упаковка. 0,5 кг.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Агонист-индуцированное фосфорилирование и десенсибилизация нуклеотидного рецептора P2Y2.

Mol Cell Biochem. Авторская рукопись; доступно в PMC 2006 2 ноября.

Опубликован в окончательной отредактированной форме как:

PMCID: PMC1633720

NIHMSID: NIHMS3660

Rosa V. Flores

1 Departments of Chemistry

o Piedras, Rí16o Piedras Мелвин Г. Эрнандес-Перес,

,

, , 1 , химический факультет, кампус Рио-Пьедрас, и

,

, Эдна Акино,

,

, , 1, , химический факультет, кампус, Рио-Пьедрас, и

,

, Ричард К.Гаррад

3 Департамент биомедицинских наук, Юго-западный штат Миссури Университет, Спрингфилд, Миссури; и

Гэри А. Вейсман

4 Департамент биохимии, Университет Миссури-Колумбия, MO

Fernando A. Gonzalez

1 Отделения химии, кампус Рио-Пьедрас и

2 Биохимия, кампус медицинских наук, Университет Пуэрто Рико, Сан-Хуан, PR;

1 кафедры химии, кампус Рио-Пьедрас, и

2 биохимия, кампус медицинских наук, университет Пуэрто Рико, Сан-Хуан, PR;

3 Департамент биомедицинских наук, Юго-западный штат Миссури Университет, Спрингфилд, Миссури; и

4 Департамент биохимии Университета Миссури-Колумбия, MO

* Кому направлять корреспонденцию: Dr.Фернандо А. Гонсалес, факультет химии Университета Пуэрто-Рико, Кампус Рио-Пьедрас, P.O. Box 23346, San Juan, PR 00931-3346, тел. (787) 764-0000 доб 2437, ФАКС (787) 758-5612, электронная почта: [email protected]

§ Текущий адрес: Кафедра микробиологии и медицинской зоологии, Университет Пуэрто-Рико, кампус медицинских наук, Сан-Хуан, PR

. Последняя отредактированная версия этой статьи доступна на сайте Mol Cell Biochem. См. другие статьи в PMC, в которых цитируется опубликованная статья.

Резюме

Очистка HA-меченных P2Y 2 рецепторов от трансфицированных Клетки астроцитомы человека 1321N1 дали белок с молекулярным размером определено с помощью SDS-PAGE в диапазоне 57–76 кДа , что характерно для мембранных гликопротеинов с гетерогенным комплексом гликозилирование. Ингибитор протеинфосфатазы окадаиновая кислота ослабляла восстановление активности рецепторов из состояния десенсибилизации, вызванного агонистами, предполагая роль фосфорилирования рецептора P2Y 2 в десенсибилизация.Выделение HA-меченных P2Y 2 нуклеотидных рецепторов из метаболически [ 32 P]-меченных клеток указали на увеличение в 3,8 ± 0,2 раза [ 32 P] -содержание рецептора через 15 мин. лечение 100 мкМ UTP по сравнению с иммунопреципитированными рецепторы из необработанных контрольных клеток. Указаны исследования секвестрации рецепторов что ~ 40% поверхностных рецепторов интернализовались через 15 мин. стимуляция 100 мкМ UTP.Точечная мутация трех потенциальных GRK и сайты фосфорилирования PKC в третьей внутриклеточной петле и С-конце хвост рецептора P2Y 2 (а именно, S243A, T344A и S356A) подавление фосфорилирования рецепторов, вызванное агонистами, вызвало заметное снижение в эффективности UTP для десенсибилизации передачи сигналов рецептора P2Y 2 к мобилизация внутриклеточного кальция и нарушение рецепторов, вызванных агонистами интернализация.Активация изоформ PKC форбол 12-миристат 13-ацетатом вызывающий десенсибилизацию гетерологичных рецепторов, не увеличивал уровень P2Y 2 фосфорилирование рецептора . Наши результаты указывают на роль фосфорилирование рецептора нечувствительными к форболу протеинкиназами в индуцированная агонистами десенсибилизация нуклеотидного рецептора P2Y 2 .

Сокращения: AAA-P2Y 2 , S243A, T344A и S356A тройной мутант P2Y 2 ; БСА, бычий сывороточный альбумин; [Ca 2+ ] i , внутриклеточная концентрация свободных ионов кальция; DMEM, среда Игла, модифицированная Дульбекко; EC 50 , концентрация агониста, которая продуцирует 50% отклик; FITC, флуоресцеинизотиоцианат; GPCR, рецептор, связанный с G-белком; GRK, рецепторная киназа, связанная с G-белком; НА, гемагглютинин; Hepes, N- [2-гидроксиэтил] пиперазин-N ’- [2-этансульфоновая кислота кислота]; IC 50 , концентрация агониста, ингибирующая 50% отклик; MAPK, митоген-активированная протеинкиназа; PKC, протеинкиназа C; PLC-b, фосфолипаза C-бета; P2Y 2 -1321N1, HA-меченные P2Y 2 трансфицированные клетки 1321N1; PMA, форбол 12-миристат 13-ацетат; PMSF, фенилметилсульфонилфторид; SEM, стандартная ошибка среднего; WT-P2Y 2 , дикий тип P2Y 2

Введение

Гепталический рецептор нуклеотидов P2Y 2 соединяется с активация митоген-активированных протеинкиназ (MAPK), мобилизация внутриклеточные запасы кальция, активация фосфолипазы C-β (PLC-β), изоформы протеинкиназы C (PKC), очаговая адгезия киназа и c-Src киназа, и участвует в ряде физиологических и патологические процессы, включая воспаление (1, 2), реактивный астроглиоз (3) и нейропротекцию (4).Нуклеотиды, действующие через P2Y 2 рецептор индуцирует секрецию Cl - в дыхательных путях. эпителиальные клетки, не зависящие от муковисцидоза регулятор трансмембранной проводимости (5), и P2Y 2 лиганды рецептора были предложены в качестве нового класса лекарств. для лечения отслойки сетчатки (6) и улучшение мукоцилиарного клиренса при таких клинических состояниях, как муковисцидоз (7).

Имеется ограниченная информация о регулировании сигнализации P2Y 2 рецептор нуклеотидов . Как и в других рецепторах, связанных с G-белком (GPCR), передача сигналов нуклеотидного рецептора P2Y 2 регулируется десенсибилизация, вызванная агонистами (8, 9). Механизмы десенсибилизации GPCR имеют наиболее широко изучен с b 2 -адренергическим рецептором (10, 11). Фосфорилирование, опосредованное G-протеин-связанной рецепторной киназой (GRK), увеличивает связывание цитозольных белков, называемых аррестинами, с β 2 -адренорецептор, приводящий к его интернализации (12–16).Было показано, что GRK-опосредованное фосфорилирование нацелено на связанный с аррестином b 2 -адренергический рецептор в направлении секвестрации через ямки, покрытые клатрином (17). Усечение C-концевых областей GPCR, содержащих консенсусные последовательности для потенциального фосфорилирования GRK, как было показано, нарушает Секвестрация β 2 -адренергических рецепторов (14).

Нуклеотидный рецептор P2Y 2 представляет собой рецептор, связанный с белком Gq, который одинаково стимулируется UTP и ATP, опосредуя активацию фосфолипазы C-бета (PLC-β) и митоген-активированная протеинкиназа (MAPK) (18, 19).Ранее мы сообщали, что рецептор P2Y 2 подвергается быстрой десенсибилизация, вызванная агонистами (8, 9, 20). Важно отметить, что обработка десенсибилизированных клеток протеинфосфатазой ингибитор, окадаиновая кислота, ингибирует ресенсибилизацию рецептора, что позволяет предположить роль фосфорилирования белка в регуляции рецептора P2Y 2 сигнализация (9, 20). Более того, мутанты с укорочением указали на важную роль С-концевой хвост рецептора P2Y 2 при десенсибилизации и секвестрации рецептора (8).

В этой статье мы исследовали десенсибилизацию, вызванную UTP, фосфорилирование и секвестрация эпитопа, меченного гемагглютинином (НА) P2Y 2 рецептор , трансфицированный в клетках астроцитомы человека 1321N1. Антитела направленный к HA-метке, облегчает обнаружение рецептора P2Y 2 посредством проточная цитометрия, конфокальная микроскопия, иммунопреципитация и вестерн-блоттинг в анализы секвестрации и фосфорилирования.Опосредованная агонистами десенсибилизация P2Y 2 рецептор, опосредованный Ca 2+ мобилизация коррелирует с увеличением фосфорилирования и секвестрации рецепторов. Мы подтвердили, что ингибирование протеинфосфатаз окадаовой кислотой уменьшилось ресенсибилизация рецепторов. Кроме того, точечная мутация потенциальных сайтов для GRK и Фосфорилирование PKC снижает индуцированное агонистами фосфорилирование и интернализацию рецептора P2Y 2 , а также эффективность UTP для индукции десенсибилизации.Интересно, что гетерологичная десенсибилизация, индуцированная форбол 12-миристатом 13-ацетат происходил в отсутствие повышенного фосфорилирования рецептора. Эта учеба дает лучшее понимание молекулярных механизмов десенсибилизации P2Y 2 рецептор нуклеотидов .

Экспериментальные процедуры

Материалы

[ 32 P] -ортофосфат (без HCl, без носителя) и протеин A-сефароза CL-4B были приобретены у Amersham Pharmacia Biotech.Моноклональные антитела против HA 12CA5 и против HA-пероксидазы 3F10 антитела были предоставлены Roche Molecular Biochemicals. Хрен маркеры пероксидазы-протеина для вестерн-блоттинга были приобретены в Новой Англии. Биолаборатории. Не содержащая фосфатов среда Игла, модифицированная Дульбекко (DMEM) и Geneticin были поставлены Invitrogen Life Technologies. Реагенты для тканевых культур были из Гиклона. Все остальные реагенты были получены от Sigma.

кДНК гена рецептора P2Y2

кДНК рецептора P2Y 2 была субклонирована в ретровирусную вектор pLXSN на сайтах Eco RI / Bam HI сайт множественного клонирования. Открытая рамка считывания рецептора P2Y 2 кДНК была модифицирована с использованием полимеразной цепной реакции, чтобы включить гемагглютинин (НА) эпитоп (YPYDVPDYA) вируса гриппа на аминоконце экспрессируемый белок, как описано ранее (8).Прямой и обратный праймеры HA, разработанные для этого исследования, были (HA-тег закодирован подчеркнутой последовательностью): 5’ – gatcgtgaattctgatgtatccatatgatgttccagattatgctgcagcagacctggaaccctgg – 3 ’ а также 5’ – gatcgtggatcccctgactgaggtgctatagccg – 3 ’, соответственно. Мутантный рецептор P2Y 2 был сконструирован путем изменения серин-243, треонин-344 и серин-356 в аланин (AAA-P2Y 2 ).Рекомбинантные конструкции кДНК секвенировали на обеих цепях, чтобы гарантировать, что мутагенез произошел, как и ожидалось, с использованием автоматического секвенирования ABI Prism аппарат (Perkin-Elmer) и флуоресцентная дидезоксинуклеотидная технология.

Культура клеток и трансфекция

Клетки астроцитомы 1321N1 выращивали в модифицированной среде Дульбекко. Среда Игла (DMEM) с добавлением 5% феталклона III бычья сыворотка, 100 единиц / мл пенициллина, 100 пг / мл стрептомицина, 5 мМ Hepes и 500 пг / мл Генетицина (G418) (21).Клетки высевали из расчета 2,5 x 10 6 на 75 см 2 культуры ткани колб и выращивали до ~ 90% конфлюэнтности во влажной атмосфере 5% CO 2 и 95% воздуха. Клетки 1321N1 были трансфицированы кДНК рецептора P2Y 2 , меченной НА, с использованием pLXSN ретровирусный вектор, как описано ранее (22).

Внутриклеточная мобилизация свободных ионов кальция

Активация рецептора P2Y 2 контролировалась путем обнаружения изменения внутриклеточной концентрации свободных ионов кальция (т.е., [Ca 2+ ] i ) в fura2 меченые клетки 1321N1 с использованием спектрофлуориметра с двойным возбуждением, как описано ранее (9, 23). Клетки анализировали в 15 мМ Hepes-буфере. физиологический раствор (pH 7,4), содержащий 1 мМ CaCl 2 , 1 мМ MgCl 2 , 0,1% (мас. / Об.) Бычьего сывороточного альбумина (БСА) и 0,18% (мас. / Об.) глюкоза. Эксперименты по десенсибилизации проводили путем инкубации суспензию трансфицированных клеток 1321N1 с различными концентрациями UTP или PMA для 15 мин при 37 ° C.Клетки осаждали в микроцентрифуге и ресуспендировали в 2 мл буфера Hepes. Концентрация UTP, равная значению EC50. для каждой клеточной линии использовали для повторного испытания клеток на десенсибилизацию рецептора. эксперименты. Мобилизация кальция указывается как отношение к максимальной отклик. Данные «концентрация-ответ» были проанализированы с помощью аппроксимации кривой призмы. программа (GraphPAD Software for Science, Сан-Диего, Калифорния).

Иммунопреципитация рецептора

Клетки 1321N1 высевали при 2,5 × 10 6 клеток / 25 мл в 25 мм × 150-миллиметровые чашки для культивирования тканей и позволили вырасти до слияния ~ 90%. В день эксперимента каждый клеточный монослой дважды промывали 5 мл раствора. бессывороточной среды DMEM, оставляя 5 мл среды над клетками. Тогда клетки были либо стимулированы в течение 15 минут 100 мкМ UTP, либо обработаны контрольной с бессывороточной средой.Чашки для культивирования помещали на лед и среду аспирировали с последующими двумя промываниями ледяным PBS. Финальная стирка была аспирирована. и 700 мкл буфера RIPA (2x) [300 мМ NaCl; 100 мМ Трис-HCL; 10 мМ ЭДТА; 2% (об. / Об.) НП-40; 1% (мас. / Об.) Дезоксихолат натрия; 0,2% (мас. / Об.) SDS; 20 мМ NaF; 20 мМ пирофосфат динатрия; 20 пг / мл бензамидин, лейпептин и ингибитор трипсина сои; Апротинин 10 пг / мл; 2 пг / мл пепстатина А; и 0.2 мМ PMSF; pH 8]. Клетки были соскребают в этом объеме и растворяют в течение 1 ч при 4 ° C с осторожным качание. После солюбилизации экстракт центрифугировали при 200000 x g в течение 45 мин при 4 ° C. Супернатант смешивали со 100 мл 10% раствора. (мас. / об.) протеин A-сефароза, полученная в 3% буфере BSA / RIPA (1x) и инкубируют 1 ч при 4 ° С при осторожном покачивании. Подвеска была центрифугировали при 12000 x g в течение 2 мин при 4 ° C и предварительно очищенном супернатант смешивали с 50 мкг антитела против НА и 100 мкл 10% Белок А-Сефароза.Образцы инкубировали в течение ночи при 4 ° C. с легким покачиванием. На следующий день гелевую матрицу промывали трижды. используя буфер RIPA (1x) при 4 ° C, и конечный осадок ресуспендировали в 50 мкл загрузочного буфера SDS (1x). Образцы инкубировали при 65 ° C. в течение 10 мин для элюирования комплексов антиген-антитело и гелевый матрикс гранулированный, как и прежде. Супернатант был удален и сохранен в –20 ° C до анализа SDS-PAGE (10%). выполненный.

SDS-PAGE и вестерн-блоттинг

Иммунопреципитированные образцы анализировали в 10% растворе натрия. додецилсульфат-полиакриламидный гель. Белки были перенесены электрофоретически на нитроцеллюлозные мембраны с использованием переноса трисглицина буфер и постоянное напряжение 15 В в системе полусухого переноса (Bio-Rad) в течение 1,5 час Нитроцеллюлозную мембрану блокировали на 1 час 5% обезжиренным сухое молоко в ФБС-0.1% Tween 20 pH 7,2 (PBS-T), затем три быстрое ополаскивание PBS-T. Затем мембрану инкубировали с 1 мкг антитело против НА-пероксидазы 3F10 (Roche Molecular Biochemicals) в 10 мл 5% обезжиренное сухое молоко в PBS-T pH 7,2 в течение 1 часа при комнатной температуре или в течение ночи при 4 ° C при легком перемешивании. Антибиотинпероксидаза (10 мл, New England BioLabs) также добавляли для обнаружения биотинилированного стандарты белка.Мембрану промывали трижды по 10 мин PBS-T. перед добавлением раствора для обнаружения люминола (SuperSignal West Dura, Pierce). Осушенная нитроцеллюлозная мембрана, покрытая полиэтиленовой пленкой, экспонировалась 15 мин на Molecular Imager Screen-CH (GS-525 Bio-Rad, Hercules, CA) для хемилюминесцентный анализ общего белка.

Фосфорилирование рецептора

HA-меченный P2Y 2 трансфицированных клеток 1321N1 (P2Y 2 -1321N1) были засеяны и выращены, как указано в рецепторе. иммунопреципитация.В день эксперимента каждый клеточный монослой был промывали два раза 5 мл бессывороточной среды DMEM, не содержащей фосфатов, в результате чего оставалось 5 мл среду над клетками. Затем 2,5 мКи [ 32 P] -ортофосфат добавляли в каждую чашку. и инкубировали при 37 ° C в течение 2 часов. Окадаиновая кислота (конечная концентрация 1 мкМ концентрации) добавляли за 10 минут до UTP или PMA, которые инкубировали в течение последние 15 минут из 2-часового периода маркировки согласно Freedman et al. аль (24).P2Y 2 рецептор очищали иммуноочисткой и анализировали с помощью SDS-PAGE и вестерн-блоттинга как описано ранее. Данные фосфорилирования были получены до хемилюминесценции. анализ путем воздействия на нитроцеллюлозную мембрану Molecular Imager Phosphor Screen-BI ™ (GS-525 Bio-Rad, Геркулес, Калифорния) в течение 18 часов. Общий белок был определен с помощью хемилюминесценции путем экспонирования та же мембрана к Molecular Imager Screen-CH в течение 15 мин после визуализации полос с антителами против НА-пероксидазы, как описано ранее.Данные фосфорилирования нормализовали к данным общего белка путем деления [ 32 P] подсчет по хемилюминесценции подсчитывает.

Анализ секвестрации проточной цитометрией

Процедура была выполнена в основном, как описано ранее (8). Вкратце, клетки P2Y 2 -1321N1 были выращены до ~ 90% конфлюэнтности в 35 мм 2 чашках для культивирования и инкубировали со 100 мкМ UTP в течение различных периодов времени.Контроль клетки инкубировали без UTP, чтобы оценить общее количество обнаруживаемых клеточная поверхность P2Y 2 рецепторов. Затем обработанные UTP клетки промывали ледяной буфером Hepes и инкубируют при 4 ° C в течение 1 ч с тем же буфер, содержащий 10 мкг антитела против HA 12CA5. Ячейки были промыты и инкубировали с PBS, содержащим 30 пг / мл Fc-специфичного флуоресцеинизотиоцианата (FITC) -меченые козьи антимышиные антитела (Sigma) в темноте при 4 ° C за 1 ч.Контрольные клетки инкубировали только с первичным или вторичным антителом. для обнаружения неспецифической флуоресценции. Промытый PBS P2Y 2 -1321N1 клетки отделяли от чашек с использованием буфера Hepes, содержащего 2 мМ EDTA. Их центрифугировали и ресуспендировали в 1 мл 1% (об. / Об.). формальдегид в PBS и инкубировали в темноте при 4 ° C еще 10 минут. Наконец, клетки центрифугировали и ресуспендировали в 0.5 мл PBS и анализировали на проточном цитометре EPICS 753 (Coulter Corp., Хайалиа, Флорида) с 5-ваттный аргоновый лазер, настроенный на 488 нм, с выходной мощностью 150 милливатт.

Конфокальная микроскопия

Клетка 1321N1, трансфицированная либо диким типом, либо мутантом AAA P2Y 2 R культивировали на предметных стеклах с камерой Laboratory-Tek (Nalge Nunc Int., Rochester, NY, USA) в течение 3 дней в культуральной среде. В день анализа клетки уравновешивали бессывороточной средой в течение 1 ч при 37 ° C.Неспецифические белковые участки блокировали 1% (мас. / Об.) Бычьей сывороткой. альбумин в PBS (блокирующий буфер) в течение 15 мин при 4 ° C. Клетки тогда были инкубировали с 10 пг / мл мышиных моноклональных антител против НА (Roche Molecular Biochemicals) в блокирующем буфере в течение 1 ч при 4 ° C с образованием комплексы рецептор / антитело и трижды промывали ледяным PBS. Ячейки были инкубировали с 10 мкМ UTP или без него при 37 ° C в течение 5, 15, или 30 мин.Клетки трижды промывали ледяным PBS и фиксировали 2% формальдегид в PBS в течение 10 мин при комнатной температуре. Плазма окрашивание мембраны агглютинином-техасским красным зародышей пшеницы (молекулярные зонды) выполняется, как описано Holloway et al . (25). Изображения были получены с использованием Zeiss (Торнвуд, Нью-Йорк, США) LSM-5 Pascal сканирующий конфокальный микроскоп с Alpha-Fluar 100 × 1.45 Маслоиммерсионный объектив DIC. Аргоновый и гелий-неоновый лазеры использовались для возбуждение Alexa Fluor 488 и Texas Red соответственно. Эмиссия от Alexa Fluor 488 и Texas Red были обнаружены с помощью BP 505–530 и LP 560. фильтры, соответственно, с использованием режима мультитрекового сканирования. P2Y 2 рецептор секвестрацию анализировали путем определения совместной локализации рецептора с маркер плазматической мембраны агглютинин зародышей пшеницы-техасский красный (WGA).Взвешенный коэффициент колокализации иммуноокрашенного рецептора P2Y 2 с пшеницей Зародыш агглютинин-техасский красный (WCC: P2Y2 / WGA) определяли с использованием Zeiss LSM. 5 Pascal Software Release 3.2 , который вычисляет коэффициент в соответствии со следующим уравнением:

WCC: P2Y2 / WGA = S (интенсивности для колокализованных пикселей) / S (общие интенсивности пикселей)

Статистический анализ

Одностороннее множественное сравнение Тьюки пост-тесты анализ дисперсионного теста (ANOVA) и непарный t-критерий Стьюдента использовались для сравнения несколько групп и две группы соответственно.Вероятность <0,05 между контрольная и опытная группы считались статистически значимыми. Все анализы были выполнены с помощью программного обеспечения InStat версии 3.06 (GraphPad Software Inc. Сан-Диего, Калифорния).

Результаты

N -концевой рекомбинант с меткой гемагглютинина (НА) P2Y 2 рецептора были сконструированы с помощью полимеразной цепной реакции и экспрессируется в клетках астроцитомы 1321N1 для исследования UTP-опосредованного рецептора десенсибилизация, фосфорилирование и секвестрация.Тег HA (YPYDVPDYA) - это специфически распознается коммерчески доступными моноклональными препаратами 12CA5 и 3F10 антитела.

Иммунопреципитация рецептора P2Y2 выявляет неоднородный рецепторный белок распределение

Солюбилизированные белковые экстракты HA-меченного P2Y 2 трансфицированных Клетки 1321N1 (P2Y 2 -1321N1) иммунопреципитировали с помощью 12CA5 анти-HA. моноклональные антитела.Вестерн-блоттинг иммунопреципитированных продуктов выявил гетерогенность рецепторного белка размером от 57 до 76 кДа, и единственная белковая полоса 45 кДа (, дорожка 2). Трансфицированные вектором клетки 1321N1 не дали продуктов иммунопреципитации. также элюент от промытой матрицы сефарозы (дорожки 3 и 4, соответственно). Полосы не обнаружены в образец, состоящий из антитела 12CA5 против НА, что указывает на то, что обнаруженные полосы происходили из клеток P2Y 2 -1321N1 и не являлись контаминантами введены антителом, используемым в протоколе иммунопреципитации (, дорожка 6).

Иммунопреципитация HA-меченного P2Y 2 рецептора

Клетки 1321N1, стабильно трансфицированные HA-меченным P2Y 2 рецептором или с вектором pLXSN без рецептора были солюбилизированы детергентом и иммунопреципитирован моноклональным антителом против НА 12CA5. Иммунопреципитированные продукты были разделены на 10% SDS-PAGE, переносят на нитроцеллюлозу и подвергают иммуноблоттингу с использованием 3F10. моноклональные антитела против НА-пероксидазы.Образцы в блоте: белок стандарты (дорожки 1 и 5), иммунопреципитация от меченного НА P2Y 2 трансфицированных клеток (дорожка 2), иммунопреципитация из pLXSN клетки, трансфицированные вектором (дорожка 3), продукты, элюированные анти-HA сшитая гелевая матрица (дорожка 4) и только антитело против НА 12CA5 (используется для реакции иммунопреципитации) (дорожка 6). Показанные результаты являются репрезентативными для три отдельных эксперимента.

Опосредованная агонистами десенсибилизация рецептора P2Y2 включает фосфорилирование

Внеклеточный UTP вызывает зависимую от концентрации активацию P2Y 2 рецепторов, которые опосредуют быстрое и временное увеличение внутриклеточная концентрация свободных ионов кальция ([Ca 2+ ] i ) как сообщалось ранее (9). Соперник концентрация, которая дает 50% значения ответа (EC50), была равна 0.32 мкМ (log EC50 = -6,5 ± 0,1) (). Десенсибилизация UTP-опосредованный кальциевый ответ был определен после 15-минутной предварительной обработки клетки с различной концентрацией UTP. Десенсибилизация была быстрой, проявляя концентрация агониста, которая подавляет 50% ответа (IC50) значение 6,3 мкМ (log IC50 = -5,2 ± 0,2) (). Поток цитометрический анализ секвестрации HA-меченных рецепторов P2Y 2 был выполняется с использованием мышиных антител к HA 12CA5 и флуоресцеинизотиоцианата (FITC) -меченное козье антимышиное антитело.Около 40% рецепторов были изолированы в течение 15 мин инкубации со 100 мкМ UTP ().

UTP-индуцированная секвестрация P2Y 2 рецепторов, экспрессируемых в Клетки 1321N1

Клетки 1321N1, экспрессирующие HA-меченные рецепторы P2Y 2 , инкубировали при 37 ° C с 100 мкМ UTP в течение указанного времени. Контрольные клетки инкубировали без UTP для определения общего количества обнаруживаемых клеточная поверхность P2Y 2 рецепторов.Клетки промывали в пробе. буфер и инкубируют с козьим меченным флуоресцеинизотиоцианатом (FITC) антимышиные антитела при 4 ° C в темноте в течение 1 часа. Ячейки были снова промыли и проанализировали проточной цитометрией, как описано в разделе «Экспериментальная часть». Процедуры. Каждое показанное значение выражается в процентах от общей P2Y 2 рецептора , обнаруженные в контрольных клетках, которые были обработаны с буфером носителя без UTP.Представленные данные являются средними ± SEM результатов трех независимых экспериментов.

Таблица 1

Значения EC 50 и IC 50 для разных P2Y 2 рецепторные конструкции экспрессируются в клетках 1321N1.

.32 (-6,5 ± 0,1)
EC 50, μ M (log EC 50 )
IC 50, μ M log ( 50 )
P2Y 2 Рецептор UTP UTP PMA
дикий тип
6,3 (-5,2 ± 0,2) 3,2 (-5,5 ± 0,2)
AAA-P2Y 2 0,20 (-6,7 ± 0,1) 79 (-4,1 ± 0,2) 2,0 (-5,7 ± 0,3)

Предыдущие сообщения предполагали, что фосфорилирование рецепторов играет роль роль в модуляции десенсибилизации и восстановления рецептора P2Y 2 (9, 20). В соответствии с этой идеей мы заметили, что восстановление передачи сигналов рецептора P2Y 2 после Десенсибилизация, вызванная агонистами, подавлялась на 50% после лечения с 1 мкМ ингибитора протеинфосфатазы окадаиновой кислоты ().Обработка окадаиновой кислотой не имела влияние на десенсибилизацию рецепторов. Однако для непосредственной оценки фосфорилирования рецептора P2Y 2 , мы разработали анализ фосфорилирования рецептора с использованием протокола иммуноочистки для метаболического исследования Меченый [ 32 P] -ортофосфат P2Y 2 -1321N1 ячеек. Лечение [ 32 P] -ортофосфатные клетки с 100 мкМ агонист UTP вызывал значительное увеличение [ 32 P] -радиоактивность, связанная с иммунопреципитированные белки в области 57–76 кДа по сравнению с контролировать нестимулированные клетки ().

Влияние ингибитора фосфатазы окадаиновой кислоты на восстановление P2Y 2 Рецептор от UTP-индуцированной десенсибилизации

Fura2-меченные P2Y 2 -1321N1 клетки инкубировали со 100 мкМ UTP в течение 15 мин при 37 ° С в присутствии 1 мкМ окадаиновой кислоты. Клетки промывали, ресуспендировали в буфере. и либо немедленно анализируется на мобилизацию Ca 2+ (открытые столбцы) или инкубируют в течение 30 мин в среде, не содержащей UTP (заштрихованные столбцы), в наличие или отсутствие 1 мкМ окадаиновой кислоты перед измерением изменения в [Ca 2+ ] i в ответ на 1 мкМ UTP, как описано в экспериментальной Процедуры.Данные выражены в процентах от максимального отклика на 100 мкМ UTP в контрольных необработанных клетках. Данные средние ± SEM результатов трех независимых экспериментов. Ячейки с Обработка окадаовой кислотой сравнивалась с параллельными культурами без окадайной кислоты. кислотная обработка (*** p <0,001; нс, p> 0,05 односторонний дисперсионный анализ).

UTP-индуцированное фосфорилирование P2Y 2 рецепторов

Клетки 1321N1, экспрессирующие HA-меченный ген рецептора P2Y 2 , были метаболически помеченный [ 32 P] -ортофосфат в течение 2 ч в среду без сыворотки и фосфатов, а затем заражали 100 мкМ UTP в течение 15 мин, как описано в экспериментальных процедурах.Контрольные нестимулированные клетки заражали средой-носителем. Ячейки были лизированные и солюбилизированные детергентом клеточные экстракты анализировали с помощью анти-HA иммунопреципитация, SDS-PAGE (10%) и вестерн-блоттинг. В Данные [ 32 P] -радиоактивности были получено до хемилюминесцентного анализа путем экспонирования нитроцеллюлозы мембрану к устройству Molecular Imager Screen-BI в течение 18 часов.Общий белок в мембрану затем анализировали после обнаружения хемилюминесценции путем инкубации та же нитроцеллюлозная мембрана с конъюгированным с пероксидазой анти-НА антителом с последующей инкубацией субстрата люминола и воздействием молекулярного Тепловизор Screen-CHEMI на 15 мин. (A) Хемилюминесценция (слева панель) и [ 32 P] -радиоактивность (справа панель) сигналы были обнаружены в той же нитроцеллюлозной мембране.Молекулярный Слева указаны стандарты веса. (В) Хемилюминесценция и [ 32 P] -радиоактивность в нитроцеллюлозной мембране (толстая линия, обработанные UTP клетки; тонкая линия, контрольные нестимулированные клетки) и выражается как функция расстояния миграции белка (в мм) от вершины к нижняя часть сканированной мембраны.[ 32 P] -радиоактивность отсчитывается от фосфорилированные белки были нормализованы путем расчета отношения к подсчет хемилюминесценции от общего иммунопреципитированного белка. UTP обработка вызвала повышение фосфорилирования в 3,8 ± 0,2 раза, как по сравнению с контрольными нестимулированными клетками. Показанные результаты являются репрезентативными для три отдельных эксперимента.

Данные [ 32 P] -радиоактивности были нормализовано к общему белку, определенному с помощью хемилюминесцентного анализа та же нитроцеллюлозная мембрана с использованием антитела против НА-пероксидазы и люминола субстрат.Таким образом, соотношение [ 32 P] -радиоактивность рассчитывается до подсчет хемилюминесценции определяли для иммунопреципитированных образцов из Клетки, обработанные UTP, и контрольные нестимулированные клетки (). Увеличение в 3,8 ± 0,2 раза [ 32 P] -содержание (фосфорилирование) было получено для рецептора P2Y 2 после 15 мин раздражения UTP.

Устранение потенциальных сайтов фосфорилирования GRK и PKC ослабляет индуцированная агонистами, но не индуцированная сложным форболовым эфиром десенсибилизация рецептора P2Y2 и фосфорилирование

Исследование первичной структуры рецептора P2Y 2 выявили присутствие остатков серина и треонина в рамках консенсуса GRK / PKC субстратные последовательности (26, 27) во внутриклеточных доменах (28).Мутантный HA-меченный рецептор P2Y 2 был сконструирован путем замены серина-243, треонина-344 и серина-356 на аланин (AAA-P2Y 2 ) для проверки гипотезы о том, что фосфорилирование P2Y 2 рецептор может участвовать в индуцированном агонистом десенсибилизация. Мы трансфицировали кДНК рецептора AAA-P2Y 2 в 1321N1 и проверили способность рецептора передавать сигнал через мобилизация кальция и его десенсибилизация.Рецептор AAA-P2Y 2 индуцировал мобилизацию внутриклеточных запасов кальция со значением EC50 для UTP 0,20 мкМ (log EC50 = -6,7 ± 0,1) (), что равно сравнимо с рецептором P2Y 2 дикого типа (WT-P2Y 2 ). Десенсибилизация Ca 2+ ответ был определен в клетках, экспрессирующих либо дикий тип, либо AAA-P2Y 2 рецепторов.Клетки предварительно обрабатывали в течение 15 мин различными концентрации UTP, как указано в, а затем повторно тестируют с концентрацией UTP, равной соответствующее значение EC50 для каждой клеточной линии, то есть 0,32 мкМ и 0,20 мкМ для рецепторов дикого типа и AAA-P2Y 2 соответственно. Интересно, что значение IC50 для UTP было примерно в 10 раз выше для AAA-P2Y 2 рецептор (IC50 = 79 мкМ, log IC50 = −4.1 ± 0,2), чем для дикого типа рецептора (IC50 = 6,3 мкМ, log IC50 = -5,2 ± 0,2) (и). Более того, когда клетки предварительно обрабатывали в течение 15 мин форболом 12-миристат 13-ацетатом (PMA), известно, что они активируют изоформы PKC и вызывают гетерологичную десенсибилизацию P2Y 2 рецептор (8, 9), мы не обнаружили существенной разницы между значениями IC50 для PMA, определенными в клетках, экспрессирующих AAA-P2Y 2 рецепторов (IC50 = 2.0 мкМ, log IC50 = -5,7 ± 0,3) и экспрессирующие дикий тип P2Y 2 рецепторов (IC50 = 3,2 мкМ, log IC50 = −5,5 ± 0,2) (и).

Опосредованная десенсибилизация рецепторов дикого типа и AAA-P2Y 2 по UTP и PMA

Возможные сайты фосфорилирования серина / треонина для GRK и PKC в рецептора (S243, T344, S356) были мутированы на аланин, чтобы создать Рецептор AAA-P2Y 2 .Клетки 1321N1, экспрессирующие любой из них дикого типа (WT, •) или AAA-P2Y 2 (○) рецепторов были мечен fura2 и инкубируют в течение 15 мин с различными концентрациями либо UTP ( A ), либо форбол 12-миристат 13-ацетат (PMA) ( B ). Ca 2+ мобилизация была определяется после повторной проверки ячеек с помощью EC 50 концентрация UTP каждой трансфицированной клетки (ЕС дикого типа 50 = 0.32 мкМ и мутант AAA-P2Y 2 EC 50 = 0,20 мкМ). Данные выражены в процентах от максимального ответа на 100 мкМ UTP в клетках которые не были предварительно инкубированы с UTP или PMA. Показанные значения являются средними ± SEM трех отдельных экспериментов.

Мы обнаружили, что UTP-индуцированное фосфорилирование AAA-P2Y 2 рецептор был заметно снижен по сравнению с диким типом P2Y 2 рецептор ().Нет увеличения фосфорилирование рецептора было обнаружено при обработке 10 мкМ PMA в течение 15 мин либо в рецепторах дикого типа, либо в рецепторах AAA-P2Y 2 (). Важно отметить, что индуцированные агонистами интернализация была значительно нарушена в рецепторах AAA-P2Y 2 по сравнению с рецепторами P2Y 2 дикого типа (). Взятые вместе, эти результаты подразумевают фосфорилирование потенциальных сайтов фосфорилирования GRK / PKC в индуцированных агонистами десенсибилизация рецептора P2Y 2 .Наши данные также показывают, что ФМА вызывает гетерологичную десенсибилизацию рецептора P2Y 2 независимо от фосфорилирования рецептора.

Опосредованное фосфорилирование рецепторов дикого типа и AAA-P2Y 2 с помощью UTP и PMA

Клетки 1321N1, экспрессирующие рецептор дикого типа или AAA-P2Y 2 , были мечен [ 32 P] -ортофосфат для двоих часов в бессывороточной и бесфосфатной среде.Клетки заражали на 15 мин с 100 мкМ UTP или 10 мкМ форбол 12-миристата 13-ацетат (PMA). Контрольные нестимулированные клетки обрабатывали носителем. Средняя. Экстракты солюбилизированных детергентом клеток иммунопреципитировали с антитела против НА с последующим SDS-PAGE (10%) и вестерн-блоттингом, как описано в Методах. [ 32 P] -радиоактивность количество фосфорилированных белков нормализовали путем расчета соотношения к подсчетам хемилюминесценции от общего иммунопреципитированного белка, как описан в.Результаты среднее ± SEM трех отдельных экспериментов (** p <0,01, достоверно отличается от нестимулированный контроль).

Интернализация дикого типа P2Y 2 и AAA-P2Y 2 рецепторы, трансфицированные в клетках 1321N1

( A ) Клетки 1321N1, экспрессирующие либо HA-тегированный дикий тип, либо AAA-P2Y 2 рецептора лечили с 10 мкМ UTP в течение 30 мин, как описано в экспериментальных процедурах.Лазерный Изображения сканирующей конфокальной микроскопии были получены, как описано в Экспериментальные процедуры. Рецепторы, меченные НА, были обнаружены иммунофлюресценция с окрашиванием Alexa Fluor 488 (показано зеленым) и клеточная поверхность N -ацетилглюкозамин и N остатков -ацетилнейраминовой кислоты в тех же клетках детектируется с помощью агглютинина зародышей пшеницы (WGA), конъюгированного с техасским красным (показано на красный).Показаны изображения слияния. Шкала шкалы в нижнем левом углу = 20 мкм. ( B ) Взвешенный коэффициент колокализации HA-меченных рецепторов P2Y 2 с WGA определяли как описано в экспериментальных процедурах. Интернализация рецепторов (фракция поверхность HA-tagged) определяли в указанные моменты времени после обработки с 10 мкМ UTP. Поверхностные рецепторы, меченные НА, рассчитывали. от отношения значений WCC к WCC в нестимулированных контрольных клетках.Данные представлены средние значения ± SEM для n отдельных ячеек (как указано внутри каждого столбца), определенных на минимум три независимых эксперимента. Клетки, экспрессирующие дикий тип P2Y 2 рецептора сравнивали с клетками, экспрессирующими AAA-P2Y 2 рецепторов (*** р <0,001; нс, p> 0,05 односторонний дисперсионный анализ).

Обсуждение

Терапевтический потенциал нуклеотидов и рецептора P2Y 2 лиганды могут зависеть от нашего понимания процесса десенсибилизации, который модулирует передачу сигналов этим рецептором.Десенсибилизация рецептора, связанного с G-белком (GPCR) может потребоваться активность нескольких протеинкиназ, таких как протеинкиназа. A (PKA), протеинкиназа C (PKC) и G-протеин-связанные рецепторные киназы (GRK) (29, 30). Хотя молекулярная основа десенсибилизации аденилатциклазы b 2 -адренергический рецептор хорошо охарактеризован, известно меньше о регуляторных механизмах, участвующих в десенсибилизации передачи сигналов P2Y 2 рецептор нуклеотидов .Иммунопреципитация меченного НА P2Y 2 рецептор , экспрессируемый в клетках астроцитомы 1321N1, выявил неравномерное распределение рецепторного белка, характерное для мембраны гликопротеины с гетерогенным комплексным гликозилированием (). Скорее всего, это связано с аспарагином. углеводы с высоким содержанием маннозы, а также гибридные и сложные олигосахариды, поскольку иммунопреципитированные рецепторы P2Y 2 оказались чувствительными к гидролиз пептидом N -гликозидаза F (данные не показаны).Похожий гетерогенная картина была обнаружена для b 2 -адренергического рецептора, который имеет молекулярную массу 46,556 и был обнаружен в размере 47–90 кДа. диапазон (31).

UTP-опосредованная активация рецептора P2Y 2 запускает сигнальный путь фосфолипазы C (PLC), ведущий к продукции инозитол-1,4,5-трифосфат, который увеличивает [Ca 2+ ] i и диацилглицерин, который активирует PKC.Значения EC50 для Ca 2+ мобилизация, определенная с помощью HA-меченного P2Y 2 рецептора , трансфицированного клетки (0,32 мкМ;) были аналогично полученным нами (20) для эндогенные рецепторы P2Y 2 в моноцитарных клетках U-937 человека (0,44 мкМ). 15-минутная обработка 100 мкМ UTP произвела быстрое десенсибилизация, показывающая значение IC50 6,3 мкМ (). Мы подтвердили, что лечение десенсибилизированных клетки с ингибитором протеинфосфатазы окадаиновой кислотой (1 мкМ) ингибирует восстановление активности рецепторов из десенсибилизированного состояния за счет ~ 50% (9), что предполагает роль P2Y 2 фосфорилирование рецептора в процессе десенсибилизации ().Эти результаты побудили нас исследовать, вовлечена ли UTP-опосредованная десенсибилизация в увеличение рецепторов фосфорилирование. Действительно, рецептор P2Y 2 фосфорилировался после лечение агонистами, которое вызвало десенсибилизацию и интернализацию рецепторов 40% (и). Эти результаты предполагают связь между рецепторами фосфорилирование и десенсибилизация, вызванная агонистами. Интересно, иммунопреципитация солюбилизированных детергентом общих клеточных экстрактов из UTP-стимулированных клетки давали полосу нефосфорилированного белка ~ 45 кДа.Рецепторы из неплазматических мембраны (например, негликозилированные рецепторы в мембранах эндоплазматического ретикулума) будут недоступны для внеклеточных лигандов и, следовательно, останутся нефосфорилированными после провокации агонистом

Исследования других GPCR показали важность С-конца в регуляция рецептора, опосредованная агонистами, поскольку эта часть рецептора содержит потенциальные сайты фосфорилирования протеинкиназ.Например, усечение С-конец α 1b -адренергического рецептора демонстрирует снижение опосредованная агонистами десенсибилизация, фосфорилирование и секвестрация по сравнению с рецепторы дикого типа (32). C-конец усечения других GPCR, таких как ангиотензин II, нейротензин и паращитовидная железа рецептор гормона, как было замечено, также ингибирует секвестрацию рецептора (33–35). Исследования нашей лаборатории показали, что С-конец рецептора P2Y 2 важен как для опосредованных агонистами десенсибилизация и секвестрация (8).Таким образом, мы сконструировали мутировавший рецептор AAA-P2Y 2 , изменив три потенциальные сайты фосфорилирования GRK и PKC до аланина (S243, T344, S356), расположенные в С-конец хвоста и третья внутриклеточная петля P2Y 2 рецептор. Хотя тройная мутация не повлияла на рецептор способность активировать мобилизацию кальция, это резко снижает степень фосфорилирование рецептора при активации агонистом, а также эффективность агониста к индукции десенсибилизации рецептора.Очень вероятно, что Опосредованная агонистами гомологичная десенсибилизация рецепторов P2Y 2 включает протеинкиназы, отличные от активированных РМА изоформ PKC, такие как GRK; несмотря на то что Не исключены изоформы PKC, нечувствительные к PMA. Фосфорилирование рецепторов может модулировать его сродство к агонисту, его способность связываться с преобразователями сигналов и опосредует его интернализацию, способствуя переносу рецепторов в эндоцитарный пути.Возможно, что PKC-опосредованная гетерологичная десенсибилизация P2Y 2 рецептор включает фосфорилирование сигнальных молекул других чем рецептор гептаелика, такой как фосфолипаза C (36), регулятор передачи сигналов G-белка (RGS) (37, 38), и GRK2 (39, 40).

Благодарности

Финансовая поддержка этой работы была предоставлена ​​Национальными институтами здравоохранения. через гранты S06 GM-08102, P20 RR-15565, P01 AG-018357 и R01 DE-007389, а также Продовольствие Университета Миссури-Колумбия для программы 21 st Century.

Ссылки

1. Hanley PJ, Musset B, Renigunta V, Limberg SH, Dalpke AH, Sus R, Heeg KM, Preisig-Muller R, Daut J. Внеклеточный АТФ вызывает колебания внутриклеточного Ca2 + и мембранный потенциал и способствует транскрипции IL-6 в макрофагах. Proc Natl Acad Sci U S. A. 2004; 101: 9479–9484. [Бесплатная статья PMC] [PubMed] [Google Scholar] 2. Каннан С. Хемотаксис нейтрофилов: потенциальная роль хемокиновых рецепторов в внеклеточные нуклеотиды индуцировали экспрессию Mac-1.Мед-гипотезы. 2003. 61: 577–579. [PubMed] [Google Scholar] 3. Нири Дж. Т., Бейкер Л., Йоргенсен С. Л., Норенберг, Мэриленд. Внеклеточный АТФ вызывает звездчатость и увеличивает глиальный содержание кислого фибриллярного белка и синтез ДНК в первичном астроците культур. Acta Neuropathol (Berl) 1994; 87: 8–13. [PubMed] [Google Scholar] 4. Чорна NE, Сантьяго-Перес Л.И., Эрб Л., Сейе К.И., Нири Дж.Т., Сан Г.Й., Вайсман Г.А., Гонсалес Ф.А. Рецепторы P2Y активируют нейропротекторные механизмы в астроцитах. клетки.J Neurochem. 2004. 91: 119–132. [PubMed] [Google Scholar] 5. Статтс MJ, Chinet TC, Мейсон SJ, Fullton JM, Кларк LL, Boucher RC. Регуляция Cl-каналов в дыхательных путях с нормальным и кистозным фиброзом эпителиальные клетки внеклеточным АТФ. Proc Natl Acad Sci U S. A. 1992; 89: 1621–1625. [Бесплатная статья PMC] [PubMed] [Google Scholar] 6. Нур М., Киамбао А.Б., Петерсон В.М., Аль-Убайди М.Р., Нааш М.И. Агонист рецептора P2Y (2) INS37217 усиливает функциональное восстановление после отслоения, вызванного субретинальной инъекцией, у нормальных мышей и мышей rds.Инвестируйте Ophthalmol Vis Sci. 2003. 44: 4505–4514. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Келлерман DJ. Агонисты рецепторов P2Y (2): новый класс лекарств, нацеленных на улучшенный мукоцилиарный клиренс. Грудь. 2002; 121: 201С – 205С. [PubMed] [Google Scholar] 8. Гаррад Р.К., Отеро М.А., Эрб Л., Тайсс П.М., Кларк Л.Л., Гонсалес Ф.А., Тернер Дж. Т., Вайсман Г.А. Структурная основа десенсибилизации, вызванной агонистами, и секвестрация нуклеотидного рецептора P2Y2. Последствия усечения конец C.J Biol Chem. 1998; 273: 29437–29444. [PubMed] [Google Scholar] 9. Отеро М., Гаррад Р. К., Веласкес Б., Эрнандес-Перес М. Г., Камден Дж. М., Эрб Л., Кларк Л. Л., Тернер Д. Т., Вайсман Г. А., Гонсалес Ф. А.. Механизмы агонист-зависимой и -независимой десенсибилизации рекомбинантного нуклеотидного рецептора P2Y2. Mol Cell Biochem. 2000. 205: 115–123. [PubMed] [Google Scholar] 10. Бувье М., Хаусдорф В.П., Де Блази А., О'Дауд Б.Ф., Кобилка Б.К., Карон М.Г., Лефковиц Р.Дж. Удаление сайтов фосфорилирования из бета 2-адренорецепторов рецептор задерживает начало десенсибилизации, вызванной агонистами.Природа. 1988. 333: 370–373. [PubMed] [Google Scholar] 11. Хаусдорф В.П., Бувье М., О'Дауд Б.Ф., Айронс Г.П., Карон М.Г., Лефковиц Р.Дж. Сайты фосфорилирования на двух доменах бета 2-адренорецепторов. рецепторы участвуют в различных путях десенсибилизации рецепторов. J Biol Chem. 1989; 264: 12657–12665. [PubMed] [Google Scholar] 12. Premont RT, Inglese J, Lefkowitz RJ. Протеинкиназы, фосфорилирующие активированный G-белок рецепторы. Фасеб Дж. 1995; 9: 175–182.[PubMed] [Google Scholar] 13. Гуревич В.В., Палс-Риларсдам Р., Бенович Дж. Л., Хози М. М., Онорато Дж. Дж. Агонист-рецептор-аррестин, альтернативный тройной комплекс с высокое сродство к агонистам. J Biol Chem. 1997; 272: 28849–28852. [PubMed] [Google Scholar] 14. Фергюсон СС, Барак Л.С., Чжан Дж., Карон МГ. Регулирование рецепторов, сопряженных с G-белками: роль сопряженных с G-белками рецепторные киназы и аррестины. Может J Physiol Pharmacol. 1996; 74: 1095–1110. [PubMed] [Google Scholar] 15.Стерн-Марр Р., Бенович Дж. Регулирование рецепторов, связанных с G-белком, рецепторными киназами и аррестины. Vitam Horm. 1995; 51: 193–234. [PubMed] [Google Scholar] 16. Кениг Дж. А., Эдвардсон Дж. М.. Эндоцитоз и рециклинг рецепторов, связанных с G-белком. Trends Pharmacol Sci. 1997. 18: 276–287. [PubMed] [Google Scholar] 17. Цукер К.С., Ранганатан Р. Путь к конкретности. Наука. 1999. 283: 650–651. [PubMed] [Google Scholar] 18. Эрб Л., Лустиг К.Д., Салливан Д.М., Тернер Дж. Т., Вайсман Г.А. Функциональная экспрессия и фотоаффинное маркирование клонированного P2U пуринергический рецептор.Proc Natl Acad Sci U S. A. 1993; 90: 10449–10453. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Пансионер М.Р., Вайсман Г.А., Тернер Д.Т., Уилкинсон Г.Ф. Пуриноцепторы P2, связанные с G-белками: от молекулярной биологии к функциональные ответы. Trends Pharmacol Sci. 1995. 16: 133–139. [PubMed] [Google Scholar] 20. Сантьяго-Перес Л.И., Флорес Р.В., Сантос-Берриос К., Чорна Н.Е., Круг Б., Гаррад Р.К., Эрб Л., Вейсман Г.А., Гонсалес Ф.А. P2Y (2) передача сигналов нуклеотидного рецептора в моноцитарных клетках человека: активация, десенсибилизация и связывание с митоген-активированным белком киназы.J. Cell Physiol. 2001; 187: 196–208. [PubMed] [Google Scholar] 21. Парр К.Э., Салливан Д.М., Парадизо А.М., Лазаровски Е.Р., Берч Л.Х., Олсен Дж. К., Эрб Л., Вайсман Г. А., Бушер Р. К., Тернер Дж. Т.. Клонирование и экспрессия нуклеотидного рецептора P2U человека, a мишень для фармакотерапии муковисцидоза. Proc Natl Acad Sci U S. A. 1994; 91: 3275–3279. [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Нгуен Т., Эрб Л., Вейсман Г. А., Марчезе А., Хенг Х. Х., Гаррад Р. К., Джордж С. Р., Тернер Дж. Т., О'Дауд Б.Ф. Клонирование, экспрессия и хромосомная локализация человека ген рецептора уридиновых нуклеотидов.J Biol Chem. 1995; 270: 30845–30848. [PubMed] [Google Scholar] 23. Grynkiewicz G, Poenie M, Tsien RY. Новое поколение индикаторов Ca2 + с большим улучшенные флуоресцентные свойства. J Biol Chem. 1985; 260: 3440–3450. [PubMed] [Google Scholar] 24. Фридман Нью-Джерси, Лиггетт С.Б., Драхман Д.Е., Пей Дж., Карон М.Г., Лефковиц Р.Дж. Фосфорилирование и десенсибилизация человеческого бета 1-адренорецептор. Участие G-протеин-связанных рецепторных киназ и цАМФ-зависимая протеинкиназа.J Biol Chem. 1995; 270: 17953–17961. [PubMed] [Google Scholar] 25. Холлоуэй А.С., Цянь Х., Пиполо Л., Зиогас Дж., Миура С., Карник С., Саутвелл Б.Р., Лью М.Дж., Томас В.Г. Замены боковых цепей в ангиотензине II выявляют разные требования для передачи сигналов, интернализации и фосфорилирования типа 1A рецепторы ангиотензина. Молекулярная фармакология. 2002; 61: 768–777. [PubMed] [Google Scholar] 26. Зайболд А., Январь Б.Г., Фридман Дж., Хипкин Р.В., Кларк Р.Б. Десенсибилизация бета2-адренорецепторов с мутациями предполагаемые сайты фосфорилирования киназы рецептора, сопряженного с G-белком.J Biol Chem. 1998. 273: 7637–7642. [PubMed] [Google Scholar] 28. Вайсман Г.А., Гонсалес Ф.А., Эрб Л., Гаррад Р.С., Тернер Дж. Т.. Клонирование и экспрессия связанного с G-белком нуклеотида P2Y рецепторы. В: Fedan JS, редактор. Рецепторы нуклеотидов P2. Humana Press: Тотова, Нью-Джерси; 1998. С. 63–79. [Google Scholar] 29. Тернер Дж. Т., Вайсман Г. А., Федан Дж. С.. 1998. Рецепторы нуклеотидов P2. [Google Scholar] 30. Lefkowitz RJ. Рецепторы, сопряженные с G-белками. III Новые роли рецепторных киназ и бета-аррестины в передаче сигналов рецепторами и десенсибилизации.J Biol Chem. 1998; 273: 18677–18680. [PubMed] [Google Scholar] 31. фон Застров М, Кобылка Б.К. Регулируемая лигандом интернализация и рециклинг человеческого бета 2-адренорецепторы между плазматической мембраной и эндосомами, содержащими рецепторы трансферрина. J Biol Chem. 1992; 267: 3530–3538. [PubMed] [Google Scholar] 32. Lattion AL, Diviani D, Cotecchia S. Усечение карбоксильного конца рецептора нарушает агонист-зависимое фосфорилирование и десенсибилизация альфа 1B-адренорецептор.J Biol Chem. 1994; 269: 22887–22893. [PubMed] [Google Scholar] 33. Хуанг З., Чен Ю., Ниссенсон Р.А. Цитоплазматический хвост рецептора, сопряженного с G-белком, для паратироидный гормон и белок, связанный с паратироидным гормоном, содержат положительные и отрицательные сигналы на эндоцитоз. J Biol Chem. 1995; 270: 151–156. [PubMed] [Google Scholar] 34. Томас WG, Теккумкара TJ, Мотель TJ, Бейкер К.М. Стабильная экспрессия усеченного рецептора AT1A в клетках CHO-K1. Карбоксиконцевая область направляет индуцированную агонистами интернализацию, но не сигнализация рецептора или десенсибилизация.J Biol Chem. 1995; 270: 207–213. [PubMed] [Google Scholar] 35. Chabry J, Botto JM, Nouel D, Beaudet A, Vincent JP, Mazella J. Остатки Thr-422 и Tyr-424 на карбоксильном конце представляют собой критически важен для интернализации рецептора нейротензина крысы. J Biol Chem. 1995; 270: 2439–2442. [PubMed] [Google Scholar] 36. Литош И. Новые механизмы регуляции фосфолипазы С-бета с обратной связью деятельность. IUBMB Life. 2002; 54: 253–260. [PubMed] [Google Scholar] 37.Sato M, Moroi K, Nishiyama M, Zhou J, Usui H, Kasuya Y, Fukuda M, Kohara Y, Komuro I., Kimura S. Характеристика нового белка RGS C. elegans с C2 домен: свидетельство прямой связи между доменом C2 и Galphaq субъединица. Life Sci. 2003. 73: 917–932. [PubMed] [Google Scholar] 38. Каннингем М.Л., Уолдо Г.Л., Холлингер С., Хеплер Дж. Р., Харден Т.К. Протеинкиназа C фосфорилирует RGS2 и модулирует его способность для отрицательной регуляции передачи сигналов Galpha 11.J Biol Chem. 2001; 276: 5438–5444. [PubMed] [Google Scholar] 39. Krasel C, Dammeier S, Winstel R, Brockmann J, Mischak H, Lohse MJ. Фосфорилирование GRK2 протеинкиназой С устраняет его ингибирование кальмодулином. J Biol Chem. 2001; 276: 1911–1915. [PubMed] [Google Scholar] 40. Lorenz K, Lohse MJ, Quitterer U. Протеинкиназа C переключает ингибитор киназы Raf с Raf-1 на ГРК-2. Природа. 2003. 426: 574–579. [PubMed] [Google Scholar]

причин и ликування Дитин хрипов и кашля.

В молодости дети часто переживают циклы простуды, заболевая с типичными симптомами, такими как кашель и нежить. Во всей иммунной системе иммунная система развивается за счет механизмов борьбы с патогенами. Неважный для тех, кто может кашлять маленького ребенка в довольно нестабильной ситуации, хриплый кашель ребенка виновен в том, что он ожесточает папиновое уважение.

Изменение тембра голоса, внешний шум в течение часа для дыхания, зрение с большой частью эмоциональной реакции на проблемы вирусной или бактериальной этологии в области дыхательных путей, чтобы вызвать недуги вообще без температуры.

Уменьшив охриплость и хрипы диханной, необходимо показать малыша педиатру или детскому отоларингологу. Врач прослушивает грудину, чтобы определить локализацию шума, замшелый процесс воспламенения. Скопление мокроты в дыхательных путях не является постоянной угрозой для ребенка, поэтому нужно быстро отреагировать.

Якщо ребенок раптом в процессе їжі, пиття или ігор кашляет, кашляет, стесняется всего, побеждает удушье от шмоточки іжі, рідиною.Возможно, предмет застрял в горле, не давая вам дихати. Сразу учтите то, что малыш видит себя. Якшо вин блидне, синий, неудобный, срок, окажите ему дополнительную помощь. Звон старых дворян может сразу помочь вам кашлять, начать тихо.

Я не прав, если малыш задыхается, успевай с обидными чертами, которыми я стану, зловоние может богато рассказать лыкарев про джерело нездужання:

  1. Термин есть симптом.Гострестан недуг не более двадцати одного дня, кашель более двух месяцев говорит о хронической форме недуга.
  2. Закончите час, кашляя на яка.
  3. Катализаторы от кашля: больше проявляется до часа приема, в России, в новых условиях, в примитивности, при употреблении алкоголя и т. Д.
  4. Чи ангина или грудина в течение часа кашель, удушье, недуги чи, изменение Ци на голос, отек Ци в голове.
  5. Причина недомогания мокрота или непродуктивный кашель, пульсация в горле.

Небезопасный кашель

Обовьязково викликайте лыкар, обсожьте ребенка, как они контролируют интенсивное хриплое хрипение, малышка подкрадывается, у вас хорошо получается, ясно, что ил течет.

Когда голос грубый, кашель ночью грубый, в мокроте видна кровь, зрение зеленое, кашель наступает сразу при простуде, не кашляет более 21 дня. Банальность может проявиться дополнительно экстравагантной слабостью, гипертермией, второй свидомостью.

Причины хриплого голоса

В случае заражения вирусом или бактериальной инфекцией он может развиться в области гортани. Ларингит должен развиваться по сухости, хрипу в горле, ларингиту и некоторой гипертермии. Больной может меняться, иметь голос и говорить до несчастья.

Непостоянное наследие ларингита - стеноз гортани, отсюда название тяжелый круп. Стенки ветровых ходов набухают, набухают, при кашле набухают лающие характеристики.Атакующий огонь ночью. Лагерь Дании несет прямую угрозу жизни больного. Vono vimagaє не специальная медицинская помощь.

Устрелян может порвать трахею до свистка. Трахеит здания может быть вызван переохлаждением или заражением бактериями. Когда появляются недуги при кашле, приступы не проходят. Тим небезопасен, что патология может распространиться на область бронхов и легенд.

Якшо девочка заболела кашлем, мучила еще приступ резкого, кашляла на хриплый хрип, вплоть до голубоватых положительных.При вдыхании недугов глибоко шумит от влаги. Вы можете присутствовать без видения. Человек и запястья ребенка будут переполнены. Ликвидация жесткости обовьязков в лекциях для визуального образа наглядно.

Майже все респираторные инфекции контролирует хриплый подих, хриплый кашель. Нужно постараться донести до крихти, так как важно не кричать, не кричать громким голосом. Насадки становятся провокатором кашлевого рефлекса. Вязки отрываются от горла, провоцируя их откашливать.В первую очередь, если избавиться от нежити, то это может привести к кашлю. ЛОР Вы можете осмотреть носовую походку, указать правильное лечение.

дополнительная обстановка

Перед перечнем обстоятельств, как спровоцировать снижение тембра голоса, хриплый характер, кашель, рядом с началом:

  • Новое лечение или новообразования в области гортани (киста, пухлина, полип).
  • Покупка сказок в легендах, туберкулез.
  • Точечное или множественное увеличение диаметра аорты в области грудины.
  • Потенциальная эффективность обусловлена ​​приемом лекарств через отвисание слизистой горла (чаще всего блокаторы гистамина).
  • Патологическое разрастание аденоидной вегетации;
  • Банально навантаження на звук гортани (если человек много спит, размовляв, кричит). При этом температура не двигается, загальный стан тяжелый, кашель не сильный.
  • Якщо малюк протыкает горло в щос, или отсекав травму гортани таким же рангом, можно довести до грани.Термыново злая бригада швидкой помощи;
  • Аллергический приступ не безопасен для выдавливания путем назначения дичного дворянина, необходимо использовать блокатор гистамина, госпитализировать ребенка.

Висячий кашель нада надмирне вантагення на все организмы и мышцы. Это также небезопасно для перехода инфекции в более низкую психику. Важно увидеть, насколько появилось больше тревожных симптомов. Диагностическое обследование, прослушивание грудины может быть дополнено экстравагантными анализами, рентгенологическими данными и ранее существовавшим зрением (при необходимости).

особенность не важна

Немовлята не может воспитывать развитие организмов. По морфологическим особенностям гортани характерны звуки волчка, если ребенок плачет или кричит. Назовите ребенка разрастанием ци нездужання. На проблемы с голосом и поведением у грудничков не влияет хроническая патология горла.

помидоров diy

Типичные школьные рекомендации Это не для больных детей горячими питтами с медом или цитрусовыми при любых признаках простуды.Подведем итоги наследования многих аллергических атак или нападений на увечья. Пейте и пейте, когда виноваты, но согрейтесь, не дразните.

Перед тем, как перейти в некоммерческий, можно добавить:

  • Використання для приема внутрь травяных настоев или эфирных масел без ароматизаторов, но малук не реагирует на аллергию и бронхоспазм.
  • Низкие температуры, горячие компрессы.
  • Обработка слизистых оболочек грудных детей антисептиками, так как они не проникают в железы, даже не вносят користоз в кровоток, могут страдать аллергией.
  • Ангина сломана. Младенцы могут вдохнуть и подавиться.
  • Застой антибиотиков без точно установленного диагноза. В случае вирусных инфекций датчан класса марний можно создать организм шкоди.

Не позволяйте себе баловаться, обращайтесь к фачивцам, позаботьтесь о своих детях.

Терапия от охриплости и кашля

Болеем онемением, надо чаще груди протирать, искусственным людям - тепло и нейтрально.Уточните малыша турбо, низкий, берегите его нервы, голоса, не давайте крика.

Ликар распознает адекватную терапию по распространенности заболеваний, причинам, другим факторам. В случае бактериальной природы заболеть антибиотиком, мне нужно будет это сделать, так как я буду строго следовать этому правилу. В список могут входить антиапальные препараты, бронходилататоры, иммуномодулирующие, иммуностимулирующие препараты.

В случае простуды кашель будет эффективным испарением.Ингалятор найкраще використовувати с диспергированным распилення. Я установил стабильное выпрямление неспеченных микрочастиц лекарства и точек лекарства. Благоприятный эффект заключается в расширении доступа к нижним психическим органам и органам, носовым пазухам. Едкость нароста.

Зиве толстый секрет нужен, чтобы ограбить большой. Возможно получение готовых аптечных муколитических препаратов, а также наличие пикантных лепешек из виглядских чаев с малиновым вареньем, медом, молоком с консервированной минеральной водой.Пиття виноват в том, что бывает часто, согревает, не тянет за горло.

Виключит все гостеприимство, кисло-соленое блюдо из детского меню. Bilioni, блюда с низкой консистенцией выглядят коричневыми. Обязательно используйте любые доступные методы, почаще протирайте пилы, чистите пидлоги, проверяйте жилки.

Мгновенно отреагируйте на потерю самооценки и невольно проявите себя в поведении вашего малыша. Я помогу тебе стать здоровым и активным ребенком.

Кашель часто является первым симптомом простуды, buvaє siplim, сухой, vologim, inodi maє sudomny характер ... При хриплом кашле голос может пропасть, а верхние члены могут выступить, затрудняя дисфункции, а иногда и даже усугубляя асфиксию.

Иногда кашель с хриплым голосом и хриплым голосом начинает закрадываться в организм парней, через что папа часто не проявляет никакого уважения к проблеме. Тем не менее, если у детей раннего возраста не проявляются некоторые из проявлений, то в дело вовлекаются причины, часто даже более серьезные, и ситуация.

Самый распространенный настой от кашля при инфекционных заболеваниях верхних и нижних вторичных путей ... Вы можете заболеть следующими симптомами: синусит, пневмония, бронхит, лихорадка и т. Д. Дитин может кашлять при аспирации инородного тела или грязно-грязевой рефлюкс.

Хронический кашель может спровоцировать даже простуду, часто переходящую в запущенную форму. Симптомы хриплого кашля могут усиливаться во время лечения бронхиальной астмы, на нижних стадиях пневмонии и при туберкулезе.

люка

Бе-яке заболел свободным запутыванием vimagaє.Почему ликувати кашель у детей? Когда у ребенка появляется хриплый кашель, это может быть не просто голос, а хрип в слизистой оболочке, как здание, которое подавляет надежду легенды. В конце концов, основной причиной обвинений было обращение к благородству и возобновление нормального поведения.

С этим я буду виводити ребенка красивее в сознании стационарного, тогда я буду живодити небажані наследством. Позвольте хорошему голосу и благородству говорить, не заболевая. Присутствие Иакшо хриплый

  • слизистые оболочки развиваются;
  • полишуется введением слизи и мокроты;
  • при победном лыкарском компоненте терапия становится болезненной;
  • изменится переход недуга в хроническую форму.

Особенно коричневые насадки небулайзера. К тому, что препарат наносится на порошок, чтобы получилась прекрасная пила, часто это увеличение пристрастия, такие процедуры показаны при тошноте, в том числе при хрипящем кашле.

Прототипные процедуры могут быть важными факторами:

  • Индивидуальная непереносимость пения песен;
  • нежелание адаптировать необходимый ритм поведения;
  • сердце-легенева нехватка;
  • щильність до коллапса мозгового кровообращения;
  • перенесен на микроинсульт;
  • гипертоническая болезнь 2-3 ступени.

компресс

Народная медицина обладает своей большой универсальностью в составе компрессоров и реестров.Застосовывать их реже с каждым разом, когда у ребенка повышается температура.

  • Капуста с медом. Лист свежей капусты покрыт медом и хоть как-то пристосоватся к груди ребенка. Дитина тепло укутывается.
  • Отец. Повышение и понижение до комнатной температуры. Viclade на марле, для кого лежать на груди больного. Банальность процедуры - 40-50 калорий.
  • Цибуля. Цибулина заперта в духе, для чего вырастить и поменять розовым или камфорным маслом, медом, сухой герчицей и борошным. Маса длится две одинаковые по размеру торта, который наносится на спину и грудь. Возьмите лечение всего 2 года.

профилактика

Не мучайте ребенка, мы часто банальные и часто неуместные люди должны периодически проводить профилактику простудных заболеваний.

  1. Убедитесь, что у вас есть еда. Малюк виноват в большем количестве фруктов, овощей и ягод корицы, богатых витаминами и минералами. Яблуко, или апельсин будет на краю корисніше, ніж зукерки.
  2. Занимайтесь спортом и диаграммами. Дело не только в этом, но и в иммунитете. Маленьким нужно больше тренировок и больше прогулок на свежей еде. Ребенка постарше можно записать в спортивную секцию.
  3. Виключити переохлажден. Как только переохлаждение станет, сделаем для девочки горячую ванну с горячей водой.

Это простая профилактика, которая поможет улучшить здоровье ребенка и избежать проявления недугов.

Все папы будут намагают спасти своего ребенка от недуга. Однако, чтобы показать вам практику, вы совсем не ожидаете, что поедете. Почему робити, например, как у ребенка нормальная температура, кашляет ли, хриплый голос? Почекати в надежде - "сам пройдешь" или все-таки на прием пойдем к ликару? Наша статья может помочь вам узнать результаты по ценам на продукты питания.

Что у ребенка осип и кашель: все причины хриплого голоса у детей в таблице

Звук детского голоса часто означает, что процессы воспламенения видны в гортани, и их невозможно донести до самой наследственной наследственности. Хриплый голос - симптом ларингита и трахеита, но не только. Давайте разберемся подробнее, из-за чего у ребенка может быть хриплый голос.

Причина охриплости у ребенка симптомы
Травма гортани У детей слизь гортани вырастает у взрослых из-за большого числа смертей от крови.При травмах кровоснабжение судинов может резко возрасти, что может привести к звуку голосовой щели.

Звук голосов - основная причина охриплости у ребенка. Легкая травма гортани может привести к изменению тембра голоса. Например, хтоз ударил ребенка в шиитском стиле. В этом разделе мы не будем говорить о серьезных проникающих повреждениях гортани. Такие, как райзан, колоть, культивирование и т. Д. Итак, в результате уважение моего отца похищает детей, получивших такие травмы.В любом случае при травме гортани необходимо лучше показать ребенка.

Посторонний предмет в гортани У детей есть табличка шкидлива - «все тяни в рот». Неридко, ненавистно проковтнув, застрял в гортани. Есть большие куски мяса, небольшие мешочки, травы, абрикосовые кисти и сливы. Еще чаще сторонней темой являются кисты рибьячи, которые застревают в слизистой гортани.

Классная картинка, когда инопланетное тело попадает в гортань, это похоже на оскорбительный ранг: у ребенка срывается диханна, появляется хриплый голос, а это для него важно. В важных случаях малышу приходится фиксировать дыхание, синюшность, артериальный хват уменьшатся и может произойти потеря свидомости.

В случае с детьми, ребенок застенчиво «видкашлю», выпив предмет в гортани. Для всех детей необходимо иметь термин «Помогу швидку», так как у ребенка гортань.

Трива розмова, крик, спів, пошепки на триву розмова Следуйте за ребенком, не давайте вам плакат на банальный час. Не позволяйте детям постарше кричать и спать голосом «Лепса», потому что зловоние просто «заглушит» голоса и звуки будут звучать. Помните, что у детей в гортани чувствительная слизь, легко пораниться.

Теплота питты и ангаляции помогают улучшить лагерь. Однако консультации лор-врача найти невозможно.

трахеит Трахеит - выделение слизи трахеи. Как правило, трахеит є сопутствующее заболевание при вирусных и бактериальных инфекциях. Трахеиты подразделяются на гостиные и хронические. Основные симптомы трахеита:

- Жесткий приступообразный кашель.

- Грубый кашель без мокроты.

- Пика за грудиной.

- Головной счет.

- Свистящая дихання.

Прискорбное лечение трахеита может быть доведено до хронической формы, как банальная порода.

ларингит На момент болезни, как правило, страдают дети до 3-х лет и привязаны к особенностям бюджета и слизи шарика. Они тоже об этом писали. При ларингите пух слизистый, отечна гортань, меняется голос гортани.

Причины определения:

- вирусы;

- аллергенный;

- патология;

- психомоторный шок;

- Неправильно засосування спрея.

При ларингите матус скаржится на хрипы в груди ... Дысно, хрипит. Багато лыкарив называют симптом «гра аккордеон». При этом свистящее дыхание любого отношения к легкому ребенку не дает обморока. Легко чистить. У ребенка хриплый голос, частый лающий кашель.Сложность дихання чаще всего встречается на четвертом курсе ранга. Я называю час «критическим».

Дитина нервничает , повышается температура. В течение последних суток дихання всплывает, не очень эффективно.

озноб Озноб - это огненная болезнь, спровоцированная инфекцией. Процесс обжига переходит в гортань и пористую структуру. Есть бугорок, который должен довести тембр голоса до разрушения. Повышение температуры, нежить, кашель, головная боль, слабость.

Голос ребенка имеет голос: что ты делаешь и что делаешь?

Как вы можете помочь мне с методами лечения, почему ребенок осип? Тильки лыкар-педиатр или ЛОР может устранить причину, промыв воду из шланга и назначив правильное и своевременное лечение. Ниякого баловства в этой выпадке но не виноват.

Как, робити, как насчет того, чтобы ребенок заглушил голос?

  1. Якщо детский голос, надо убедитесь, что нет ... Попробуй так сделать, чтобы якомог малыша меньше росмовляв. Говорить можно только в позах, короткими фразами.
  2. Детей старшего возраста можно распознать ингаляций с маслом эвкалипта или маслом календулы (проводить процедуру только после консультации с врачом).
  3. ЛОР-ликарі рекомендую на весь период дотримуватся легких детей ... С делением ребенка сдал в общем порядке viclyuchiti solonu и gostru uzhu . Я не могу дать ребенку ни холод, ни тепло, ни холод, ни пить ... Пей и будь виноватым, но согрейся. Детям рекомендуется давать куриный бульон.

Народные рецепты ликування осипнув

  1. Приложите к ребенку холодный компресс. Для всего необходимо сделать картоплюм, снять его, положить в пакет и обернуть полотенцем. Заменить картоплин можно с помощью питания. Компрессор виноват в том, что он теплый, а не горячий.
  2. Если у ребенка в горле, то можно одну чайную ложку морской соли полоскать в стакане теплой воды, а затем полоскать горло трижды в день.
  3. В детской комнате за ней необходимо ухаживать, регулярно ходить к врачу для уборки.

У ребенка травма гортани: как робити?

В случае отказа от травмы гортани необходимо прекратить срок до фахивця Так как охриплость можно лишить первого признака початка.А в случае с оборудованием без специального щупа для дихання не обойтись.

Дитина осип через сторонний предмет попадает в гортань: перша допога

  • Так как ребенок маленький, необходимо положить его на спину и плескать по спине лопатками.
  • Переверните ребенка и положите его спиной на ровную поверхность. Килка развита, чтобы сильно тянуться и указывать на давление на грудь.
  • Сожмите пальцем корень языка ребенка и потяните за нижнюю прорезь.Если вы видите посторонний предмет - вам нужно постараться быть витягнути.

Все процедуры занимают один час с помощью вики "Помощь Швидкого". В эту випадку - дорога шкура вторая.

ликування трахеита

  • При вирусной этиологии застаиваются такие антивирусные препараты: Интерферон, Арбидол, Кагоцел и др.
  • При бактериальной инфекции, как правило, распознаются антибиотики.
  • При сухом кашле наиболее распространены застойные явления: Либексин, Стоптузин, сироп солодки и др.

ликуванный ларингит

  • В першу чергу надо найти причину диагноза ларингит ... В первую очередь посмотрите на основное заболевание.
  • При ларингите 1 ступень , Як обычно допускают небулайзеры ... Для ингляций есть проблема: негазированная минеральная вода, эуфилин или преднизолон.
  • В любом случае при ларингите можно давать ребенку молоко с медом. Чтобы добавить аллергенные продукты, можно получить горячие точки. Не рекомендуется хранить видвари для приема внутрь перед складом, на котором есть декаль с видами трав.
  • Ликування ларингита 2, 3 и 4 стадии проводится еженедельно в стационаре. Курс лечения должен носить индивидуальный характер, необходимо установить наличие недугов в анамнезе.

Народные методы лечения ларингита, как правило, по собственным рецептам, в состав которых входят молоко или мед и прием внутрь с различными травами.Для того, чтобы прикоснуться к удовольствиям ликаров, они не перестанут им подавлять. Дождемся поводка с одним народным рецептом - , если недуги прошли, можно полежать в более теплом (не горячем) питво.

Ребенок простужен и болеет: как лечить?

  • Течение простуды поможет вам заболеть из анамнеза.
  • Еще чаще рекомендую физиотерапевтические процедуры: электрофорез гортани, УВЧ.Обовьязково рясне теплое питво.

В народные рецепты входят: компрессы на область грудных тканей и ший, ангаляції над парами картопла, мяты перечной.

Немовля осип: перша допога

Уже в первый месяц жизни голос немого можно окропить. В целом симптом небезопасен, возможно, но есть сигнал о заражении. Сам факт, что пока ваш ребенок - осип, неточно накрутил ликар.Самоликування в эту выпадку входит. Однако я помогу маленькому папочке обвинить.

Перша хриплым голосом не поможет:

  • успокойте ребенка;
  • проверьте свою температуру;
  • визуально пересмотреть верхнюю дихотомию для третьих лиц;
  • до прихода лыкар, дайте малышам только тёплую воду;
  • Забудьте о всплеске свежих продуктов в сообществе.

Отже, пока твой маленький осип, терминово злой лыкар.Только после завершения диагностики и осмотра медицинского изделия можно поставить правильный диагноз и указать на необходимость коррекции.

При ознобе, недомогании органов у детей часто бывает охриплость, то есть какая у ребенка охриплость, что актуально для багатохских отцов. Удивляйтесь любым необычным симптомам, чтобы помочь людям и людям, пожалуйста, пожалуйста, д-р Комаровский.

При простуде малыши часто теряют голос

Причина охриплости у ребенка

Охриплость ребенка не доходит до банальных исходов голосов, ребенку не хочется плакать или плакать.Как признак холода, необходимо понять и заподозрить причину сырости новорожденного, через несколько дней неуместных симптомов, чтобы узнать самостоятельно.

  • Инфекционные процессы в гортани и ортоглотке - ангина, трахеит;
  • появление папилом и новообразований в гортани;
  • травмы, нанесенные шиитами;
  • пошкоження слизистая фирма;
  • лихорадка;
  • как только пропал голос при недомоганиях, тогда могут быть некоторые признаки бактериальной инфекции;
  • віковые изменения голоса в пубертатном периоде - в 13-14 лет у ребят подавляющее гормональное состояние организма, так как они расширяются по голосам.

При простуде и инфекционных патологиях, если голос хриплый, появляется нежить, сухой кашель, пот, дисплазия и покраснение горла, повышение температуры и потливости, увеличение количества недомоганий у женщин, Ликування и тому подобное. патологии можно проводить в домашних условиях, терапия направлена ​​на уменьшение неприемлемых симптомов и восстановление иммунитета.

Хриплый голос - фактор небезопасности

Иногда охриплость опротестовывается без повышения температуры, кашель немой, даже такая ситуация небезопасна для жизни ребенка, необходимо некорректно выкликати швидку помочь.

Небезопасные факторы охриплости:

  • набряк Квинке - разновидность аллергической реакции, затрудняющей отек тканей и гортани, вызывающая у детей нормальное дыхати, патология наблюдения с явным отеком, висипа, свербиння, заложенность носа;
  • стеноз гортани - развиться на почве травм стравохода посторонними предметами, аллергии, скарлатине, опике, на стадии початков, дихотомия не усложняется, дела становятся еще тупее, есть тупость, когда увлекаешься воздухом, взрослеешь;
  • незнакомцы тихо ходят по причудливым тропинкам - проблема часто в том, чтобы топтаться среди маленьких детей, так как они тянут в компанию другие предметы, ребенок быстро начинает ползать, шкирный поворот, отекать синюшный вид, кашлять как злоумышленник;
  • злаки - наследование дифтерии, коры, некоторых форм ангины, чаще всего у детей от 2-5 лет.

При стенозе гортани наблюдается охриплость и затруднение в дисфункции

При подозрении на наличие бокового тела в дыхательных шляхах необходимо не слишком сильно перевернуть ребенка вверх ногами, а затем уложить ребенка на слева от властного, ноги сжать, на спину плеснуть. Ребенка постарше можно отогнать руками, положить кулак на верхнюю часть живота, положить палец на другую руку, здесь же ерш можно придавить снизу вверх в гору.

Чим ликувати охриплость у ребенка

Правильная терапия также помогает при быстрой реакции на охриплость, для улучшения голоса, что необходимо в комплексе заместительных препаратов и нетрадиционной медицины. Додатковые мысли для умной женщины - новый голос, говорящий, часто прибирающийся, время от времени отключающий горячие и холодные травы и напитки, пейте больше теплого молока с овсяными хлопьями, минеральной воды без газа, морепродуктов.

liks

При ликуванной охриплости використовуют различные препараты в виде таблеток, спреев, розчинив.Препараты Вибир лежат в основе того, что они явились причиной развития патологии.

  • растворы антисептические для полоскания - Хлорофилипт, Мірамістин;
  • спрей для горла знеболувальный, противопожарный, помьякшувальную дию - Ингалипт, Тантум Верде, Каметон;
  • таблетки для антимикробного и антимикробного обезвоживания - Лизобакт, Фарингосепт, Стрепсилс;
  • отсос для коррекции горла - Люголь;
  • Лики вид от кашля - АСС, Гербион;
  • антигистаминные препараты для уменьшения отеков - Фенистил, Супрастин;
  • ингаляция небулайзера с Пульмикорт, амброксол;
  • витаминные комплексы - Азбука, Супрадин.

Хлорофиллипт - полоскание горла

Провести симптоматическое лечение антислойными, антибактериальными препаратами, при повышенной температуре 38 градусов до приема жаропонижающих средств - Панадола, Ибупрофена.

Лечение термических, механических, химических ряж по горлу проводить только в неподвижных умах.

Народные способы лечения

Приобретите нетрадиционную медицину, которая поможет вам прикоснуться к начинке, процессам воспламенения, зловонию иммунитета, выпить мерцающий ил.

Як знать охриплость - простые рецепты:

  1. В 230 мл теплого молока добавьте 10 г версового масла и 5 мл меда - таким напитком я помогу вам высушить слизистую оболочку.
  2. Полоскать горло можно из 240 мл воды и 15 мл меда, проводить процедуру 2-3 раза в день.
  3. Eggnog - пикантный и коринсодержащий ликер, хорошее дополнительное средство при горле. Взбить 2 жевания, добавить 450 мл молока, 50 мл меда и 30 мл свежего апельсинового сока.К сумме трех программ на паровой бане добавляем 2 битых кирпича.
  4. Чорну редька вимити, см. Верхушку, виконати маленькую дырочку, залейте ее медом, залейте на 5-6 лет. Давайте детям по 2 ч.л. сока 3-5 раз в день. Liki может помочь вам при сухом кашле.
  5. Для полоскания можно добавить настой ромашки, календулы, листьев эвкалипта, шавли - 20 г тонкой сирени, заварить 350 мл обсыпки, перелить в герметичную емкость по 20-30 киллинн, обработать. Процедуру нужно проводить через год после приема напитка, с растяжкой на 30 минут, для полоскания можно пить и пить.
  6. При проглатывании пара принимать эфирные масла ялица, ментола, эвкалипта, чайного дерева. Дихати в паре требует 5-10 чилинов, в парах в детстве.

Для лечения детей более интенсивно вырабатывается мед акации, вяжется гипоаллергенен.

Редис чорна с медом поможет избавиться от хрипоты голоса

Если голос ребенка хриплый, доктор Не переходите сразу на комбинацию препаратов против зубного камня, а антибиотиков, потому что они сильные, виновен в том, что он выписывает только препараты для осмотра и диагностики.

Чаще всего охриплость голоса является признаком поражения простудой, ларингитом, гриппом, если у ребенка сухой кашель. Рекомендации по таким видам стандартные - рясне пиття, постельный режим, более здоровое и прохладное питье в комнате, полоскание ромашкой или содой, ингаляция, а также немая температура.

Эль, для ребенка при охриплости, ребенку трудно ощущать гучни с затрудненным дыханием, грубый лающий кашель, затем появляются характерные признаки грубой или натертой каши.Такой лагерь часто развивается на тли ГРВИ, коры, вітрянки, скарлатины, а также на вимаге тайной лыкарской вспомогательной помощи. Перед приходом ликара малышке будет теплее, мы выпьем, попьем теплой палочками или компотом из сухофруктов. Наиболее безопасен в конкретной ситуации - сухой корм и жмых в примитивности, самоуничтожение.

профилактика

  • не думайте никаких записок против дифтерии - охриплость воспринимается по первым признакам какого-то неудобного недуга;
  • груди vigodovuvannya дополнительно формируют иммунную систему ребенка;
  • правильные и сбалансированные расы с большим количеством овощей, фруктов, круп, микс продуктов с высоким содержанием углеводов;
  • дети виноваты в большом коллапсе, проводят больше часа в новый день;
  • не забывайте о загартовування;
  • учитывает оптимальную температуру и полезность напитка в окружающей среде;
  • стресс, недосыпание, подавляющий иммунитет.

Пусть малыш от дифтерии разлетится

Хороший способ профилактики, снижение мышечного иммунитета - морозный, если ребенок употребляет продукт регулярно небольшими порциями, то это будет означать, что простуды, першение в горле увеличатся. .

Хриплый голос у ребенка может быть знаком вирусным патологическим бактериальным инфекциям, часто несоответствующие симптомы являются наследием неправильного температурного режима у ребенка. Если у малыша хрипы немного, есть сильные хрипы, есть проблемы с поведением, значит, есть признак серьезных недугов, небезопасных для жизни - нужна помощь терминовой лыкарской.

Хриплый кашель у ребенка без температуры - рефлекторная реакция организма на внешние и внутренние раздражители респираторных рецепторов. В качестве таковых можно рассматривать, как патогенные микроорганизмы, так и посторонние предметы, которые были любезно поглощены головокружительным образом в течение часа или около того. В некоторых случаях хриплый кашель без признаков лихорадки может быть симптомом ряда больных. То есть когда у ребенка до часа спазма бронхов слышен посторонний звук, то неточно обращается к педиатру для передачи детских легенд.

Хриплый кашель, повязки с хрипом, слышен из груди, в большом количестве случаев тяжелые функциональные патологии со стороны бронхогенной системы. В первую очередь страдают бронхи, как главный орган, который позволит ребенку проходить через открытое пространство и стабильно осуществлять энергетический акт.

Причиной может ощущаться обвинение в хрипах на вдохе и видихе, а также хриплый кашель при наличии у ребенка таких недугов:

Кожный причинный фактор, чрезмерное страхование в указанном списке является потенциальной угрозой для нормального развития ребенка и продолжения жизни.

В частности, это причина хрипов при сильном и хриплом кашле, когда он вирусный, инфекционный. Этот вид патологии небезопасен тем, что возбуждается возбудившая великая провокация бактерия великого vognisch, разрушая ткань ребенка, как в прошлом притворяясь волокнистой, несмертельная viconuvati числа функции бронхиальной системы. В результате ребенок заболевает и до тех пор, пока не подрастет, часто заболевает простудными заболеваниями.

Чим ликувати, якшо дитина хрипы и кашель

Перед командой, как исправить такие симптомы, как хрипота в течение часа и хриплый кашель, необходимо установить характер хождения больного человека, я стану легендой. Для данного типа кожи недугу предоставляется собственный терапевтический протокол, выпрямляющий внешний вид болезни ребенка и устраняющий симптомы недуга. Порядок сообщения и способ устранения хрипов и кашля из-за перепадов температуры можно легко различить, либо он появляется без нарушения теплообмена.

без температуры

Когда ребенок находится вне поля зрения, появляется признак спекуляции, хрипы и бронхиальный спазм; Аптечные препараты Яка могут применяться как використические лекарственные препараты, сиропы из яка Гербион, Алтей, Корин солодка, Лазолван. Уже зарекомендовали себя Бромгексин, Азитромицин, Гентомицин, Бромхикум, Мукалтин.

Если у ребенка диагностирован аллергический кашель, так как имеются все признаки развития бронхиальной астмы в початковой стадии, рекомендуется принимать Спазмолгон, Но-шпу, Дротоверина гидрохлорид, Эуфилин.Для профилактики малуковой аллергии нужно регулярно пить Эдем, Цетрин, Алерон, Супрастин, Кетотифен, Супрастинол, таблетки L-цет. Это позволяет адаптировать иммунную систему к организму и снизить концентрацию аллергенов в крови.

3 температура

Повышение температуры с одночасовым проявлением хрипов в груди и слабого кашля в легочной ткани и органах дыхательной системы, и происходит процесс воспламенения. В большом количестве выпадки вин вимага в комплексной терапии с сильнодействующими антибактериальными и жаропонижающими средствами.В некоторых ситуациях сиропы и таблетки играют роль вспомогательных элементов лечения, а основной курс шоковой терапии зависит от внутренних заболеваний таких медикаментов, как Оксациллин, Ампицилин, Гициазин

.

Антибиотик определенного типа или антиапалиновый следует принимать как индивидуальное и подходящее лекарство только потому, что в результате лабораторных исследований установлен бактериальный штамм, который вызывает воспаление, процесс и низкую температуру

Лікування народного засоба

Чтобы ускорить процесс вынашивания ребенка, одновременно с приемом традиционных лекарственных препаратов вам будет разрешено використовувати принимать народные лекарства.Очень важно придерживаться этих категорий маленьких пациентов, так как они не дают медицинских показаний к имплантации меда, экстрактов и добавок лыкарских трав, молока и цукру.

Самые простые и эффективные рецепты лечения хрипов при тупом и хриплом кашле можно найти при имплантации таких домашних ликаров, а также:

  1. Отвар из корня алтея, ромашки листовой, мать-и-мачуха, мать-тимьян, зомби.Все вони готовятся по одному принципу. Возьмите от 15 до 30 граммов сушеного розелина и отварите в 1 литре воды на 15-20 игл. Привыкнуть к инструкциям в инструкции или рекомендациям врача.
  2. Чай, или горячее молоко с малиновым вареньем и медом. Не знаю, какие малину и джемы готовят на основе натурального аспирина, который снизит температуру и стабилизирует нервную систему робота. Мед - сильнейшее противопожарное и антисептическое средство.
  3. Редис с медом. Для приготовления целого домашнего ликера необходимо полностью очистить корни редиса от внутренней мякоти и на треть выдержать с сырым медом. Пройти 24 года и принципиально, прежде чем вводить глюкозу во всю ее силу. Используйте домашний сироп от кашля. Единственное, что редис нельзя принимать детям, так как у них проблемы с сердцем, так как нельзя принимать активные компоненты роста роста сердца.
  4. Лук с цукатами. Принцип технологии, данной в народной медицине, заключается в том, что цибулин легко варится с сахаром, что стимулирует выделение сока из мякоти овощей. В результате ребенок заберет чистый сик из цибули, наполненный величественным кругом витаминов, мин и рифм с корицей, а также антисептическими и противопожарными свойствами.

Для достижения более короткого терапевтического эффекта рекомендуется использовать несколько видов нетрадиционных методов устранения хриплого кашля и хрипов, которые немного умирают в процессе ребенка.Перед тем, как приступить к соответствующему курсу, необходимо проконсультироваться с врачом-педиатром.

Концерт Венди Брук 2019 - Песни и джем

Фестиваль Венди Брук провел 5 апреля свой ежегодный концерт 40 th , на котором присутствовало более 250 человек. Это событие не только подчеркивает удивительные молодые таланты в районе Вегревилля, но и четвертый год подряд оно транслируется по радио благодаря каналам Country 106.5 FM и Perogies and Jam.

Музыкальный фестиваль Венди Брук восходит к 1961 году, когда он начался с ежегодного концерта Венди Брук Кэрол.В 1979 году Женский институт Венди Брук стал движущей силой, когда они открыли Музыкальный фестиваль. В 1986 году Ротари-клуб на много лет стал основным спонсором, а затем, в 1999 году, был создан Комитет Венди Брук для обеспечения руководства и действует по сей день. Сообщество Вегревилля было твердо привержено музыке на протяжении всего этого времени, о чем свидетельствуют многочисленные добровольцы, спонсоры и участники. Лариса Бомбак и Виола Браун-Фокс организовали мероприятие в этом году с помощью множества волонтеров.

В 19:00 ведущая Коллетт Миллер приветствовала публику на мероприятии, а «O Canada» вела Дебби Федорук в сопровождении фортепиано Виолы Браун-Фокс.

Мэр Вегревилля Тим Макфи поздравил фестиваль Венди Брук с 40-летним вкладом музыки в жизнь общества и вручил им городскую награду за выдающуюся службу на протяжении этих лет.

Исполнителей за вечер было:

  • Клэр Пасай (фортепиано) - «Сонатина соль мажор» Л.В. Бетховен
  • Оделия Раяварапу - «Ожидание, ожидание» Джона Форстера
  • А.Л. Хортон Гр.1 Украинский двуязычный - «Два Барантзее» Х. Чубаха
  • Школа Мундаре Гр. 1 - «Рев» Кэти Перри
  • Одри Ларкин - «В неизвестность» Патрика Хейла
  • Оливер Хорон, Торрин Локхарт, Адам Миллс - «Майстер Свирд» Ивана Франко
  • Клейден Луцак (скрипка) - Вальс Жизель ',' Shoe Jig 'и' Reel de Lindbergh '
  • Chelsea Malabanan -' Эд невидимый дракон 'Д.Rhodenizer
  • AL Horton Gr 6 Украинский двуязычный Acapella - «Oj Chornaja» от Chorna
  • Калли Остин - «Все хотят быть кошкой» Аль Ринкер
  • Мия Бургхардт и Эмили Каучман (фортепианный дуэт) - «Цвета ветра»
  • Шейд Кларк (скрипка) - «Уиллоу-Спрингс» Спейда Кули
  • Колдер Лангкоу и Максим Рудик - «Три боковых истории» Луи Сачара
  • А.Л. Хортон Гр. 4B (магнитофоны) - «Counting Stars» One Republic
  • Винни Ланге (сольный концерт) - «Златовласка и три медведя» Р.Даль
  • Дилан Ваднайс (труба) - «Лето» Джорджа Гершвина
  • Эбигейл Белламконда - «Назови свое имя» Л. ДеШазо и Дж. Сэдл
  • София Ким (фортепиано) - «Соната соль мажор» WA Моцарт
  • AL Horton Gr. 5 Украинский двуязычный (хоровая речь) - «One Inch Tall» Шел Сильверстайн
  • VCHS Senior Jazz Band - «Песня для моего отца» Горация Сильвера, «Foot Prints» Уэйна Шортера
  • Кен Тимансон - «Посади редис» Харви Шмидт
  • Джулия Долейси (с гавайской гитарой) - «Riptide» Вэнса Джоя
  • Певцы Святого Иоанна - «Мы верим» Т.Райан, М. Хупер, Р. Фике

Между пятью сетами этого вечера Виола Браун-Фокс объявила награды и спонсоров в каждой из категорий. В конце вечера ведущая Коллетт Миллер поздравила всех исполнителей с демонстрацией своего таланта.

Спасибо Виоле Браун-Фокс и многочисленным волонтерам Венди Брук, Джеймисону Брауну из Country 106.5 FM, а также Ральфу Арндту и Грегу Проберту из школы А. Л. Хортона за их поддержку. Среди волонтеров Perogies и Jam на этом мероприятии были Байрон Джеймс, Рэнди Керелюк и Дон Харфилд в качестве звукооператоров, Роб Хьюз в качестве фотографа и Гордон Форбс для установки оборудования.

Perogies and Jam с радостью выступили спонсором музыкальной премии сообщества певцов Святого Иоанна (хор для взрослых лютеранской церкви Святого Иоанна) в этом году.

Музыкальный фестиваль Венди Брук полагается на своих многочисленных добровольцев, которые самоотверженно посвящают свое время в течение года, особенно в период с января по апрель, чтобы сделать это мероприятие успешным и сделать честь нашему сообществу. Посетите веб-сайт Венди Брук http: // wendybrookmusic.wix.com/wendybrook для получения дополнительной информации.

Всем спасибо! Посмотрите фотографии с мероприятия этого года ниже.


Фотогалерея
Фотография предоставлена ​​Робом Хьюзом

Пошаговое руководство по приготовлению супер быстрого домашнего приготовления бадами кулфа

Бадами Кулфа

Привет всем, надеюсь, у вас сегодня замечательный день. Сегодня мы приготовим отличное блюдо - бадами кулфа.Один из моих любимых. На этот раз я сделаю немного вкуснее. Будет очень вкусно.

#BadamiKulfiРецепт домашнего бадами кулфи на урду лахоре бадами кулфи бадами кулфи рецепт кулфи банане ка тарика кулфи фалуда кулфи мороженое кулфи в домашних условиях. Рецепт Бадами Кульфи считается одним из самых популярных рецептов пакистанской кухни. Ни один обеденный стол не обходится без вкусных блюд.

Бадами куфа - одно из самых популярных блюд на земле.Это легко, быстро, вкусно. Ежедневно им пользуются миллионы. Бадами кулфа - это то, что я любил всю свою жизнь. Они милые и выглядят фантастически.

Чтобы начать работу с этим рецептом, мы должны подготовить несколько компонентов. Вы можете приготовить бадами кулфа, используя 10 ингредиентов и 10 шагов. Вот как это приготовить.

Ингредиенты, необходимые для приготовления Бадами кулфа:
  1. Взять 1,5 литра Полножирное молоко
  2. Достать 200 мл сгущенного молока
  3. Взять 2 си 3 столовые ложки свежих сливок
  4. Получите 1 чайную ложку порошка кардамона
  5. Готово 150 грамм Хойя
  6. Приготовьте 2 столовые ложки несоленого сливочного масла
  7. Приготовьте 2 ломтика хлеба
  8. Get 3 sy 4 столовые ложки миндального писси hoey
  9. Возьмите 1 чайную ложку розовой воды (по желанию)
  10. Приготовьте несколько капель миндальной эссенции

Привет, гурманы! Надеюсь, вы, ребята, в порядке, Meal Mist приносит еще один удивительный рецепт Бадами Кулфа. Вы также можете называть его Малай Кулфа.Итак, это миндальное мороженое. Бадами Кулфа - бесподобный выбор для этой задачи. Трудно избежать этого сладкого наслаждения, даже если у него диабет.

Шаги, чтобы сделать Бадами кулфа:
  1. Doodh ko boil kar ke 10 sy 15 mint halki anch par pakaen.
  2. Usk плохой сгущенки Dal ke pakaen.
  3. Сат крем или масло b добавить krden jab garha pan любой иги в бадам или khoya masal ke dalen или pakaen Spoon sy chalty затем chorna ni Hy.
  4. Тогда порошок Elaechi b dal dein или chalaty rhen wrna lag jaeygi.
  5. Джаб кхоя Хал хо джэй пхр розовая вода Даал кар хоб ачи трха пакаен халки анч пар.
  6. Chamach cahlaty rehna Hy garhi ho jaey to Комнатная температура par thanda krlen.
  7. Затем взбейте мне ломтик хлеба по центру Вала кусок или смесь кулфа ка даль кар 1 смесь мяты карейн.
  8. Или phr kulfi ke sanchy ya kisi b чаша me sal kar 24-часовая морозильная камера me rakh или Jama lein.
  9. Джем джей никал кар серв карейн.
  10. Вкусная домашняя Кулфа Тайар Хай.

Помогает успокоить нервы в жаркое время года и. Бадами Кульфа - любимый замороженный десерт сердца всех возрастных категорий. Скорее, чтобы купить его, вы можете легко доставить его домой. Сделать Бадами Кульфу в домашних условиях экономично и без особых усилий. Badami Kulfi بادامی قلفی - Десертное мороженое - любимый замороженный десерт всех возрастных групп.

Итак, на этом закончим рецепт особого блюда бадами кулфа. Спасибо за прочтение. Я уверен, что вы сможете сделать это дома.Скоро появятся интересные блюда по домашним рецептам. Не забудьте сохранить эту страницу в браузере и поделиться ею со своей семьей, друзьями и коллегами. Спасибо за чтение. Готовь!

.
Чорна редька: На городи чорна редька (Украинская)

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *