Содержание

Каменное масло — белое мумиё!

Каменное масло, также известное как белое мумиё — очень редкий уникальный и волшебный подарок Природы человеку! Это народное средство пришло к нам из Тибетской медицины, и хотя оно не столь широко известно, как черное мумиё, лечатся им уже более 4000 лет!

В китайской медицине  каменное масло относят к эликсиру молодости — пище бессмертных людей, оно ценилось на вес золота, и при императорском дворе было разрешено употреблять белое мумиё только членам императорской семьи, остальным же, кто осмеливался попробовать это чудо-средство, отрубали голову.

В России каменное масло начали добывать в Сибири и использовать для лечения в 18 веке по Указу Петра 1.

Состав каменного масла

Каменное масло — это алюмокалиевые квасцы, в которых также содержится сульфат магния и водорастворимые соли. Образуется оно высоко в горах в результате выщелачивания горных пород и находят его в пещерах и расщелинах скал.

В каменном масле содержатся в высокой концентрации калий, магний, железо, йод, цинк, кобальт, фосфор, марганец…

Отличие каменного масла от мумиё

Хотя каменное масло и называют белым мумиё, от черного мумиё оно отличается коренным образом, так как представляет собой чисто минеральный продукт, а мумиё — органо-минеральное вещество, то есть помимо минеральных солей содержит органические примеси.

Целебные свойства каменного масла

Каменное масло является сильным иммуномодулятором, хорошо укрепляет иммунитет. Это сильный адаптоген, который повышает защитные силы организма и помогает восстановиться после перенесенных тяжелых заболеваний, химиотерапии, лечения антибиотиками…

Каменное масло хорошо воздействует на все обменные процессы в организме, восстанавливая обмен веществ, чистит кровь, выводит токсины и шлаки, приводит показатели анализа крови к норме, омолаживает весь организм являясь эликсиром молодости.

Хорошо помогает при таком тяжелом заболевании обмена веществ, как сахарном диабете.

Масло помогает хорошо при кожных заболеваниях, угревой сыпи, псориазе, а также всевозможных порезах, ушибах, ожогах и обморожениях.

Каменное масло эффективно в лечении доброкачественных и злокачественных опухолей с метастазами. Особенно хорошо его применять в гинекологии, при миоме, фибромиоме, а также женских заболеваниях: эрозии, кольпите, сальпингите… Масло помогает также при внутренних кровотечениях и кровавых поносах.

Белое мумиё как и черное хорошо лечит язву желудка, гастрит, энтероколит, расстройства пищеварения.

Хорошо применять каменное масло при заболеваниях полости рта: гингивит, кровоточивость десен, пародонтит, пародонтоз.

Помогает каменное масло и при заболеваниях суставов с отложением солей: артриты, артрозы.

Также как и черное, белое мумие ускоряет заживление костей при переломах.

При цистите и камнях в почках и мочевой пузыре и при болезнях печени также применят каменное масло.

Способ применения каменного масла

Каменное масло имеет консистенцию порошка, который хорошо растворяется в воде и принимается внутрь или наружно в виде раствора.

Обычно берут 3 г масла и растворяют их в 2-х литрах воды, принимают по 1 стакану 2-3 раза в день до 12 дней. Затем разводят 3 г масла на 1 литр и принимают еще 12 дней.

При язвенной болезни рекомендуется делать более высокую концентрацию раствора: 3 гр. растворить в 600 мл. воды.

При наружном применении 3 гр. растворяют в 300 мл. воды.

При сахарном диабете эффективно каменное масло разводить в отваре овса для усиления лечебного эффекта и поддержки печени. При таком применении сахар в крови снижается очень хорошо.

Для профилактики болезней, укрепления и долголетия организма можно принимать каменное масло в слабом растворе в течение двух недель 3-4-мя курсами в год.

Предостережение!

Очень важно при лечении каменным маслом не принимать антибиотики, гормоны и алкоголь, исключить на время лечения из рациона кофе, черный чай, какао, шоколад, а также свинину.

Противопоказания:

Беременность и кормление грудью, низкое давление.

В Екатеринбург можно купить каменное масло в нашем магазине.

Лечебные свойства каменного масла и его способ применения

Каменное масло имеет множество названий: белый камень, бракшун, горные слёзы, белое мумиё… Но как бы его ни называли, одно остаётся неизменным – уникальные целительные свойства этого необычного вещества.

По своему виду и составу каменное масло на масло вовсе не похоже. Готовое к употреблению, оно представляет собой порошок белого или кремового цвета с кисловатым вкусом. Добывают каменное масло высоко в горах. Его соскабливают с поверхности скал, а затем очищают от примесей.

Механизм образования бракшуна доподлинно не известен. Ясно только, что это продукт выщелачивания определённых горных пород. Каменное масло хорошо растворяется в воде, а потому его удобно принимать внутрь.

С давних пор этот продукт использовался в Тибетской, Китайской, Монгольской медицине как средство от многих заболеваний. Сегодня оценить этот полезный горный продукт можем и мы.

Состав каменного масла

Химически горные слёзы представляют собой алюмомагниевые квасцы: на долю сульфатов магния и алюминия приходится до 95% состава. Остальные вещества могут меняться в зависимости от места, где было собрано каменное масло, вида горных пород и даже возраста гор. Как правило, в наибольшей концентрации в нём содержатся: цинк, калий и кальций, железо и медь, йод, селен, кремний, марганец, натрий и другие полезные вещества. Многие из них жизненно необходимы человеку, но получить их, что называется, «со стола» зачастую не представляется возможным.

Полезные свойства бракшуна

Каменное масло обладает выраженными антибактериальными свойствами. Поэтому его применяют для полосканий полости рта и горла при таких заболеваниях, как стоматит, тонзиллит. Противовоспалительное свойство масла оказывает положительное влияние на здоровье при многих заболеваниях, в частности – при болезнях мочеполовой сферы, таких как цистит, пиелонефрит.

Содержание в бракшуне железа позволяет применять его при железодефицитной анемии. Каменное масло является мощным природным адаптогеном. Оно помогает организму справиться с негативным влиянием окружающей среды, укрепляет иммунитет, оказывает тонизирующее действие.

Применяемое наружно, оно оказывает ранозаживляющее действие, снимает воспаление, зуд и раздражение при кожных заболеваниях.

Каменное масло «Алтэя»

Современный ритм жизни диктует свои правила. Поэтому каменное масло «Алтэя» выпускается в максимально удобной форме – в виде капсул. В линейке продуктов на основе каменного масла – 7 средств. Помимо бракшуна, в капсулах содержатся различные полезные добавки, усиливающие его действие, в зависимости от назначения. Так, каменное масло с сабельником и белой ивой «Радость движения» — прекрасное средство для поддержания здоровья суставов. Каменное масло с глицином, валерианой и пустырником «Антистресс» рекомендуется для нормализации сна, укрепляет нервную систему. Познакомиться со всеми продуктами линейки можно в нашем каталоге.

Способ применения каменного масла «Алтэя» предельно прост: нужно выпивать 1 капсулу раз в день, утром, запивая водой. Каждая упаковка содержит 30 капсул и рассчитана ровно на 1 курс применения.


Лечение гингивита у детей

Вопреки распространенному мнению, основные стоматологические проблемы у детей связаны не с зубами, а с деснами. Неудивительно, ведь временные молочные зубы ребенка с годами полностью меняются, а вот десны остаются с человеком навсегда. Одной из самых распространенных болезней десен является гингивит — поражение слизистых оболочек десен воспалительного характера.

Причины

Основной причиной детского гингивита практически всегда является недостаточный уровень гигиены и профилактики заболеваний полости рта.

Нередко родители допускают ошибку, научив маленьких детей чистить зубы, но не контролирующих этот процесс в дальнейшем. Ребенок же, не понимая важности гигиены полости рта, может превратить процесс чистки зубов в забавную, но бесполезную игру. Результат в виде зубного налета обычно бывает налицо, вернее, на зубах и деснах.

Налет на детских зубах служит отличной кормовой базой для микроорганизмов, в том числе и болезнетворных. Разрастаясь, колония микробов вызывает ответную реакцию организма — возникает воспаление.

Хотя воспаление и является естественной реакцией организма, борющегося с нежелательным воздействием, борьба эта не проходит бесследно — организм расходует внутренние ресурсы, вследствие чего происходит постепенное разрушение воспаленной ткани.

Также заболеванию детей гингивитом способствуют следующие факторы:

  • несбалансированное питание, отсутствие важных минералов и витаминов, особенно витамина С;
  • травмы слизистой оболочки десен из-за неправильного прикуса, разжевывания твердой пищи, ожога горячей пищей или питьем;
  • вирусныеинфекции;
  • сахарный диабет;
  • наследственная предрасположенность.

Особенности

Гингивит чрезвычайно распространен в детском и подростковом возрасте, так как именно дети наиболее подвержены заболеванию гингивитом. Виной тому повышенная восприимчивость пародонта у детей.

Заболеваемость гингивитом достигает пика с наступлением среднего школьного возраста, когда на ускоренный рост тканей пародонта накладывается свойственный подросткам «гормональный взрыв».

Гингивит не является редкостью и у совсем маленьких детей, возрастом 1 год и младше. Это вполне объяснимо, ведь один из главных факторов возникновения гингивита — травмы десен, что и происходит при прорезывании зубов. А к этим естественным травмам добавляется неразвитость иммунитета и слабая насыщенность ротовой полости маленького ребенка полезной микрофлорой.

Иногда можно встретить гингивит даже у грудных детей. Родителям рекомендуется при обнаружении любых подозрительных симптомов в столь нежном возрасте немедленно обращаться к детскому стоматологу.

Дополнительным фактором риска может стать короткая уздечка губы, мешающая правильной гигиене десен и способствующая скоплению остатков пищи. В большинстве случаев уздечка губы растягивается сама собой, но если этого не произошло до того, как ребенку исполнится 2 года, по предписанию врача производится хирургическая резекция.

Симптомы и классификация

Для того, чтобы не дать болезни развиться и начать лечение как можно скорее, нужно правильно и своевременно распознать симптомы заболевания. Симптомы гингивита напрямую зависят от той стадии, в которой находится болезнь.

  • Катаральный — наиболее легкая и самая распространенная разновидность болезни. Для этой острой стадии характерны покраснение и отек края десен, зуд, жжение, образование характерных зубных отложений. Заметен неприятный запах изо рта. Ребенок постарше может пожаловаться на неприятный привкус во рту. Известный детский врач Евгений Комаровский утверждает, что нередко катаральный гингивит и стоматит у детей сопровождают собой заболевания, вызванные герпетическими и вирусными инфекциями.
  • Простой маргинальный — хроническая вялотекущая разновидность катарального гингивита. Симптомы схожи, но выражены слабее. Заметная боль при этой разновидности встречается редко, а зуд может быть довольно сильным, из-за чего эта болезнь у маленьких детей часто проходит незамеченной — ее попросту путают с естественным зудом при прорезывании зубов.
  • Десквамативный проявляется обильным покраснением и отслоением покровов слизистой оболочки десен.
  • Гиперпластический чаще всего возникает при гормональных истоках болезни, что характерно для подростков. Отличается эта разновидность заболевания заметным воспалением выступов десен между зубами — так называемых зубодесневых сосочков. Распухая, сосочки образуют у основания зуба пазухи, которые нередко заполняются дурно пахнущим гноем. Десны при этом кровоточат.
  • Гипертрофическийявляется тяжелой хронической формой гиперпластического гингивита. Отек воспаленных зубодесневых сосочков при этой форме болезни настолько выражен, что коронка зуба может значительно (иногда полностью) скрываться в опухшей десне.
  • Язвенно-некротический— тяжелая форма заболевания. Ребенок испытывает сильную жгучую боль, у основания зубов образуются открытые кровоточащие язвы, основания зубов частично обнажаются. Могут появляться признаки общего недомогания — слабость, тошнота, повышенная температура.
  • Атрофический — наиболее тяжелая стадия воспаления слизистой оболочки десен, ткани десны заметно истончаются, основания зубов сильно обнажены. Кровотечение и отделение гноя обильные, сильная боль требует медикаментозного купирования.

При отсутствии лечения детскийгингивит переходит в стадию глубокого поражения пародонта — пародонтоз, что чревато потерей значительной части зубного ряда.

Лечение гингивита у детей

Лечение на ранних стадиях

Гингивит на ранних, не запущенных стадиях (катаральный и простой маргинальный гингивит) вполне поддается лечению своими силами в домашних условиях.

Начинать следует с облегчения состояния ребенка. Снять болевой синдром помогут анестезирующие средства, в частности различные препараты на основе лидокаина. Для лечения детей рекомендуется использовать лидокаиносодержащий препарат «Калгель».Это гелеобразное средство разрешено к применению даже для самых маленьких пациентов, даже при гингивите у годовалого ребенка. «Калгель» может быть использован, в том числе, при прорезывании зубов у грудничков.

Избавить от боли и снять воспаление детям постарше помогает применение бактерицидных мазей и ополаскивателей, таких как:

  • Пропсол;
  • Элюдрил;
  • Хлоргексидин;
  • Ромазулан.

Также одним из наиболее часто используемых лекарственных препаратов при гингивите у ребенка является гель Холисал. Этот препарат, помимо противовоспалительного, обладает также бактерицидным действием. В любом случае, перед применением витаминных препаратов и лекарств, особенно при лечении гингивита у грудничка, лучше проконсультироваться с лечащим врачом.

Также важно обратить внимание на питание детей: пища при гингивите не должна быть излишне холодной или горячей, кислой или соленой. Главная задача в этот период — максимально снизить воздействие раздражающих факторов на ротовую полость.

После снятия воспаления и уменьшения болей проводится терапия, направленная на уничтожение болезнетворных организмов. Для этого широко применяются антибиотические препараты, например, Амоксициллин, Метронидзол, Эритромицин.

Лечение гиперпластической и гипертрофической формы

Тяжелые формы гингивита поддаются лечению только в специализированных медицинских учреждениях. Лечение гиперпластического гингивита и его тяжелой формы, гингивита гипертрофического, кроме противовоспалительного курса и противобактериальных мероприятий может включать в себя удаления отечной ткани десен. Для этого применяются следующие методы:

  • Замораживание. В ткань десны вводятся склерозирующие препараты: раствор декстрозы либо хлористый кальций. Введение данных препаратов вызывает затвердение зубодесневых сосочков и прекращение патологического роста тканей.
  • Прижигание электротоком. Позволяет не только остановить разрастание отека большой области ткани, но и остановить кровотечение. Прижигание проводится методом диатеромкоагуляции — воздействия на ткань током силой 3-5 Ампер высокой частоты. Процедура отличается болезненностью и проводится под местным наркозом, поэтому не рекомендуется для детей до пяти лет.
  • Химическое прижигание. На подсушенную поверхность десны ватным тампоном наносится смесь раствора серной кислоты с эфиром.
  • Усечение десны (гингивэктомия). Применяется в особо тяжелых случаях, когда излечение ротовой полости ребенка без операции уже невозможно. Операция проводится под общим наркозом и, как правило, проходит без осложнений. Гингивэктомия обязательно сочетается с замораживанием либо прижиганием десны, в противном случае паталогическое разрастание может продолжиться, и через некоторое время усечение придется производить снова.

Лечение язвенно-некротического и атрофического гингивита

Чем быстрее страдающий язвенным или атрофическим гингивитом ребенок попадет к врачу-стоматологу, тем лучше. Дома ребенку должен быть предоставлен постельный режим и покой, так как может наблюдаться общее недомогание, сопровождающееся повышением температуры.

При ярко выраженном кровотечении десен, когда гингивит достиг язвенной или атрофической стадии, использовать зубные щетки с жестким ворсом не рекомендуется. В тяжелых случаях от чистки зубов щеткой придется воздержаться вовсе, ограничившись полосканием зубов специальными бальзамами.

Противовирусная и противовоспалительная терапия при данных формах схожа с аналогичными процедурами при маргинальном и катаральном гингивите. Кровотечения останавливаются с помощью точечного нанесения (аппликации) перекиси водорода.

Некротические (омертвевшие) участки тканей вокруг язв удаляются хирургически либо консервативно методом некролизабезхирургического рассасывания. Некролиз омертвевших тканей производится нанесением на пораженные участки наносится растворенный в хлористом натрии сублимированный фермент трипсин.

После купирования воспаления и заживления язв ребенку может понадобиться гингивопластика — восстановление утерянных участков десны путем переноса лоскутов ткани с других участков пародонта.

Народные средства

Серьезным подспорьем при лечении гингивита станет обращение к средствам народной медицины и гомеопатии. Для профилактики болезней полости рта и укрепления зубов издавна применялись отвары коры дуба, шалфея, зверобоя, пустырника.

Для лечения воспалительных процессов у ребенка использование настоев на основе спирта, а также спиртового раствора йода не допускается!

Народные рецепты:

  • Зверобойное масло. Средство готовится самостоятельно из сухих листьев зверобоя, которые можно приобрести в аптеке. Столовая ложка истолченных листьев заливается половиной стакана рафинированного растительного масла и оставляется настаиваться на ночь. Воспаленные десны смазывать зверобойным маслом три раза в день.
  • Смесь листьев шалфея и эвкалипта в равных пропорциях заливается кипятком из расчета по чайной ложке шалфея и эвкалипта на стакан кипятка. Настоять в течение суток и процедить. Применять по столовой ложке перед едой.
  • 3-4 грамма мумиё развести в стакане теплой воды, использовать для полоскания рта перед сном.
  • Другой способ использования мумиё: то же самое количество (3-4 грамма) развести в стакане теплого нежирного кефира (тщательно перемешать!). Держать во рту две-три минуты, после чего проглотить.

Профилактика

Главнейшее средство профилактики гингивита, равно как и других стоматологических заболеваний — гигиена ротовой полости. С самого раннего возраста приучайте ребенка чистить зубы не менее 10-15 минут, обязательно уделяя внимание внутренней стороне зубов. Приобретите ребенку лечебно-профилактическую зубную пасту, проследите за тем, чтобы он чистил зубы правильно. Для ликвидации въевшегося зубного налета можно использовать щетку с умеренно жестким ворсом. После чистки зубы следует тщательно прополоскать.

Приучите ребенка пользоваться зубной нитью для удаления остатков еды из пространства между зубами. Но учитывайте, что зубная нить также может травмировать десну при неправильном использовании, поэтому пользоваться зубной нитью ребенку до 3 лет не рекомендуется.

Современная стоматология не приветствует использования для ухода за зубами зубочисток, так как при их применении есть опасность не только травмировать десны, но и занести инфекцию. Отдайте предпочтение зубной нити.

Если во рту ребенка успел образоваться зубной камень, значит, без посещения стоматолога не обойтись. Врач удалит зубной камень максимально щадящим способом.

 

Мумиё при аллергии. Лечение аллергии | Отзывы: (51)

Аллергия — сбой в иммунной системе организма, который проявляется в виде повышенной чувствительности к определенным внешним раздражителям (аллергенам). Реакция организма на аллергены может быть разной: высыпания, покраснения кожи, кашель, отечность, насморк и др.

Распространенное на сегодняшний день облегчение симптомов таблеточными антигистаминами не дает ощутимого результата, а только временно гасит симптомы аллергической реакции.

Аллергия часто возникает еще в детском возрасте, поэтому с приемом медицинских препаратов нужно быть крайне осторожными. Важно также понимать, что отказаться от лечения аллергии — не выход. Чем дольше аллергия не лечится, тем серьезней развивается болезнь.

Рекомендуем абсолютно безопасный метод лечения аллергии с помощью природного средства мумиё. Принимая натуральное Алтайское мумиё при аллергии, Вы обогащаете организм огромным количеством полезных макро- и микроэлементов, среди которых очень важные для диабетиков: Cелен, марганец, цинк, хром, йод, витамины (А, Е, В1, B6, B12), кремний, фосфор. Благодаря 100% природному происхождению, все вещества в составе средства быстро усваиваются организмом без каких-либо побочных эффектов.

Как принимать мумиё при аллергии?

Для профилактики аллергии

Для аллергиков очень важно проходить ежегодный профилактический курс лечения с мумиё. Для этого Вам нужно 1–2 грамма Алтайского натурального мумиё растворите в половине стакана теплой кипяченной воды. Принимайте раствор мумиё 1 раза в день — перед едой с утра или вечером перед сном на протяжении 20 дней.

Мазь от аллергических реакций на коже

Для устранения аллергических дерматозов (высыпаний, пятен и т. д.) можно дополнительно смазывать зоны высыпания мазью из натурального мумиё. Для этого растворите 5 грамм средства с 50 миллилитрами воды и размещайте до нужно консистенции. Смазывайте кожу 2-3 раза в день до результата.

При сильной аллергии рекомендуем растворить в 0,5 литре воды 10 гр. мумиё. Принимать по 1-2 ст.л. до еды 2 раза в день.

Хороший способ против сезонной аллергии

При сезонной аллергии мумиё поможет снять симптомы. Для этого 5 грамм натурального мумиё развести в 0,5 литра воды. Лечебный раствор рекомендуется пить по 50 мл. дважды в день. Курс составляет 20 дней. Затем перерыв в 5 дней. И нужно для закрепления эффекта пропить ещё 10 дней. Повторять курс 1-2 раза в год.

Капли в нос при аллергическом рините

При аллергических ринитах необходимо растворить 0,5 мумиё в 0,5 стакане воды. Данный раствор можно использовать, как капли в нос.

Мумиё при лечении аллергической экземы

При лечении аллергической экземы, для внутреннего применения следует растворить 10 грамм мумиё на 1 литр воды. Принимать по 50 мл. 2 раза в день. Также для наружного применения: 20 грамм мумиё растворить 0,5 литра воды, рекомендовано наносить раствор мумиё на пораженные участки. После истечения 14 дневного курса, необходимо сделать 10-ти дневный перерыв, после чего курс повторить.

Лечение аллергии у детей с мумиё

Для лечения аллергии у детей Вам нужно 10 грамм мумиё растворить в 1 литре питьевой воды. Полученный раствор дают детям утром натощак. Дозировка будет зависеть от возраста: детям до 3х лет следует давать 50 мл раствора; детям до 7 лет – по 70 мл; детям до 14 – по 100 мл. Указанную дозу можно разбить на два приёма. Курс составляет до 10 дней. Если ребенку не нравится вкус мумиё, его можно смешать с соком.

Также расскажите о ваших рецептах и опыте использования мумиё при аллергии в комментариях ниже

* Каких результатов удастся добиться?

Мумиё стабилизирует иммунную систему организма и оказывает терапевтический эффект при аллергических реакциях:

  • Мумиё снимает симптомы аллергии.
  • Устраняет последствия и аллергические реакции в виде высыпаний, насморка, слезоточивости, кашля, отечности и т.д.
  • Усиливает защитные функции организма и поднимает его общий тонус.

* Результаты лечения могут отличаться из-за индивидуальных особенностей организма

* Результаты лечения могут отличаться из-за индивидуальных особенностей организма

Мумие для волос в шампунь: сколько таблеток, рецепт, пропорции

Мумие для волос в шампунь добавляется в виде таблеток или смолы, и создает полезное средство от перхоти и выпадения волос. С давних лет повелось так, что одним из показателей женской красоты считаются волосы. И поэтому каждая женщина хочет обладать роскошной шевелюрой. В мире существует масса разных средств по уходу за ними, одним из них является является мумие. Используют его для волос, для кожи, для улучшения ее структуры.


[contents]

Важно тщательно и ежедневно следить за здоровьем, и тогда оно отплатит вам взаимностью и красотой.

Показаниями для его применения

Ими служат факторы:

  • Обеспечение качественного ухода за волосами;
  • Избавление от возрастной кожной сыпи, угри;
  • Очищение слоев эпидермиса;
  • В целях борьбы с лишним весом.

Мумие для волос в шампунь

Добавление мумие для волос в шампунь — это способ местного воздействия на зону волос. Человек имеет возможность лечить свои волосы и не принимать, горькие по вкусу таблетки, внутрь. Такое применение препарата позволяет избежать передозировки.

Воздействуя на зону применения снаружи, мумие помогает оздоровлению волосяного покрова, помогает избавиться человеку от такого ненужного фактора как перхоть, поскольку обладает антибактериальным эффектом.

Способ позволяет использовать препарат ежедневно. Нанесение на распаренную кожу головы позволяет человеку достичь эффекта за непродолжительное время процедуры.

Повышается приток крови к клеткам головы и увеличивается концентрация цинка и меди. Эта процедура помогает улучшению клеточной регенерации и укреплению волосяных луковиц.

Фактор воздействия препарата

Богатство витаминного комплекса, содержащегося в мумие, помогает поддержанию необходимых микроэлементов в балансе организма.

Используя его на регулярной основе, уже через несколько дней применения результат будет заметен, поскольку он помогает:

  • Поддержанию обменных процессов в организме на необходимом уровне;
  • Укрепляет волосяные луковицы;
  • Стимулирует клетки кожи к регенерации;
  • Оказывает лечебное действие антибактериального характера;
  • Защищает волосы от излишней ломкости;
  • Способствует нормальной работе сальных желез кожи головы;
  • Ускоряет процесс роста волос;
  • Улучшает синтез коллагена в коже;
  • Ведет борьбу с процессами воспаления на коже, заживляет ранки;
  • Придает волосам эластичность и гладкость;
  • За счет пробуждения спящих волосяных луковиц, помогает увеличению объема волос;
  • Уменьшает образование жировых слоев под кожей головы;
  • Предотвращает сильную потерю волос.

Благодаря всем этим свойствам мумие это один из распространенных средств в косметологии по восстановлению волос.

Его используют в виде:

  • Масок;
  • Спреев;
  • Добавляют в шампуни.

Видео


Как сделать в домашних условиях

Если нет возможности приобрести готовый шампунь с мумие, то не стоит отчаиваться. Достаточно будет купить в аптеке таблетированный препарат и самый обычный шампунь, который подходит вашей коже головы.

Использование таблеток этого препарата является самым простым способом, готовить необходимо перед применением:

  1. Возьмите 1 порцию шампуня необходимого для мытья вашей головы и растворите в данном объеме 2 таблетки препарата.
  2. Таблетки предварительно необходимо измельчит в порошок, а затем добавить в шампунь.
  3. Волосы смочить водой и нанести приготовленную смесь.
  4. Легкими массирующими движениями аккуратно втирать в кожу головы.
  5. Оставить препарат для воздействия на 5 минут и смыть обычным способом.
  6. После использования этой процедуры для лучшего воздействия необходимо дать волосам высохнуть естественным способом.

В чем превосходство «золотого мумие»

С недавнего времени на прилавках аптек появился новый препарат фармакологической компании «Эвалар» «Золотое мумие». Препарат таблетированного характера.

Главным его преимуществом считается 100% очистка от примесей. Проведение этой процедуры сохраняет максимальное количество питательных веществ и микроэлементов, необходимых для организма на более продолжительное время.

Использование этого препарата в косметических целях по укреплению и стимулированию роста волос, для борьбы с перхотью, оказывает наибольший эффект.

Применение препарата ничем не различается от обычного мумие. Что необходимо помнить — это при использовании его внутрь имеются противопоказания, о которых нужно узнать каждому человеку.

К ним относят:

  • Наличие диагностированной беременности;
  • Период грудного вскармливания;
  • Индивидуальная непереносимость компонентов состава.

Ускоряем процесс роста волос

Сколько бы не было перечислено свойств мумие, не забывайте о том, что в каждой бочке меда есть своя ложка дегтя. Это косметическое средство не стоит применять женщинам с повышенной сухостью кожных покровов головы, поскольку действие этого препарата направлено на уменьшение подкожного жирового слоя.

В остальных случаях применение смеси из шампуня с мумие окажет положительное действие на рост волос.

Косметические салоны предлагают приобретение уже готовых шампуней с содержанием в них мумие. Но если пациент сомневается в истинном наличии данного вещества в приобретаемом продукте, то можно приготовить его самостоятельно дома по описанному рецепту.

Применение этой смеси для роста волос 3 раза в 7 дней. Курсом считается 10 процедур. Можно на месяц сделать перерыв, а затем приступить к процедурам снова.
Все хорошо в меру и не стоит ждать, что ваши волосы вырастут за неделю, природе нужно помогать, а не стараться изменить ее полностью,

Другие способы применения

Применение мумие для волос носит как лечебный, так и профилактический характер:

  1. Его широко применяют при развитии у человека облысения.
  2. Шампуни бальзамы и маски позволяют проводить качественный уход за волосами.
  3. При наличии перхоти и зуда головы его применяют как антибактериальное средство.
  4. При слишком высокой жирности кожи головы назначение применения этого препарата снижает выработку жира.
  5. Вышесказанного мумие может быть назначено человеку для обогащения организма необходимым витаминным комплексом. Но проведите предварительную консультацию с лечащим врачом и исключить наличие аллергических реакций со стороны организма.

Каждому необходимо помнить, что применение любого препарата должно приносить пользу организму, а не наносить ему вред.

Применение мумиё для лечения суставов

Лечение суставов с помощью мумиё.

Заболевания суставов самого различного происхождения являются на настоящий момент актуальной проблемой среди множества людей. Официальная медицина предлагает решение данного вопроса, но оно сводится к пожизненному длительному применению препаратов и не гарантирует полного излечения.

Народная медицина, в том числе фитотерапия, предлагает достойную альтернативу химическим средствам и представляет растения в самых различных лекарственных формах. Если вам интересна эта тема, то можете почитать статью фитотерапевта Алефирова Андрея Николаевича, врача высшей категории «Фитотерапия заболеваний суставов». Там подробно и понятными словами излагается суть суставных заболеваний, их виды и методы лечения травами.

Кроме лечения суставных заболеваний растительными средствами народная медицина предлагает также мумие. Ему отводится одно из первых мест по эффективности оздоровления. Самое важное, что оно не мешает использованию других препаратов, а помогает ускорить выздоровление.

Несмотря на большие различия в причине возникновения суставных заболеваний (перенесенная инфекция, аутоиммунный конфликт, нарушения обмена мочевой кислоты и др.), они имеют в своей основе общие механизмы развития. Основным патогенетическим механизмом в данном случае является воспаление, в результате которого наступает повреждение тканей суставов, выделение экссудата (воспалительной жидкости) и замещение поврежденных тканей рубцом. Чередование этих процессов или одновременное их протекание и формируют симптомы заболевания суставов: боль, покраснение, отеки, повышение температуры в области поражения, а также нарушением функции соответствующего сустава. Исходя из этого, можно выделить свойства мумие, решающие данные задачи.

Свойства мумие при заболевании суставов:

1. Снимает воспалительные процессы в суставных тканях;

2. Восстанавливает поврежденные ткани в суставах;

3. Восстанавливает нарушенные обменные процессы внутри больного сустава;

4. Регенерирует хрящевые ткани;

5. В составе мумие содержится необходимое для опорно-двигательного аппарата количество минералов, витаминов, органических соединений. Это способствует ускорению восстановления суставов;

6. Мумие активно очищает печень и улучшает состав крови, что очень важно при приеме химических препаратов;

7. Мумие не токсично и не имеет побочных действий.

Применение мумие при заболевании суставов.

Мумие, как правило, не применяется само по себе при лечении суставов. Но является замечательным и достаточно эффективным дополнением к назначенному курсу лечения (химическими препаратами, растительными и др.). Желательно сочетать его с употреблением трав, корней и др. , применяющихся для конкретного заболевания. В этих случаях эффективность лечения резко повышается.

Ориентировочная схема применения трав с мумие при артрите, полиартрите, артрозе.

Настойка корней сабельника болотного 1:10. 100 г корней сабельника залить 1 литром водки или спирта 45 градусов в стеклянную банку. Настоять в темном месте 2 недели, периодически взбалтывая. Процедить. Пить по 1 столовой ложке внутрь 3 раза в день до еды с небольшим количеством воды.

Отвар сбора трав с мумие внутрь. Лабазник вязолистный (3 части), багульник болотный побеги (2 части), смородина черная лист (2 части), малина лесная лист (3 части), солодка голая корень (1 часть), дягиль лекарственный корень (1 часть), алтей лекарственный корень (3 части). Способ приготовления: 1 ст.л сырья залить 1 стаканом (200 мл) воды. Настоять на водяной бане 15 минут. Накрыть полотенцем и настоять еще 30 минут. Процедить, довести до исходного объема. 0,2 г мумие растворить в 1/3 стакана отвара трав (температура отвара должна быть не более 37 градусов). Пить 3 раза в день до еды. Мумие растворять в отваре непосредственно перед приемом.

Компресс с мумие на область пораженных суставов. Мумие от 2 до 10 г, в зависимости от размера пораженного участка, растянуть в лепешку. Для этого его нужно прогреть, положить пакетик с мумие на теплую грелку. Затем разместить на пораженном суставе. От температуры тела мумие начинает растекаться, поэтому необходимо защититься от протекания, наложив сверху дополнительную тканевую или марлевую повязку. Компресс делается на ночь, а утром снимается. Остатки мумие смываются водой. Курс 10 дней, процедуру повторяем через день.

Курс лечения 21 день, затем перерыв 10 дней. Затем курс необходимо повторить.

Для подагрического артрита можно использовать те же рецепты, только в сбор вместо листьев малины положить столько же цветов вереска.

Ориентировочная схема при ревматизме.

Лабазник вязолистный (3 части), донник лекарственный (1 часть), адонис весенний (1 часть), земляника лесная (2 части), полынь горькая (0,5 части). Способ приготовления: 1 ст.л сырья залить 1 стаканом (200 мл) воды. Настоять на водяной бане 15 минут. Накрыть полотенцем и настоять еще 30 минут. Процедить, довести до исходного объема. 0,2 г мумие растворить в 1/3 стакана отвара трав (температура отвара должна быть не более 37 градусов). Пить 3 раза в день до еды. Мумие растворять в отваре непосредственно перед приемом.

Компресс с мумие. 0,5 г мумие растворить в 1 ст.л воды, добавить 100 г меда. Тщательно перемешать. Мумие должно раствориться полностью. Втереть в пораженный сустав, замотать пищевой пленкой и наложить согревающую повязку. Компресс оставить на ночь, утром смыть теплой водой. Курс 10 дней перерыв 5 дней, затем курс повторяем 2-3 раза, в зависимости от тяжести заболевания.

Растирки с мумие. 50 г плодов софоры японской залить 500 мл водки или спирта 45 градусов в стеклянную банку. Настоять в темном месте 2 недели, периодически взбалтывая. Процедить. 5 г мумие растворить в 100 настойки софоры японской. Растирать полученным раствором больные суставы на ночь. Курс 25 дней.

Общие рецепты для лечения суставов с мумие.

Ванны с мумие. 12 г мумие растворить в 1 литре воды. Набрать ванну воды и вылить туда полученный раствор с мумие. Температура воды не должна превышать 37 градусов. Длительность процедуры 20 минут. Курс 10 процедур через день. Затем 10 дней перерыв и курс можно повторить. После ванны рекомендуется отдохнуть от 30 минут до 1 часа под теплым одеялом.

Мумие внутрь. 0,3 г мумие развести в 150 мл молока или воды. Пить 3 раза в день до еды за 15 минут. Курс 21 день, перерыв 10 дней, затем курс повторяется.

Мумие внутрь (рецепт И.П. Неумывакина). 20 плодов шиповника очищенного от семени залить 100 мл кипятка, настоять в термосе 3 часа, процедить. Добавить 15 г перги (пчелиный клей), 10 капель витамина А (масляная форма) и, в полученном настое, растворить мумие 5 г. Принимать по 1 ч.ложке утром и вечером. Курс 6 месяцев: прием 20 дней, 20 дней перерыв.

Для полноты освещения проблемы нужно также добавить, что, несмотря на всю эффективность мумиё, применение этого средства при суставных заболеваниях не отменяет потребности в грамотно назначенной ЛФК, специальной диете и терапии, поскольку заболевания считаются достаточно упорными и могут быть обращены вспять лишь при комплексном лечении.

Автор данной статьи: травница, специалист народной медицины Кайгородова Татьяна.
Купить мумиё Алтайское

Мумие при переломах костей. 5 лучших способов применения

Мумие – природное средство, присутствующее в народной медицине несколько десятилетий. При помощи алтайских «слез гор» люди могли исцелить любые болезнь и травмы, включая переломы костей. Но как появилось мумие? Очень давно люди нашли в горах темную субстанцию, которая отличалась специфичным запахом. Однако при контакте с ранами было замечено, что регенеративная функция существенно возрастает. Преимущество мумие состоит в том, что лечить переломы можно у пациентов любого возраста и вне зависимости от пола. В современной медицине мумие занимает далеко не последнее место и активно используется для лечения внешних ранений, а также сращивания костей.

Мумие для лечения переломов

Сломанные кости – одна из тяжелейших травм получаемых человеком, ведь это нагрузка на весь двигательный комплекс. Нарушить целостность кости может любая травма или патология, результатом которой становиться деформация. В особых случаях, присутствует пагубное воздействие на мышечную структуру, если перелом внутренний, закрытый.

При переломах костей у пациента присутствуют сильные боли, отечность поврежденной области, наблюдается высокая температура. Со временем, деформированная кость покрывается мозолью, и в дальнейшем происходит срастание. Это наиболее благоприятный момент для начала терапии.

Купить мумие за 550₽ Купить мумие за 550₽

Применение мумие будет зависеть от типа перелома, пораженной области, а также временного промежутка. Но как принимать мумие при переломах? Нужно немного подождать, пока кости начнут срастаться. Только после этого начинать лечение. Мумие можно применять как внутренне, так и наносить на пораженную область.

Важно: перед началом терапии мумие нужно проконсультироваться у лечащего специалиста. Наибольшего эффекта от применения можно достичь посредством комбинированной терапии.

Как пить мумие при переломах костей

Для терапии переломов рекомендуется мумие алтайское. Средство обладает мощным терапевтическим эффектом, а также универсально, ведь используется как наружно, так и внутренне. Стоит помнить, что только специалист может обозначить, как правильно пить мумие при переломах костей. Самостоятельное употребление принесет только вред.

Если был наложен гипс, то лучше принимать мумие перорально. Для этого существует два способа: приготовление водного раствора или комбинация с медом.

Водный раствор

Мумие невозможно растворить в спирте. Рекомендуется обычная вскипяченная вода (теплая) или свежевыжатый сок. Пероральный прием водного раствора позволяет устранить любые трещины в костях, а также «подлечить» старые переломы.

Алгоритм приготовления выглядит следующим образом:

  • доводим до кипения четверть литра воды или сока;
  • на кончике столовой ложки добавляет в жидкость смолистое мумие;
  • ждет 20-30 минут, пока смесь полностью остынет;
  • за несколько часов до еды выпиваем, принимать лекарство нужно исключительно на голодный желудок.

Терапевтический курс составляет месяц. Принимать средство можно не более 1 раза в день. Инструкция по применению гласит, что при необходимости, терапию можно продлить, но не больше чем на 2 недели.

Важно: принимать лекарство можно соблюдая дозировку. Только в этом случае терапевтический курс пройдет успешно.

Мумие с медом

Для восстановления деформированной кости, которая представляет собой повреждение закрытого типа, при переломе бедра или тазобедренной кости рекомендуется пить мумие с медом. Именно сладкий продукт позволяет многократно усилить терапевтический эффект смолистого вещества. Чтобы приготовить лекарство потребуется 1 грамм мумие, 100 мл вскипяченной охлажденной воды и 150 грамм меда. Смолистое вещество смешать с водой (желательно в стеклянной банке) и оставить в теплом месте на несколько дней. После добавить мед и тщательно перемешать. Схема приема: дважды в сутки по чайной ложке, желательно натощак.

Внимание: если пациент страдает непереносимостью меда, категорически запрещается использовать это средство.

Применение мумие наружным методом

Смолистое вещество можно использовать также для наружного применения. Таким способом, восстанавливается не только костная структура, но и кожный покров с мышечными волокнами. Применять мумие наружно рекомендуется при многочисленных или открытых деформациях кости. К примеру, при переломе ноги, руки или позвоночника. Наносить средство необходимо непосредственно на пораженную область. Если отсутствуют болевые ощущения, рекомендуется при нанесении слегка массировать травмированный участок. Так лечение перелома пройдет максимально эффективно.

Мазь

При переломе позвоночника, одной кости в нескольких местах или открытая травма, лучшим решением станет приготовление мази на основе мумие. Сразу стоит заметить, что средство категорически запрещено людям, страдающим аллергией. Если же вы решили изготовить мазь на свой страх и риск, то при первых аллергических проявлениях нужно немедленно посетить медицинское учреждение.

Алгоритм приготовления мази выглядит следующим образом:

  • Необходимо разогреть до жидкого состояния 100 грамм меда.
  • При достижении требуемой консистенции добавляет мумие (1 грамм).
  • Далее тщательно перемешиваем, до образования однородной массы.
  • Ставим емкость с мазью в темное место, лишенное влияния ультрафиолета.
  • Спустя сутки еще раз перемешиваем.

Средство против переломов готово! Наносить мазь нужно равномерно, тонким слоем. После нанесения накрыть бумажным полотенцем или целлофановым пакетом. Лучше всего мазь использовать перед тем, как ложиться спать и оставлять компресс на ночь.

Массажная паста

При переломе лодыжки, шейки бедра или запястья лучше всего подойдет массажная паста на мумие. В целом, средство подходит для реабилитационного мероприятия, когда кость уже начала срастаться.

Необходимо смешать детский крем и 1 грамм смолистого мумие. Лучше всего смешивать в плоской тарелке, чтобы потом было удобно наносить на пораженное место. Терапевтический курс составляет 2 недели.

Мумие для лечения переломов у детей

Дети – наиболее потенциальная группа риска, у которой чаще всего бывают переломы. Это обусловлено тем, что детский организм еще достаточно слаб и достаточно незначительной травмы, чтобы спровоцировать надлом кости. Но, мумие абсолютно безопасно для детей, хоть и должно применяться согласно определенным условиям.

К примеру, таблетки или порошок не подойдет малышам. Необходимо очищенное алтайское мумие, представляющее собой смолистую субстанцию. Помимо этого, использовать его можно лишь под строгим наблюдением врача, который будет корректировать дозировку.

Количество лекарства, а также дозировка варьируется от возраста ребенка, его массы тела, а также степени и области повреждения. При незначительных травмах (надкол кости) достаточно помазать средством буквально две недели, чтобы полностью устранить проблему. Но при более глубоких повреждениях требуется серьезный терапевтический курс, основанный на мумие.

Лечить переломы у детей можно при помощи мази и массажной пасты на мумие. Не рекомендуется использовать мед, по данным следований, каждый третий ребенок страдает на него аллергией.

Помимо этого, при переломах костей у детей можно принимать мумие перорально, но исключительно с дозволения лечащего специалиста.

Для лечения пожилых людей

Переломы у пожилых людей явление не частое, но, к сожалению, возможное. Люди преклонного возраста вторая группа риска после детей, чаще всего подверженная переломам. Недостаток кальция и фосфора в организме истощает кости, что приводит к их деформациям. В результате, происходит травма, последствия которой могут тянуться месяцы или даже годы.

Для терапии переломов у пожилых людей используется растирка на алтайском мумие. Для приготовления потребуется всего два ингредиента: розовое масло и 1 грамм мумие. Перемешать компоненты, довести до однородной массы. Каждый день растирать поврежденное место.

Действительно ли полезно мумие при переломах костей, ведь отзывы пациентов свидетельствуют о том, что средство невероятно эффективно? Безусловно! Очень редко мнение народной и современной медицины совпадает, но в данном случае, многие терапевты и травматологи рекомендуют лечить переломы любого типа алтайским мумие.

Материал мумие

может способствовать дифференцировке стволовых клеток, полученных из жировой ткани, в остеобласты за счет усиления экспрессии костно-специфических факторов транскрипции

Adv Pharm Bull. 2018 Авг; 8 (3): 457–464.

, 1 , 2 , 3 , 4 , 1 и 1 , *

Марьям Эйвази

1 Центр исследования стволовых клеток, Тебризский университет медицинских наук, Тебриз, Иран.

Рахеле Фарахзади

2 Исследовательский центр гематологии и онкологии, Тебризский университет медицинских наук, Тебриз, Иран.

Нахид Каримиан Фатхи

3 Кафедра биохимии медицинского факультета Тебризского университета медицинских наук, Тебриз, Иран.

Мохаммад Каримипур

4 Кафедра анатомических наук, медицинский факультет Тебризского университета медицинских наук, Тебриз, Иран.

Джафар Сулеймани Рад

1 Центр исследования стволовых клеток, Тебризский университет медицинских наук, Тебриз, Иран.

Азаде Монтасери

1 Центр исследования стволовых клеток, Тебризский университет медицинских наук, Тебриз, Иран.

1 Центр исследования стволовых клеток, Тебризский университет медицинских наук, Тебриз, Иран.

2 Исследовательский центр гематологии и онкологии, Тебризский университет медицинских наук, Тебриз, Иран.

3 Кафедра биохимии медицинского факультета Тебризского университета медицинских наук, Тебриз, Иран.

4 Кафедра анатомических наук, медицинский факультет Тебризского университета медицинских наук, Тебриз, Иран.

Поступила 13.05.2018 г .; Пересмотрено 17 июля 2018 г .; Принята в печать 19 июля 2018 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями Creative Commons Attribution (CC BY), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе, при условии ссылки на оригинальных авторов и источник. Никакого разрешения от авторов или издателей не требуется.

Эта статья цитируется в других статьях в PMC.

Abstract

Назначение: Применение мумие для лечения различных заболеваний, таких как переломы костей, кожные раны и воспаления суставов, рекомендовалось персидской традиционной медициной уже сто лет назад.В связи с заявлениями коренных народов и советами традиционной медицины по применению этого материала при заживлении переломов костей, это исследование было разработано для оценки того, может ли мумический материал способствовать дифференцировке мезенхимальных стволовых клеток в остеобласты и усиливать экспрессию костно-специфических гены и белки.

Методы: Стволовые клетки, полученные из жировой ткани (ASC) при четвертом пассаже клеток, делили на контрольную, группу остеогенеза (получавшую остеогенную среду), группу мумие (получавшую мумию в концентрации 500 мкг / мл).ASC в четвертой группе обрабатывали как остеогенной средой, так и мумие (500 мкг / мл). Клетки во всех группах собирали на 7, 14 и 21 день для дальнейшей оценки с помощью ОТ-ПЦР в реальном времени, окрашивания по фон Коссу, иммуноцитохимии и проточной цитометрии.

Результаты: Обработка ASC мумие в концентрации 500 мкг / мл повышает уровень экспрессии генов остеокальцина, RUNX-2 и β1-интегрина в разные моменты времени, но уровень экспрессии Osterix не изменился.Кроме того, экспрессия белка остеокальцина значительно увеличилась в ASC, обработанных мумие, обнаруженных с помощью иммуноцитохимии и методики проточной цитометрии, по сравнению с контрольными группами. Результаты этого исследования также показали, что обработка ИСС мумией приводила к образованию минеральных отложений, которые оценивали методом окрашивания по фон Коссу.

Заключение: Данные этого исследования показывают, что мумие является мощным усилителем дифференцировки ASC в остеобласты в системе in vitro, вероятно, за счет повышения уровня специфичных для кости генов и белков.

Ключевые слова: Остеобласты, стволовые клетки жировой ткани, дифференцировка, фактор транскрипции

Введение

Кость — это особый тип соединительной ткани, состоящий из двух разных клеток, называемых остеобластами и остеокластами. 1 Скоординированный баланс между активностями этих клеток отвечает за поддержание гомеостаза и ремоделирования кости. 2 Синтез органических компонентов костного матрикса приписывается остеобластам, в то время как резорбция кости происходит за счет активности остеокластов. 3 Нарушение этого точно регулируемого баланса может привести к заболеваниям костей, таким как остеопороз, который определяется как уменьшение костной массы. 4 Распространенность заболеваний костей увеличивается, отчасти из-за старения населения. С другой стороны, костные дефекты также могут возникать из-за травм, хирургических вмешательств, метастазов опухолей и нарушений обмена веществ, поэтому поиск эффективных терапевтических методов лечения костных дефектов имеет большое значение.

Недавно, in vitro, производство костных конструкций, полученных с помощью техники тканевой инженерии, было введено в качестве новой стратегии лечения заболеваний костей. 5 Успешная тканевая инженерия может быть достигнута за счет применения биоразлагаемых каркасов, засеянных соответствующими клетками, такими как мезенхимальные стволовые клетки или остеобласты. Мезенхимальные стволовые клетки — это мультипотентные и недифференцированные клетки, которые обладают потенциалом дифференцировки в различные клетки, включая хондроциты, адипоциты и остеобласты. 6 Эти клетки можно собирать из различных источников, таких как костный мозг, желе Уортона из пуповины, мышечной и жировой ткани. 7 Среди различных источников жировая ткань была представлена ​​в качестве подходящего кандидата из-за ее широкого распространения в организме, легкого доступа, меньшей заболеваемости и большого количества стволовых клеток, которые можно извлечь из нее. 8 Во время эмбрионального развития остеобласты происходят из мезенхимальных стволовых клеток. Остеогенная дифференцировка этих клеток регулируется различными специфическими факторами транскрипции, такими как остерикс и RUNX-2 (связанный с Runt фактор транскрипции-2). 4 Эти ключевые факторы модулируют приверженность мезенхимальных стволовых клеток остеобластам посредством экспрессии генов маркеров костной ткани, таких как щелочная фосфатаза (Alp), типа коллагена, остеокальцина и остеопонтина. 9-12

Как уже отмечалось ранее, в последние десятилетия инженерия костной ткани стала успешным методом лечения костных дефектов. 13 Для улучшения этих основанных на клетках терапевтических методов были применены факторы роста и цитокины для улучшения восстановления костей. 14,15 Несмотря на преимущества, учитывая высокую стоимость и быструю деградацию, клиническое применение этих факторов ограничено. 16 Следовательно, существует постоянная и срочная потребность в разработке альтернативных агентов с более высокой эффективностью, меньшими побочными эффектами и более низкой стоимостью. В последние десятилетия внимание исследователей переключилось на применение природных соединений, полученных из нескольких растений, с положительным эффектом на восстановление костей. 17 На протяжении сотен лет в традиционной персидской медицине мумию использовали в качестве целителя при различных заболеваниях, таких как переломы костей, воспаление суставов, кожные раны и язвы желудка. 18 Мумия, которую местные жители называют также Mumnaye, представляет собой темно-коричневый, полутвердый и похожий на смолу материал, который обнаруживается в некоторых трещинах редких пещер и выделяется из-за окисления нефти. 19 Химический анализ показал присутствие в этом материале кальция, фосфата, карбоната, магния, кислорода, азота, а также полисахарида. Клиническое исследование, проведенное Dehghan et al. (2012), показало, что мумие может улучшить процесс заживления переломов большеберцовой и бедренной кости и уменьшить осложнения. 18

Принимая во внимание вероятные эффекты мумие в ускорении заживления костей, о которых заявляют коренные люди, настоящее исследование было разработано для оценки того, может ли мумие усилить дифференцировку мезенхимальных стволовых клеток (ASC), полученных из жировой ткани, в остеобласты посредством экспрессии основных факторов транскрипции, таких как RUNX. -2 и остерикс, а также связанный с остеогенезом маркер остеокальцин.

Материалы и методы

Сбор жировой ткани и выделение мезенхимальных стволовых клеток

Образцы жировой ткани были взяты у пациентов, перенесших лапаротомию.Выделение мезенхимальных стволовых клеток из жировой ткани выполняли, как описано ранее Fathi et al. (2017). 20 После передачи в культуральную лабораторию образцы промывали аскетически с использованием фосфатно-солевого буфера (PBS), содержащего 1% пенициллин / стрептомицин (P / S), 3 раза. Механическое расщепление проводили путем измельчения образцов жировой ткани с помощью стерильного скальпеля с последующим ферментативным расщеплением. Путем инкубации образцов в коллагеназе типа I (0,2% в свободной DMEM) на каждый грамм при встряхивании на водяной бане в течение примерно 60-90 минут.После переваривания основных кусочков добавляли среду DMEM, содержащую 10% эмбриональной телячьей сыворотки (FBS), для нейтрализации активности фермента, а затем фильтровали через фильтр для клеток 70 мкм для выделения непереваренных частиц. Полученную суспензию клеток центрифугировали в течение 10 минут при 1500 об / мин, а затем клетки высевали при плотности 5 × 10 5 / T75 колб в 5% co 2 и 37 ° C. После достижения примерно 70% слияния клетки трипсинизировали. и расширился. Для этого исследования использовали стволовые клетки, полученные из жировой ткани (ASC) четвертого пассажа.

Приготовление мумие

Мумию купили на местных ботанических рынках в Керманшахе, Иран. В этом исследовании мумие использовали в концентрации 500 мкг / мл; Следует отметить, что выбор концентрации материала мумие был сделан на основе предыдущих оценок, проведенных нашей исследовательской группой. 21 Мумию можно полностью растворить в воде, поэтому ее растворяли в культуральной среде DMEM и затем пропускали через шприцевой фильтр (0,22 мкм) для стерилизации.

Дизайн исследования

Чтобы оценить, может ли мумие влиять на остеогенез в ASC, клетки на 4 -м пассаже были разделены на различные группы: контрольная (группа I), которая получала сыворотку DMEM (0/05% FBS), группа остеогенеза (группа II), которая лечила со средой для остеогенной индукции, содержащей базовую среду DMEM, 10 -7 моль дексаметазона (Sigma, кат.№ D8893, Германия), 10 ммоль β-глицерофосфата (сигма, кат. № 9422, Германия) и 50 мкмоль аскорбак-2-фосфата (сигма, кат. № A5960, Германия), ASC в третьей группе (группа III) были обрабатывали остеогенной средой и мумие в концентрации 500 мкг / мл, а в четвертой группе (группа IV) ASC получали мумие (500 мкг / мл). Клетки собирали на 7, 14 и 21 день для дальнейшей оценки с помощью ОТ-ПЦР в реальном времени, окрашивания по фон Коссу, иммуноцитохимии и проточной цитометрии.

Экспрессия генов с использованием метода полимеразной цепной реакции с обратной транскриптазой (ОТ-ПЦР) в реальном времени

Профиль экспрессии генов для Osterix, RUNX-2, остеокальцина и интегрина β-1 в различных группах определяли методом ОТ-ПЦР в реальном времени.

Для выполнения этого метода общую клеточную РНК экстрагировали с помощью мини-набора YTA (каталожный номер: YT9065, Тайвань) в соответствии с инструкциями. Вкратце лизис клеток проводили с использованием буфера RB, а затем смесь переносили в пробирку для сбора. После центрифугирования к каждому образцу добавляли 70% этанол. Затем к образцам добавляли свободную от РНКазы H 2 O для получения РНК. Приблизительно 1000 мкг / мл всей полученной РНК использовали для синтеза кДНК с использованием набора для обратной транскрипции (Takara, RR0371, Япония).На следующем этапе с использованием PCR Rotorgene 6000. (Corbett, 010755, Австралия) и мастер-микса SYBR Green PCR (Takara, RR20 L, Япония) были выполнены реакции RT-PCR в реальном времени. показывает различное время и температуру отжига для каждого гена.

Таблица 1

Последовательности праймеров, используемые в ОТ-ПЦР в реальном времени

9019 9019 9019 9019 9018 Метод окрашивания по фон Косса для оценки отложений минерализованной матрицы

Однослойные культивированные ASC окрашивали Von kossa для наблюдения за минерализованными отложениями. Для выполнения протокола окрашивания клетки в разных группах фиксировали этанолом, а затем промывали 3 раза дистиллированной водой (D / W).Затем проводили инкубацию с нитратом серебра с последующей инкубацией в 1% -ной пирогалевой кислоте в течение 5 минут. После отмывки D / W клетки фиксировали тиосульфатом натрия (5%) и, наконец, окрашивали ядерно-быстрым красным раствором (0/1%) для наблюдения за ядрами.

Метод иммуноцитохимического окрашивания

В общей сложности 200 × 10 3 клеток высевали на предметное стекло камеры для культивирования клеток с 8 лунками. Через один день культивирования клетки промывали PBS, а затем фиксировали в 4% параформальдегиде в течение 30 минут при комнатной температуре.После фиксации клетки дважды промывали PBS и один раз PBS и 3% FBS. Клетки инкубировали в течение ночи при 4ºC с разведением 1: 100 mAb против остеокальцина (антитело к остеокальцину человека / крысы MAB1419, R&D Systems, Великобритания) в PBS. Затем клетки промывали PBS и инкубировали с разведением 1: 500 конъюгированного с биотином мышиного моноклонального антитела IgG1 против крыс в PBS и 1% BSA в течение ночи. После промывания PBS добавляли разведение 1: 500 вторичного антитела (козий антимышиный IgG-PE, sc-3738, США) на 2 часа при 37 ° C.Клетки трижды промывали PBS и ядра окрашивали DAPI в течение 30 секунд. После трех промывок PBS флуоресцентные клетки визуализировали под флуоресцентным микроскопом. 22

Проточно-цитометрический анализ

Приблизительно 10 6 клеток дважды промывали PBS, содержащим 3% FBS (промывочный буфер), блокировали блокирующими реагентами, фиксировали буфером фиксации FCM и инкубировали с первичным антителом к ​​остеокальцину (антитело к остеокальцину человека / крысы MAB1419, R&D Systems, UK) в течение 30 минут на льду.После окончания времени инкубации клетки промывали промывочным буфером и инкубировали с PE-конъюгированным моноклональным антителом IgG1 против подагры против мыши в течение 30 минут на льду. hADSC снова промывали промывочным буфером и использовали систему FACSCalibur (BD Biosciences, Сан-Диего, Калифорния) для определения экспрессии белка остеокальцина по внутриклеточному окрашиванию. Данные были проанализированы с использованием программного обеспечения FlowJo (версия 6.2).

Статистический анализ

Статистическую разницу между разными группами определяли методом двухфакторного дисперсионного анализа (ANOVA) с последующим пост-тестом t-критерия.Результаты показаны как среднее значение ± стандартное отклонение типичного эксперимента, проведенного три раза. Показанные данные являются репрезентативными для трех независимых экспериментов.

Результаты

Влияние мумие на экспрессию генов в ASC, дифференцированных в остеобласты

Влияние мумие на дифференцировку ASC в остеобласты оценивали по экспрессии генов остеокальцина, RUNX-2 и остерикса, а также оценивали экспрессию гена интегрина β 1-, чтобы проверить, может ли мумие усиливать адгезию клетка-клетка и клеточный матрикс. что имеет решающее значение для выживания клеток.-A показывает уровень экспрессии фактора транскрипции RUNX-2, который играет решающую роль в регуляции развития костей. Как видно из этого рисунка, обработка ASC мумие в концентрации 500 мкг / мл (группа IV) приводила к значительному увеличению экспрессии RUNX-2 по сравнению с контрольными и индуцированными остеогенами клетками через 7 и 21 день культивирования, но не в 14 дней. Через 14 дней уровень экспрессии этого фактора транскрипции значительно увеличился в ASC, индуцированных остеогенной средой (группа II), а также в клетках, совместно обработанных остеогенной средой и мумие (500 мкг / мл) (группа III), по сравнению с контрольными клетками (P <0.001).

Влияние материала мумие на дифференцировку ASC в остеобласты оценивали с помощью ОТ-ПЦР в реальном времени. A) Экспрессия RUNX-2, B) Остерикс, C) Остеокальцин и D) β1-интегрин. После обработки ASC мумие уровень экспрессии RUNX-2 значительно увеличился на 7 и 21 дни по сравнению с контрольной группой, а также группами с остеогенезом. Экспрессия остеокальцина также значительно увеличилась через 7 и 14 дней лечения мумие по сравнению с контрольной группой.Кроме того, значительное увеличение уровня экспрессии гена β1-интегрина было обнаружено после обработки ASC материалом мумие на 7 и 21 день периода культивирования, но уровень экспрессии Osterix не оказал значительного влияния между различными группами. * P <0,01, ** P <0,001, *** P <0,0001 и *** P <0,00001

В этом исследовании также оценивали уровень экспрессии остерикса как важного маркера образования кости, чтобы выяснить, может ли обработка ASC мумией усилить его экспрессию.-B показывает, что нет никакого увеличения экспрессии остерикса в ASC, обработанных мумие или остеогенной средой, по сравнению с контрольной группой в разные моменты времени. Другим геном, экспрессия которого оценивалась в этом исследовании, был остеокальцин. -C показывает, что в присутствии мумие (500 мкг / мл) уровень экспрессии остеокальцина значительно увеличился по сравнению с контрольными группами на 7 и 14 день культивирования, но на 21 день никакого увеличения не было.

Уровень экспрессии β1-интегрина в разных группах в разные моменты времени показан на -D.Как можно понять, обработка ASC мумие приводила к значительному увеличению экспрессии β1-интегрина по сравнению с другими группами через 7 и 21 день периода культивирования, но не через 14 дней.

Световая микроскопия

Для оценки отложения минералов в различных группах после 7 дней культивирования использовали метод окрашивания по фон Коссу. Как видно из примера А, в контрольных клетках отложения кальция не наблюдалось. В отличие от контрольных ASC, клетки, которые получали среду для остеогенеза (группа II) или индуцировали остеогенной средой и обрабатывали синхронно с мумие в концентрации 500 мкг / мл (группа III), были окрашены положительно на отложение кальция (B и C).-D показывает отложение минералов в ASC, обработанных мумией (группа IV), поскольку можно понять, что сильные отложения кальция были обнаружены в ASC, обработанных мумией в концентрации 500 мкг / мл.

Метод окрашивания Фон Коссы для исследования отложения кальция в различных группах. A) Контрольные клетки, B) Среда для остеогенной дифференцировки, C) среда для остеогенной дифференцировки и мумие, и D) клетки, обработанные мумией. В необработанной (контрольной) группе отложения кальция не наблюдали, но сильное отложение кальция можно увидеть в клетках, обработанных остеогенной средой (B), а также в клетках, которым вводили мумие (D).400x

Определение белка остеокальцина методами иммуноцитохимии и проточной цитометрии

Как показано на фиг.2, иммунофлуоресцентное окрашивание ADSC в присутствии другой культуральной среды продемонстрировало, что большинство клеток были положительными по маркерам остеокальцина в группе II (обработанной средой для остеогенной дифференцировки), III (получавшей как среду для остеогенной дифференцировки, так и мумие) и IV (обработанные мумие 500 мкг / мл) по сравнению с группой I (контрольные клетки).Кроме того, влияние мумие на остеогенную дифференцировку ADSC было выполнено с помощью проточной цитометрии для определения экспрессии белка остеокальцина, а также методом иммуноцитохимии. Графики проточной цитометрии () показали, что 83,7%, 69,7% и 88,9% ADSC экспрессировали остеокальцин в группе II (среда для остеогенной дифференцировки), III (среда для остеогенной дифференцировки + мумие) и IV (мумие), соответственно. Однако значение p не было значимым между группами.

Иммунофлуоресцентное окрашивание для экспрессии остеокальцина как внутриклеточного маркера мезенхимальных стволовых клеток жировой ткани (ADSC) в присутствии другой культуральной среды; (A) культуральная среда DMEM, (B) среда для остеогенной дифференцировки, (C) среда для остеогенной дифференцировки + мумие, (D) мумие, растворенное в DMEM (500 мкг / мл).По окончании 7-дневной обработки каждой культуральной средой ADSC метили, используя PE-конъюгированные анти-остеокальциновые (красные) антитела; ядра окрашивали в синий цвет с помощью 4 ‘, 6-диамидино-2-фенилиндола (DAPI)

. Экспрессия внутриклеточного маркера остеокальцина ADSC, как анализировали с помощью проточной цитометрии. ADSC обрабатывали грязью различных культур в течение 7 дней перед анализом проточной цитометрии; (A) среда для остеогенной дифференцировки, (B) среда для остеогенной дифференцировки + мумие, (C) мумие; Каждое антитело тестировали индивидуально, и контрольные изотопы использовали в качестве отрицательного контроля (красные линии) в этом эксперименте.(D) Диаграмма для сравнения между группами. Односторонний дисперсионный анализ с последующим апостериорным тестом Даннета использовался для определения значимой разницы между группами; значение p не было значимым между группами

Обсуждение

В настоящем исследовании мы изучили, может ли мумие усиливать дифференцировку ASC в остеобласты. Результат этого исследования показал, что: Обработка ИСС мумией в дозе 500 мкг / мл увеличивала уровень экспрессии RUNX-2, остеокальцина и β1-интегрина в разные моменты времени, в присутствии мумие — экспрессия белка остеокальцина, обнаруженная с помощью Методика иммуноцитохимии была расширена, и обработка ASC мумией (500 мкг / мл) приводила к образованию минеральных отложений, которые определялись с использованием протокола окрашивания по фон Коссу.

Недавно технология инженерии костной ткани на основе клеток стала новым терапевтическим методом реконструкции костей. 23 За успешную тканевую инженерию в этой области, направленную на поиск идеального источника клеток. 24 Идентификация мезенхимальных стволовых клеток (МСК) открыла новые рубежи в подходах к инженерии скелетных тканей. Полученные из жировой ткани мезенхимальные стволовые клетки (ASC) с потенциалом дифференцировки в хондроциты, адипоциты и остеобласты вводятся в качестве подходящего кандидата для методов регенерации костей. 23 Еще одним фактором усиления регенерации кости и стимулирования дифференцировки МСК в остеобласты является использование анаболических факторов роста. 14 Несмотря на множество преимуществ, применение этого фактора для подходов к тканевой инженерии имеет свои ограничения, такие как производственные затраты и короткий период полураспада, поэтому очень важно найти другие усилители с большей эффективностью и меньшей стоимостью.

В большинстве азиатских стран применение продуктов на натуральной основе имеет большие перспективы для лечения различных заболеваний, таких как деформации и переломы костей. 25 На протяжении сотен лет мумию рекомендуют для лечения переломов костей в традиционной персидской медицине. Из-за неясных механизмов, лежащих в основе этого материала при заживлении переломов, мы разработали это исследование, чтобы выяснить, может ли мумие усилить дифференцировку мезенхимальных стволовых клеток в остеобласты за счет активации определенных факторов транскрипции кости и компонентов внеклеточного матрикса.

В этом исследовании мы поняли, что обработка ASC мумие в концентрации 500 мкг / мл приводила к значительному увеличению уровня экспрессии RUNX-2, остеокальцина и β1-интегрина, но уровень остерикса не изменился.

Связанный с Runt фактор транскрипции 2 (RUNX-2) является ключевым фактором транскрипции, который регулирует дифференциацию остеобластов от мезенхимальных стволовых клеток, а также контролирует экспрессию белков костного внеклеточного матрикса во время остеогенеза. 26 Этот фактор транскрипции играет решающую роль как во внутримембранной, так и в эндохондральной оссификации, и потеря его функции приводит к серьезным деформациям скелета. 27 Это знание о важности RUNX-2 привело нас к исследованию, может ли материал мумий изменять экспрессию этого фактора транскрипции в ASC.Фактически мы обнаружили, что мумие в концентрации 500 мкг / мл может значительно стимулировать экспрессию гена RUNX-2 на 7 и 21 день. Эти находки предполагают возможное участие передачи сигналов RUNX-2 в дифференцировке остеобластов от ASC в присутствии материала мумие.

Другой фактор транскрипции, участвующий в формировании костей, — остерикс. 28 Этот фактор транскрипции играет важную роль в дифференцировке предшественников остеобластов в зрелые клетки и, кроме того, экспрессируется во время восстановления участков перелома костей.В этом исследовании мы исследовали, может ли обработка ASC мумие способствовать уровню экспрессии мРНК остерикса.

Полученные данные показали, что в оцененные моменты времени уровень гена остерикса снизился по сравнению с контрольными клетками.

Кроме того, в этом исследовании мы обнаружили, что в присутствии мумие уровень экспрессии мРНК остеокальцина и β1-интегрина значительно увеличивался по сравнению с контрольной группой и группами, индуцированными остеогенами. Кроме того, используя метод ICC, мы обнаружили, что экспрессия белка остеокальцина в ASC, обработанных мумие, повышена по сравнению с другими группами.

Остеокальцин — это самый распространенный гликопротеин внеклеточного матрикса кости, который может связываться с ионами кальция. 29,30 Этот белок продуцируется остеобластами, одонтобластами и гипертрофическими хондроцитами. Остеокальцин, играющий роль в регуляции минерализации костного матрикса, используется в качестве маркера для оценки активности остеобластов.

Более того, мы поняли, что мумие может значительно увеличить уровень экспрессии гена β1-интегрина по сравнению с другими группами. Этот трансмембранный белок опосредует межклеточные взаимодействия и межклеточный матрикс, а также участвует в поддержании клеточного фенотипа.Кроме того, сообщалось, что молекулы интегрина участвуют в регуляции синтеза коллагена I типа.

В совокупности результаты этого исследования показали, что материал мумие может повышать уровень экспрессии мРНК RUNX-2, остеокальцина и β1-интегрина в ASC. Необходимы более обширные исследования для лучшего понимания механизмов, лежащих в основе этого материала в дифференцировке ASC в остеобласты.

Заключение

Таким образом, результаты этого исследования впервые показали, что обработка ASC материалом мумие может повысить уровень экспрессии костно-специфических маркеров и способствовать отложению минеральных компонентов ASC.Необходимы дальнейшие исследования для лучшего понимания точных механизмов этого материала на внутриклеточных сигнальных путях в стволовых клетках, полученных из жировой ткани.

Благодарности

Эта статья является результатом исследовательского предложения, которое привело к диссертации Марьям Эйвази, студентки магистратуры анатомических наук, и одобрено Исследовательским центром стволовых клеток Тебризского университета медицинских наук, Тебриз, Иран. Авторы выражают благодарность научному сотруднику Тебризского университета медицинских наук за финансовую поддержку.

Этические вопросы

Письменное согласие было получено от всех пациентов, а протокол исследования был одобрен комитетом по медицинской этике Тебризского университета медицинских наук (этический номер: IR.TBZMED.REC.1395.229).

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Справочные материалы

1. Чжан Дж. Ф., Ли Дж., Чан Ц.Й., Мэн Ц.Л., Линь М.С., Чен Ю.С. и другие. Флавоноиды herba epimedii регулируют остеогенез мезенхимальных стволовых клеток человека через сигнальный путь BMP и wnt / β-катенин.Mol Cell Endocrinol. 2010. 314 (1): 70–4. DOI: 10.1016 / j.mce.2009.08.012. [PubMed] [CrossRef] [Google Scholar] 2. Choi YH, Han Y, Jin SW, Lee GH, Kim GS, Lee DY. и другие. Псевдошиконин i усиливает дифференцировку остеобластов, стимулируя runx2 и osterix. J Cell Biochem. 2018; 119 (1): 748–57. DOI: 10.1002 / jcb.26238. [PubMed] [CrossRef] [Google Scholar] 3. Чой Й.Х., Ким Г.С., Чой Дж.Х., Джин С.В., Ким Х.Г., Хан Й. и др. Этаноловый экстракт lithospermum erythrorhizon sieb. Et zucc. Способствует остеобластогенезу за счет регуляции runx2 и osterix.Int J Mol Med. 2016; 38 (2): 610–8. DOI: 10.3892 / ijmm.2016.2655. [PubMed] [CrossRef] [Google Scholar] 4. Ли СН, Хуан Ю.Л., Ляо Дж.Ф., Чиу В.Ф. Угонин k способствует дифференцировке и минерализации остеобластов за счет активации опосредованной p38 mapk и erk экспрессии runx2 и osterix. Eur J Pharmacol. 2011; 668 (3): 383–9. DOI: 10.1016 / j.ejphar.2011.06.059. [PubMed] [CrossRef] [Google Scholar] 5. Csaki C, Matis U, Mobasheri A, Shakibaei M. Совместное культивирование мезенхимальных стволовых клеток собак с первичными костными остеобластами способствует остеогенной дифференцировке.Histochem Cell Biol. 2009. 131 (2): 251–66. DOI: 10.1007 / s00418-008-0524-6. [PubMed] [CrossRef] [Google Scholar] 6. Цю XM, Ван L, Гуй YY, Xu YP, Li DJ. Bsnxd модулирует дифференцировку мезенхимальных стволовых клеток в остеобласты в модели мышей с остеопорозом в постменопаузе. Int J Clin Exp Pathol. 2015; 8 (5): 4408–17. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Hassan Famian M, Montazer Saheb S, Montaseri A. Кондиционированная среда стволовых клеток, полученных из желе Уортона, может усилить экспрессию хрящевых генов хондроцитами в монослойных системах и системах массовой культуры.Adv Pharm Bull. 2017; 7 (1): 123–30. DOI: 10.15171 / apb.2017.016. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 8. Kasir R, Vernekar VN, Laurencin CT. Регенеративная инженерия хряща с использованием стволовых клеток, полученных из жировой ткани. Regen Eng Transl Med. 2015; 1 (1): 42–9. DOI: 10.1007 / s40883-015-0005-0. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Диркс Н., Ван Хул М., Маес С. Рекрутирование остеобластов в места формирования кости при развитии скелета, гомеостазе и регенерации. Врожденные дефекты Res C Embryo Today.2013. 99 (3): 170–91. DOI: 10.1002 / bdrc.21047. [PubMed] [CrossRef] [Google Scholar] 10. Fu H, Doll B, McNelis T, Hollinger JO. Остерикс способствует дифференцировке остеобластов in vitro и in vivo. J Biomed Mater Res A. 2007; 83 (3): 770–8. DOI: 10.1002 / jbm.a.31356. [PubMed] [CrossRef] [Google Scholar] 11. Ченг А., Женевер П.Г. Sox9 определяет трансактивность runx2, управляя внутриклеточной деградацией. J Bone Miner Res. 2010. 25 (12): 2680–9. DOI: 10.1002 / jbmr.174. [PubMed] [CrossRef] [Google Scholar] 12. Штейн Г.С., Лиан Дж. Б., ван Вийнен А. Дж., Стейн Дж. Л., Монтесино М., Джавед А.и другие. Runx2 контроль организации, сборки и активности регуляторного механизма экспрессии скелетных генов. Онкоген. 2004. 23 (24): 4315–29. DOI: 10.1038 / sj.onc.1207676. [PubMed] [CrossRef] [Google Scholar] 13. Доусон Дж., Канцлер Дж., Таре Р., Кассем М., Ореффо РО. Краткий обзор: Преодоление разрыва: регенерация костей с использованием стратегий на основе скелетных стволовых клеток — где мы сейчас находимся? Стволовые клетки. 2014; 32 (1): 35–44. DOI: 10.1002 / стержень.1559. [PubMed] [CrossRef] [Google Scholar] 14. У И, Ся Л, Чжоу И, Сюй И, Цзян Х.Икариин индуцирует остеогенную дифференцировку мезенхимальных стволовых клеток костей mapk-зависимым образом. Cell Prolif. 2015. 48 (3): 375–84. DOI: 10.1111 / cpr.12185. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Zhao J, Ohba S, Shinkai M, Chung UI, Nagamune T. Икариин индуцирует остеогенную дифференцировку in vitro в зависимости от bmp и runx2. Biochem Biophys Res Commun. 2008. 369 (2): 444–8. DOI: 10.1016 / j.bbrc.2008.02.054. [PubMed] [CrossRef] [Google Scholar] 16. Чжао Б., Катагири Т., Тойода Х, Такада Т., Янаи Т., Фукуда Т.и другие. Гепарин усиливает эктопическое образование кости in vivo, индуцированное костным морфогенетическим белком-2. J Biol Chem. 2006. 281 (32): 23246–53. DOI: 10.1074 / jbc.M511039200. [PubMed] [CrossRef] [Google Scholar] 17. Ян И, Чин А, Чжан Л., Лу Дж, Вонг Р. Роль традиционных китайских лекарств в остеогенезе и ангиогенезе. Phytother Res. 2014; 28 (1): 1–8. DOI: 10.1002 / ptr.4959. [PubMed] [CrossRef] [Google Scholar] 18. Дехган М, Фарадонбе А.С. Влияние мумие на заживление переломов костей. Afr J Pharm Pharmaco.2012; 6 (5): 305–9. DOI: 10.5897 / AJPP11.353. [CrossRef] [Google Scholar] 19. Абшенас Дж., Хейрандиш Р., Заработная плата АР. Гастропротекторный эффект мумие при индуцированной язве желудка у крыс. Сравнительный Clin Pathol. 2014; 23 (2): 305–9. DOI: 10.1007 / s00580-012-1610-7. [CrossRef] [Google Scholar] 20. Fathi E, Farahzadi R, Charoudeh HN. L-карнитин способствует усилению нейрогенеза мезенхимальных стволовых клеток через wnt / бета-катенин и путь PKA. Exp Biol Med (Maywood) 2017; 242 (5): 482–6. DOI: 10.1177 / 1535370216685432.[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Sabetkam S, Soleimani Rad J, Hassan pour Khodaie S, Maleki M, Roshangar L. Влияние мумие на пролиферацию и миграцию стволовых клеток и фибробластов, полученных из желе человека, стволовых клеток и фибробластов в системе культивирования in vitro. Полумесяц J Med Biol Sci. 2018; 5 (3): 233–40. [Google Scholar] 22. Farahzadi R, Fathi E, Mesbah-Namin SA, Zarghami N. Сульфат цинка способствует увеличению длины теломер за счет увеличения экспрессии гена теломеразы, активности теломеразы и изменения статуса метилирования островков cpg промотора гена tert мезенхимальных стволовых клеток, полученных из жировой ткани человека.PLoS One. 2017; 12 (11): e0188052. DOI: 10.1371 / journal.pone.0188052. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Рада Т., Рейс Р.Л., Гомес М.Э. Стволовые клетки из жировой ткани и их применение в инженерии костной и хрящевой ткани. Tissue Eng Часть B Ред. 2009; 15 (2): 113–25. DOI: 10.1089 / ten.teb.2008.0423. [PubMed] [CrossRef] [Google Scholar] 24. Эль Тамер МК, Рейс Р.Л. Клетки-предшественники и стволовые клетки для регенерации костей и хрящей. J Tissue Eng Regen Med. 2009. 3 (5): 327–37. DOI: 10.1002 / термин.173. [PubMed] [CrossRef] [Google Scholar] 25. Zhang P, Dai KR, Yan SG, Yan WQ, Zhang C, Chen DQ. и другие. Влияние нарингина на пролиферацию и остеогенную дифференцировку мезенхимальных стволовых клеток кости человека. Eur J Pharmacol. 2009. 607 (1-3): 1–5. [PubMed] [Google Scholar] 26. Комори Т. Регуляция развития костей и генов белков внеклеточного матрикса с помощью runx2. Cell Tissue Res. 2010. 339 (1): 189–95. DOI: 10.1007 / s00441-009-0832-8. [PubMed] [CrossRef] [Google Scholar] 27. Jeong HM, Han EH, Jin YH, Choi YH, Lee KY, Jeong HG.Ксантохумол из растения хмеля стимулирует дифференцировку остеобластов за счет активации runx2. Biochem Biophys Res Commun. 2011. 409 (1): 82–9. DOI: 10.1016 / j.bbrc.2011.04.113. [PubMed] [CrossRef] [Google Scholar] 29. Ducy P, Karsenty G. Два различных остеобласт-специфичных цис-действующих элемента контролируют экспрессию гена остеокальцина мыши. Mol Cell Biol. 1995. 15 (4): 1858–69. [Бесплатная статья PMC] [PubMed] [Google Scholar] 30. Бересфорд Дж. Н., Галлахер Дж. А., Позер Дж. В., Рассел Р. Г.. Производство остеокальцина костными клетками человека in vitro.Эффекты 1,25 (oh) 2d3, 24,25 (oh) 2d3, паратироидный гормон и глюкокортикоиды. Metab Bone Dis Relat Res. 1984. 5 (5): 229–34. DOI: 10.1016 / 0221-8747 (84) -X. [PubMed] [CrossRef] [Google Scholar]

Семь священных масел — 𓁧 Блуждающие звезды

1- Слова Владыки Двух Земель Мен-Маат-Ра, одаренного жизнью, что дух Гора радуйтесь

2- приближению глаза Гора, тела его; can

3- сердце Амона-Ра, живущего в замке Мен-Маат-Ра, радоваться приближению глаза, его глаз

4- его тела, можешь ли ты расти во имя твоего

5- Wadjet , его аромат вам приятен в этом названии

6- приятный аромат Амона-Ра.Я пришел позаботиться о ваших глазах

7- используя масло Madjet и ваши духи. Возьмите себе Око Гора и свои духи; слова, чтобы сказать

8-царь Мен-Маат-Ра | наделенный жизнью, о Амон-Ра, живущий в замке Мен-Маат-Ра, я завершаю

9- для вас Око Гора и масло Madjet , (не) без его масла Hekenu на вашем лицо, ни масло Sefet . Слова, которые произнесет сын Ре, Сети Мерен-Птах, как и Ре, о Амун-Ра, который живет в замке Мен-Маат-Ра, возьмите для себя Око Гора, которое является наказанием Сета на ее

10- Масло Нехенем , слова, чтобы сказать король Мен-Маат-Ре, о Амун-Ра, который живет в замке Мен-Маат-Ре, возьми для себя Око Гора с Мадджет маслом и маслом Туат , слова сына Ре, Сети Мерен-Птаха | О Амон-Ра, живущий в замке Мен-Маат-Ра, возьми для себя Око Гора, которое он принес и из которого он окликнул

11- Боги в нем, Кедровое масло .Слова короля (Мен-Маат-Ре) | О Амон-Ре, живущий в замке Мен-Маат-Ра, возьми себе Око Гора, которое ты схватил перед собой: Ладанум , Слова, которые произнесет сын Ре (Сетхи, возлюбленный Птаха) | как Ре, о Амун-Ра, который обитает в замке Мен-Маат-Ра, возьмите для себя Око Гора

12 — вы завершили его, масло Моринга , Ладанум . Слова короля Мен-Маат-Ре | О Амон-Ре, обитающий в замке Мен-Маат-Ра, прими для себя Око Гора, небосвод Сета находится под ним, никакой небосвод не против тебя.Слова сына Ре, Сети Мерен-Птаха, | как Ре, о твоя мазь, твоя мазь

13- Он там на лбу Гора, он на лбу Гора, вы помещаете его на лоб Амона-Ра, который живет в замке Мен-Маат- Ра, я делаю его приятным с ним, я прославляю его вместе с тобой, давая его силу в его теле, давая

14 — его страх через два глаза всех умов, когда ты видишь их, ты слышишь их всех, его имя конечно, Амон-Ра, твой глаз заполнен маслом Мадджета, твоя голова заполнена маслом Мадджет , что на лбу Гора,

15 — оно разрушено благодаря ему, оно разрушает благодаря богу, духи приятны для тебя, твоя голова в раю благодаря тому, что на лбу Гора, Гор пришел, полный пота, целовавшись

16- для него его отец Осирис, он нашел его рядом с собой в Гээсти, Осирис завершил это Осознав его рождение, о Амон-Ра, пришедший к тебе, ты станешь стабильным, когда завершишь с Madjet oi l, который вышел из глаза Гора, чтобы мы заполняли то, что в нем,

17 — ваши кости собраны вместе, ваши конечности собраны, ваша плоть собрана, ваше настроение удалено, зло на земле, когда вас схватили для вас его аромат, который делает приятным его аромат, который для вас, как Ра, когда он выходит из-за горизонта, милость богов горизонта, которые против вас, о Амон-Ра, аромат

18- Глаз Гора, который обращен к вам, милость следующего божества Осириса обращена к вам, когда вы захватываете большую корону, которую вы предусмотрели для того, что делает Осирис, вы преуспеваете в благотворных словах, потому что Хорус, повелитель человечества, установил это .Это масло Гора, это ваше масло

19 — Сет, место, где Гор заставил его быть захваченным своим врагом, Сет скрывает, кто он, Гор наполнил его, оборудовав свою статую, повредив глаз Гору, его запах для вас , он борется с вашим гневом против вашего врага, О масло Амона-Ра

Мумический материал может способствовать дифференцировке полученных из жировой ткани стволовых клеток в остеобласты за счет усиления экспрессии костно-специфических факторов транскрипции

| 463

Мумия способствует остеогенной дифференциации ИСС

Advanced Pharmaceutical Bulletin, 2018, 8 (3), 457-464

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1. Zhang JF, Li G, Chan CY, Meng CL, Lin MC, Chen

YC, et al.

Флавоноиды herba epimedii регулируют остеогенез мезенхимальных стволовых клеток человека

посредством пути передачи сигналов BMP и wnt / β-катенина.

Эндокринол клеток Mol 2010; 314 (1): 70-4. DOI:

10.1016 / j.mce.2009.08.012

2. Чой Й.Х., Хан И, Джин С.В., Ли Г.Х., Ким Г.С., Ли Д.Й.,

и др. Псевдошиконин i усиливает дифференцировку остеобластов

, стимулируя runx2 и остерикс.J

Cell Biochem 2018; 119 (1): 748-57. DOI:

10.1002 / jcb.26238

3. Чой Й.Х., Ким Г.С., Чой Дж.Х., Джин С.В., Ким Х.Г., Хан Й.,

и др. Этаноловый экстракт lithospermum erythrorhizon

sieb. Et zucc. Способствует остеобластогенезу посредством регуляции runx2 и osterix. Int J Mol Med

2016; 38 (2): 610-8. DOI: 10.3892 / ijmm.2016.2655

4. Ли Ч., Хуан Ю.Л., Ляо Д.Ф., Чиу В.Ф. Угонин k

способствует дифференцировке остеобластов и минерализации

путем активации экспрессии runx2 и osterix, опосредованной p38 mapk- и erk-

.Eur J

Pharmacol 2011; 668 (3): 383-9. doi:

10.1016 / j.ejphar.2011.06.059

5. Csaki C, Matis U, Mobasheri A, Shakibaei M. Co-

Культура мезенхимальных стволовых клеток собак с

первичными костными остеобластами способствует развитию

остеогенная дифференциация. Histochem Cell Biol

2009; 131 (2): 251-66. DOI: 10.1007 / s00418-008-

0524-6

6. Цю XM, Ван Л., Гуй YY, Сюй Ю.П., Ли DJ.Bsnxd

модулирует дифференцировку мезенхимальных стволовых клеток

в остеобласты в модели мышей

с остеопорозом в постменопаузе. Int J Clin Exp Pathol 2015; 8 (5): 4408-

17.

7. Hassan Famian M, Montazer Saheb S, Montaseri A.

Кондиционированная среда стволовых клеток, полученных из желе Уортона

, может усиливать специфичность хряща. экспрессия генов

хондроцитами в монослое и массовых системах культивирования

.Adv Pharm Bull 2017; 7 (1): 123-30.

doi: 10.15171 / apb.2017.016

8. Касир Р., Вернекар В.Н., Лауренсин СТ. Регенеративная

инженерия хряща с использованием стволовых клеток из жировой ткани

. Regen Eng Transl Med 2015; 1 (1): 42-9. doi:

10.1007 / s40883-015-0005-0

9. Dirckx N, Van Hul M, Maes C. Рекрутирование остеобластов

в места формирования кости при развитии скелета,

гомеостаз и регенерация.Врожденные дефекты Res C

Embryo Today 2013; 99 (3): 170-91. DOI:

10.1002 / bdrc.21047

10. Fu H, Doll B, McNelis T, Hollinger JO. Остеобласт

дифференцировке in vitro и in vivo способствует

остерикс. J Biomed Mater Res A 2007; 83 (3): 770-8.

doi: 10.1002 / jbm.a.31356

11. Cheng A, Genever PG. Sox9 определяет трансактивность runx2

, управляя внутриклеточной деградацией. J

Bone Miner Res 2010; 25 (12): 2680-9.DOI:

10.1002 / jbmr.174

12. Стейн Г.С., Лиан Дж. Б., ван Вийнен А. Дж., Стейн Дж. Л.,

Монтесино М., Джавед А. и др. Runx2 контроль

организации, сборки и активности регуляторного механизма

для экспрессии скелетных генов. Онкоген

2004; 23 (24): 4315-29. DOI: 10.1038 / sj.onc.1207676

13. Доусон Дж. И., Канцлер Дж., Таре Р., Кассем М., Ореффо

РО. Краткий обзор: Преодоление разрыва: регенерация кости

с использованием стратегий на основе скелетных стволовых клеток

— где мы сейчас? Стволовые клетки 2014; 32 (1): 35-44.

doi: 10.1002 / stem.1559

14. Wu Y, Xia L, Zhou Y, Xu Y, Jiang X. Икариин индуцирует

остеогенную дифференцировку костных мезенхимальных

стволовых клеток в зависимости от mapk. Cell Prolif

2015; 48 (3): 375-84. doi: 10.1111 / cpr.12185

15. Zhao J, Ohba S, Shinkai M, Chung UI, Nagamune T.

Икариин индуцирует остеогенную дифференцировку in vitro в

bmp- и runx2-зависимым образом. Biochem

Biophys Res Commun 2008; 369 (2): 444-8.DOI:

10.1016 / j.bbrc.2008.02.054

16. Чжао Б., Катагири Т., Тойода Х, Такада Т., Янаи Т.,

Фукуда Т. и др. Гепарин потенцирует образование эктопической кости in vivo

, индуцированное морфогенетическим белком-2 кости

. J Biol Chem

2006; 281 (32): 23246-53. DOI:

10.1074 / jbc.M511039200

17. Ян Й, Чин А, Чжан Л., Лу Дж, Вонг Р. Роль

традиционных китайских лекарств в остеогенезе и

ангиогенезе.Phytother Res 2014; 28 (1): 1-8. DOI:

10.1002 / ptr.4959

18. Дехган М., Фарадонбе А.С. Влияние мумие

на заживление переломов костей. Afr J Pharm

Pharmaco 2012; 6 (5): 305-9. DOI:

10.5897 / AJPP11.353

19. Абшенас Дж., Хейрандиш Р., Заработная плата AR.

Гастропротекторное действие мумие на индуцированную

язву желудка у крыс. Сравнительный клинический анализ Clin Pathol

2014; 23 (2): 305-9.DOI: 10.1007 / s00580-012-1610-7

20. Fathi E, Farahzadi R, Charoudeh HN. L-карнитин

способствует усилению нейрогенеза из

мезенхимальных стволовых клеток через wnt / бета-катенин

и путь PKA. Exp Biol Med (Maywood)

2017; 242 (5): 482-6. doi:

10.1177 / 1535370216685432

21. Sabetkam S, Soleimani Rad J, Hassan pour Khodaie

S, Maleki M, Roshangar L. Влияние вещества мумие

elly на размножение и миграцию человеческого стебля

, полученного из джунглей. клетки и фибробласты в системе культивирования

vitro.Crescent J Med Biol Sci

2018; 5 (3): 233-40.

22. Farahzadi R, Fathi E, Mesbah-Namin SA, Zarghami

N. Сульфат цинка способствует увеличению длины теломер

за счет увеличения экспрессии гена теломеразы

, активности теломеразы и изменения промотора гена tert

cpg статус островкового метилирования

мезенхимальных стволовых клеток человека, полученных из жировой ткани.

PLoS One 2017; 12 (11): e0188052.doi:

10.1371 / journal.pone.0188052

Черника (Vaccinium corymbosum) — ягода мумие | Справочники по борьбе с вредителями на северо-западе Тихоокеанского региона

См .:

Чувствительность сорта голубики

Причина Гриб Monilinia Vacinii-corymbosi зимует в мумифицированных плодах (псевдосклеротиях) на земле. Мумии могут жить минимум 2 года, а может и больше. Часто мумифицированный плод оказывается зажатым между стеблями одного куста у земли.Мумии нуждаются в охлаждении на много часов при температуре ниже 45 ° F. Ранней весной, когда температура поднимается выше 45 ° F, примерно в то время, когда начинают распадаться цветочные и вегетативные почки, из зимующих мумий на поверхности почвы или рядом с ней вырастают грибковые плодовые чашечки (апотеции). Апотеции созревают в среднем в течение 17 дней, но может варьироваться от 8 до 28 дней. Многие апотеции могут появиться только из одной мумии. Температура почвы, влажность почвы и солнечная радиация были определены как наиболее важные факторы, влияющие на высвобождение аскоспор в PNW.

Аскоспоры (первичный инокулят) апотеций разносятся ветром на 100 футов или более и заражают цветы и листья вскоре после раскрытия бутонов. Споры второго типа (конидии или вторичный инокулят) образуются примерно через 3 недели на пораженных цветках и побегах. Эти споры разносятся ветром, дождем и различными насекомыми-опылителями к здоровым цветкам. Цветы наиболее восприимчивы, когда они распускаются, и инфекции приводят к симптомам мумие. Уже опыленные цветы менее подвержены заражению.

Потенциал потери выше для первичного заражения, потому что одно заражение может привести к поражению всех цветов одного куста. Потери от вторичного заражения также могут быть значительными, но потенциальные потери меньше, поскольку от каждого заражения теряется только одна ягода.

Зараженные спорулирующие побеги становятся светоотражающими, ароматными и выделяют сахар, привлекающий насекомых-опылителей. Затем насекомые перемещают конидии с зараженных побегов на здоровые цветы, увеличивая количество зараженных ягод.

Все виды Vaccinium инфицированы видами Monilinia, вызывающими у каждого мумиеподобное заболевание. Однако каждый вид является узкоспециализированным по отношению к своему хозяину и поэтому не может вызывать болезнь у других хозяев. Например, виды грибов, поражающие чернику красную, не могут атаковать чернику высокорослую, и наоборот.

Сорта голубики Bluejay, Bluetta и Olympia считаются устойчивыми к обеим фазам болезни, в то время как сорта Blueray, Berkeley, Earliblue и Northland считаются очень восприимчивыми.

Симптомы Зараженные цветы буреют и вянут, как если бы они были заморожены. Стебли и побеги становятся темно-коричневыми с некрозом, переходящим на черешки листьев и немного в основание листовых пластинок. Побеги быстро разрушаются и вскоре погибают. Примерно через 3 недели после первичного заражения на пораженных стеблях и листьях цветков появляется коричневато-серая масса спор.

При раннем развитии ягод больные плоды выглядят как здоровые; если разрезать; однако в плодолистиках можно увидеть губчатый белый грибок.По мере того, как ягоды достигают зрелости, зараженные ягоды приобретают красновато-коричневый или коричневый цвет в отличие от восково-зеленого цвета здоровых фруктов. Многие больные ягоды опадают до того, как будут собраны здоровые ягоды. Зрелые мумифицированные ягоды серые, сморщенные, твердые.

Apothecia можно найти под кустами, где остатки листьев или мульча оставлены нетронутыми. Весной, перед цветением, из мумий выходят апотеции в форме урны, от светло-коричневого до коричневого цвета. Кончик стебля темнее и со временем расширяется до чашеобразной структуры 0.От 1 до 0,4 дюйма в ширину.

Контроль посевов Тактику контроля, применяемую к почве, возможно, придется часто повторять, поскольку апотеции развиваются и созревают в течение нескольких недель.

  • Осенью, до опадания листьев, неглубоко культивируйте, чтобы закопать мумии. Исследования, проведенные в Джорджии, показывают, что закапывание мумий на глубину 1 дюйма или более препятствовало тому, чтобы апотеции достигли поверхности.
  • Двухдюймовый слой опилок дугласовой пихты, применяемый в любое время в период покоя, предотвращает появление апотециалов весной.
  • Ранней весной между распусканием почек и цветением уничтожьте развивающиеся апотеции, взорвав почву под растениями и / или в переулках, сгребая или обрабатывая почву. Некоторые гроверы собирают землю между рядами у основания кустов и между кустами, чтобы закопать мумии. Они сгребают почву обратно в рядки позже весной, когда апотеции уйдут. Другие производители тянут цепи по земле, чтобы помешать развитию апотеций. Также может быть полезно пламя.
  • Соберите и уничтожьте мумифицированные фрукты с кустов, прежде чем они упадут на землю.Эта практика может занять несколько лет, прежде чем можно будет получить выгоду.
  • Перед перемещением на новое поле удалите и уничтожьте растительный мусор, который скапливается на комбайнах.
  • Также весной уничтожьте все кучи отбраковки возле упаковочных цехов.
  • Сорта устойчивые к растениям. Выберите подходящие сорта с перекрестным опылением с синхронизированными периодами цветения, чтобы опыление могло происходить быстро.
  • Удалите восприимчивые сорта, такие как Беркли, из смешанных посадок.
  • Хорошая борьба с сорняками способствует культурным мероприятиям.

Органический контроль С помощью органических методов борьбы с мумие сложно. Материалы на основе серы или меди не привели к эффективной защите новых цветов и побегов. Организаторы должны сосредоточить внимание на сокращении перезимовки посевного материала. Разведка и агрессивное удаление даже минимального количества ягод мумие во время и после сбора урожая могут быть эффективными на новых посадках, которые еще не проявляют серьезных заболеваний.Производители с небольшими площадями должны сосредоточиться на удалении как можно большего количества мумий во время и после сбора урожая в сочетании с агрессивным нарушением развития апотециев весной. Усилия должны быть эффективны на 99,9%, чтобы оказать значительное влияние на это заболевание.

Химический контроль

  • Лабораторное применение гербицидов диурона или симазина привело к снижению развития и споруляции апотециев. Эти гербициды могут быть полезны, если их использовать весной в период, близкий к развитию апотециев.За конкретными рекомендациями обратитесь к Справочнику по борьбе с сорняками PNW.
  • Rex Lime Sulphur из расчета 8 галлонов / 100 галлонов воды направляется на поверхность почвы для уничтожения апотеций. Общая эффективность сомнительна, поскольку апотеции выживают при применении с жизнеспособными аскоспорами. 48-часовой повторный вход. O
  • Защищайте цветки и листву фунгицидом от распада почек до конца цветения. С точки зрения всей фермы, начните, когда у самых ранних сортов появятся бутоны. При регулярной разведке первая заявка может быть приурочена к апофециальному развитию.Смешивайте в баке и / или чередуйте продукты из разных групп с разными способами действия, чтобы предотвратить накопление устойчивых грибов. Фунгициды 3-й группы имеют высокий риск развития резистентности.
    • В количестве от 6 до 15,5 жидких унций / A. Не применять с поверхностно-активными веществами на основе силикона. Можно применять в день сбора урожая. Фунгицид 11 группы. 4-часовой повторный вход.
    • Bonide Captan 50 WP при концентрации от 1 до 2 столовых ложек на галлон воды можно использовать в домашних садах. H
    • Captan 80 WDG от 1,25 до 3 фунтов / А плюс наклейка-разбрасыватель можно использовать только начиная с середины цветения, но можно применять до дня сбора урожая.Умеренный контроль как начальной, так и средней стадии. Фунгицид группы М4. 48-часовой повторный вход.
    • CaptEvate 68 WDG при 4,7 фунта / год Может использоваться в день сбора урожая. Группа 17 + фунгицид М4. 48-часовой повторный вход.
    • EcoSwing от 1,5 до 2 пунктов / А. Можно использовать в день сбора урожая. Фунгицид группы ВМ01. 4-часовой повторный вход. O
    • Индар 2F при 6 жидких унциях / А плюс смачивающий агент. Нанесите повторно через кратчайший интервал, разрешенный на этикетке. Не использовать в течение 30 дней после сбора урожая. Фунгицид 3 группы. 12-часовой повторный вход.
    • Inspire Super от 16 до 20 жидких унций / А.Не применять в течение 7 дней после сбора урожая. Фунгицид 3 + 9 группы. 12-часовой повторный вход.
    • Kenja 400 SC от 13,5 до 15,5 жидких унций / А. Не применять в течение 7 дней после сбора урожая. Фунгицид 7 группы. 12-часовой повторный вход.
    • Luna Tranquility, от 13,6 до 27 жидких унций / A. Можно использовать в день сбора урожая. Фунгицид группы 7 + 9. 12-часовой повторный вход.
    • Миравис Прайм в концентрации от 9 до 13,4 жидких унций / А. Можно использовать в день сбора урожая. Группа 7 + 12 фунгицид. 12-часовой повторный вход.
    • Безупречный при плотности от 18,5 до 23 унций / A. Не используйте с другими добавками в бак, кроме Captan.Можно использовать в день сбора урожая. Группа 7 + 11 фунгицид. 12-часовой повторный вход.
    • Proline 480 SC при 5,7 жидких унций / А. Используйте до двух (2) аппликаций, одно нацелено на первый распустившийся цветок. Не использовать в течение 7 дней после сбора урожая. Отличный контроль. Фунгицид 3 группы. 12-часовой повторный вход.
    • Зарегистрированы фунгициды на основе пропиконазола. Не использовать в течение 30 дней после сбора урожая. Использование пропиконазола для борьбы с мумие было связано с увеличением степени тяжести Botrytis. Фунгициды 3-й группы. 12-часовой повторный вход.
      • Бампер 41,8 EC при 6 жидких унциях / A.
      • PropiMax EC при 6 жидких унциях / А.
      • Наклон 6 жидких унций / A.
    • Движитель при 13,6 жидких унций / А. Не использовать в течение 7 дней после сбора урожая. Фунгицид 3 + 7 группы. 12-часовой повторный вход.
    • Quadris Top от 12 до 14 жидких унций / A. Не применять в течение 7 дней после сбора урожая. Группа 3 + 11 фунгицид. 12-часовой повторный вход.
    • Quash при 2,5 унции / A. Особенно полезно при использовании непосредственно перед цветением. Не использовать в течение 7 дней после сбора урожая. Отличный контроль.Фунгицид 3 группы. 12-часовой повторный вход.
    • QuiltXcel от 14 до 21 жидких унций / A. Не использовать в течение 30 дней после сбора урожая. Не используйте опрыскиватели для яблок. Группа 3 + 11 фунгицид. 12-часовой повторный вход.
    • Регалии от 1 до 4 кварт / А плюс еще один фунгицид. Используйте 7-дневные интервалы. Можно использовать в день сбора урожая. При позднем цветении с высокими дозами плоды могут покраснеть. Фунгицид группы Р5. 4-часовой повторный вход. O
    • Switch 62,5 WG от 11 до 14 унций / А. В 2004 г. в западном Орегоне он не был эффективен ни на одной стадии болезни.Можно использовать до дня сбора урожая включительно. Группа 9 + 12 фунгицид. 12-часовой повторный вход.
    • Вакциплант в концентрации от 14 до 22 жидких унций / A плюс эффективный фунгицид. Можно использовать в день сбора урожая. Неизвестная эффективность в PNW. Фунгицид группы Р4. 4-часовой повторный вход.
    • Willowood Azoxy 2SC от 6 до 15,5 жидких унций / А. Не применять с поверхностно-активными веществами на основе силикона. Можно применять в день сбора урожая. Не используйте опрыскиватели для яблок. Фунгицид 11 группы. 4-часовой повторный вход.
    • Зирам 76 ДФ при 3 фунтах / А.Не применяйте через 3 недели после полного цветения. Плохой контроль как начальной, так и средней ступени. Фунгицид группы М3. 48-часовой повторный вход.

Примечание. Некоторые зарегистрированные продукты предназначены только для подавления этого заболевания и поэтому не рекомендуются для использования. Эти продукты включают Bravo Weather Stik, Double Nickel 55 (Triathlon BA) и Echo.

TNC Biological Fungicide отмечен только для штата Орегон, но не рекомендуется, поскольку его эффективность в PNW неизвестна и он слишком вязкий в растворе во время типичной прохладной весны, когда необходимо применение.

Прогнозирование Программа прогнозирования была разработана в Новой Шотландии, Канада, по чернике низкорослой. Программа использует влажность листьев и температуру в период влажности для прогнозирования заражения. Например, низкий риск заражения возникает при 6-часовой влажности при температуре 43 ° F или 50 ° F. Использование в западном Орегоне показало, что почти каждый дождливый период во время апотециального спороношения считается периодом инфекции.

Биологический контроль

  • Actinovate AG (Streptomyces lydicus штамм WYEC 108) от 3 до 12 унций / A плюс наклейка-распределитель.Не смешивайте с Регалиями. Самый высокий показатель был умеренно эффективным в западном Орегоне. Эффективен только в начальной фазе этого заболевания, поэтому используйте его до цветения и при температуре выше 45 ° F. 4-часовой повторный вход. O
  • Botector (штаммы Aureobasidium pullulans DSM 14940 и 14941) при концентрации от 5 до 10 унций / A в зависимости от объема воды. Может применяться в день сбора урожая. Был эффективным в одном тесте в западном Орегоне при низком уровне заболевания, но не в другом при высоком давлении. 4-часовой повторный вход. O
  • LifeGard WG (изолят J Bacillus mycoides) на 4.5 унций / 100 галлонов воды. Этикетка указывает на использование в ротации с фунгицидами. Можно использовать в день сбора урожая. Плохие результаты в одном испытании в западном Орегоне, но очень хорошие результаты в нескольких испытаниях в Мичигане. 4-часовой повторный вход. O
  • BotryStop (штамм Urocladium oudemansii U3) от 2 до 4 фунтов / А. Перед использованием хранить в холодильнике. Совместим со многими смачивающими средствами, некоторыми фунгицидами и биологическими средствами, но не со всеми. Неизвестная эффективность в PNW. 4-часовой повторный вход. O
  • LifeGard WG (изолят J Bacillus mycoides) на 4.5 унций / 100 галлонов воды. Этикетка указывает на использование в ротации с фунгицидами. Можно использовать в день сбора урожая. Плохие результаты в одном испытании в западном Орегоне, но очень хорошие результаты в нескольких испытаниях в Мичигане. 4-часовой повторный вход. O
  • Serenade ASO (штамм Bacillus subtilis QST 713) от 2 до 4 кварт / А. Действующее вещество — небольшой протеин. Хотя он полезен в Джорджии для кроликов, на Тихоокеанском Северо-Западе его эффективность практически отсутствует. 4-часовой повторный вход. O
  • Концентрат для борьбы с болезнями Serenade Garden из расчета от 2 до 4 жидких унций на галлон воды.Хотя он полезен в Джорджии для кроликов, на Тихоокеанском Северо-Западе его эффективность практически отсутствует. H O
  • Stargus (штамм Bacillus amyloliquefaciens F727) от 1 до 4 кварт / А плюс неионогенное поверхностно-активное вещество. Можно использовать в день сбора урожая. Неизвестная эффективность в PNW. 4-часовой повторный вход. O

Ссылки Florence, J. and, Pscheidt, J. 2017. Апотециальное развитие Monilinia Vacinii-corymbosi, связанное с глубиной мульчирования и временем нанесения. Болезнь растений 101: 807-814.

Хартевельд, Д.O.C. и Пивер Т. 2018. Определение времени восприимчивости сортов голубики высокорослой на северо-западе Вашингтона к Monilinia Vacinii-corymbosi, вызывающей мумие ягоды. Патология растений 67: 477-487.s

Эфирные масла Doterra — Mummy Mojo

Как вы, наверное, знаете, я сторонник всего естественного.

Я выступаю за местные органические продукты питания, потому что они максимально приближены к природным источникам, я принимаю только травы, витамины и минералы, содержащие натуральные ингредиенты, и все мои средства личной гигиены и домашнего хозяйства не содержат химикатов.

Я также одержим холистической терапией: иглоукалывание, EFT (постукивание), йога, инфракрасные сауны, флотационная терапия, массаж, кинезиология и хиропрактика являются частью моего постоянного репертуара.

Я искал что-то новое, чтобы поддержать мое возвращение к здоровью, когда моя подруга, натуропат и мастер Рейки, Салли познакомила меня с эфирными маслами doTERRA для решения моих проблем со здоровьем, и, в основном, с большой проблемой — болезнью Лайма.

Я начал использовать их для поддержки своих эмоций и здоровья, и это было только начало моих ароматных приключений.

Я начала использовать их при домашних недомоганиях вместе с мужем и детьми. Периодические незначительные головные боли, расстройство желудка, сезонный дискомфорт, общая болезненность и незначительная боль.

Я каждый раз наблюдал, как эти масла помогли облегчить мои симптомы и симптомы моей семьи.

Следующее, что вы знаете, я пил пару капель ладана, чтобы уменьшить боль в теле, эфирное масло лимона в моей воде, чтобы вывести мое тело от токсинов, вдыхал мяту перечной, чтобы взбодриться утром, имел баланс и покой лаванды ванна с эпсомской солью, когда у меня был долгий день, добавление лайма и имбирного масла в жаркое и полоскание горла On-Guard, если меня тошнило.

Затем я начал использовать роллерные смеси и носить их с собой везде, куда бы я ни пошел ….

Я чувствовал себя хорошо из-за того, как я лечу свое тело.

И без побочных эффектов! Я знал, что это станет частью моего пути к естественному исцелению, и с ежедневным использованием этих эфирных масел я чувствовал себя готовым вернуть свое здоровье и равновесие.

Я заметил, что масла помогают поддерживать мое психическое и физическое здоровье в равновесии и в оптимальном состоянии.

У меня впервые за долгое время появляется энергия, и, что лучше всего, я могу естественным образом справляться с 95% мелких жизненных ситуаций.

Я всегда благодарен за западные лекарства, но я благодарен за то, что нашел альтернативу, которая доступна по цене и не дает побочных эффектов ни мне, ни моей семье.

Правда о тонике

Лето — пора фруктового мороженого и кукурузы в початках, арбузов и мороженого, а для некоторых — напитков, приготовленных на прозрачных ликерах. Хорошо известно, что алкоголь глубоко влияет на тело и разум, но смешанный напиток — это нечто большее, чем печень.А как насчет тонизирующей воды, горькой шипучей жидкости, которую так часто используют в теплые месяцы, чтобы она служила инь янь джина?

Тонизирующая вода изначально существовала как средство доставки хинина, противомалярийного препарата, полученного из коры южноамериканского хинного дерева. В начале 1800-х годов британский офицер в колониальной Индии изобрел почтенный джин с тоником, когда понял, что алкоголь помогает лекарству самым восхитительным образом расплачиваться.

Сегодня тонизирующая вода по-прежнему содержит хинин, но его роли поменялись местами: разбавленный, более сладкий состав тонизирующей воды помогает джину и водке пройти мимо миндалин.Среди продуктов и напитков, которые употребляются исключительно из соображений вкуса, тонизирующая вода уникальна тем, что прежде всего была лекарством. Поскольку лекарства, как правило, имеют побочные эффекты, возможно ли, что в тонизирующей воде кроется скрытый риск для здоровья? Ответ — да, но с некоторыми оговорками. Хинин до сих пор используется для лечения малярии, хотя врачи обычно прибегают к нему для случаев, когда патоген, ответственный за заболевание, проявляет устойчивость к новым лекарствам. Однако вам придется ежедневно выпивать почти 20 литров сегодняшнего разбавленного тоника, чтобы достичь дневной дозы, обычно назначаемой при малярии.

Это может стать плохой новостью для любого, кто надеется вылечить смертельную инфекцию с помощью ночного питья, но для всех нас это должно стать облегчением, потому что хинин имеет побочные эффекты.

Побочные эффекты настолько серьезные, что фактически они были причиной того, что Управление по санитарному надзору за качеством пищевых продуктов и медикаментов запретило врачам в 2010 году прописывать препарат для лечения ночных судорог ног, что часто используется не по назначению. Наиболее серьезным из распространенных побочных эффектов является тромбоцитопения, снижение количества тромбоцитов в крови, которое может привести к внутреннему и внешнему кровотечению, а также связанное с ним состояние, которое может вызвать необратимое повреждение почек.Хуже того, эти и другие побочные эффекты в той или иной степени возникают примерно у одного из 25 пациентов, принимающих лекарственные дозы хинина.

К счастью, низкая доза хинина, содержащаяся в стакане или двух тонизирующей воде, недостаточна, чтобы вызвать эти проблемы у большинства людей. Однако для немногих неудачников даже небольшое количество хинина в тонизирующей воде может вызвать тромбоцитопению (врачи называют это редкое явление «джинно-тонической пурпурой»).

У людей также может развиться чувствительность и аллергия на хинин в результате периодического употребления тонизирующей воды, а спустя годы после приема лекарственной дозы хинина у них появится полномасштабная реакция.

Хинин может проходить через плаценту от матери к плоду, и есть некоторые ограниченные доказательства того, что он может вызывать врожденные дефекты, поэтому беременным женщинам следует избегать приема препарата, если врач не прописал его для борьбы с малярией. Людям с метаболическим нарушением дефицита глюкозо-6-фосфатдегидрогеназы (G6PD) также следует избегать этого.

Для остальных из нас, с точки зрения здоровья, алкоголь — гораздо более тревожный ингредиент смешанных напитков, чем тоник.

Передайте: Люди могут избегать тонизирующей воды, если беременны, чувствительны или страдают аллергией на хинин.

Food Facts исследует странный мир химических веществ и питательных веществ, содержащихся в нашей пище, и появляется на MyHealthNewsDaily по пятницам. Следите за MyHealthNewsDaily в Twitter @MyHealth_MHND. Мы также на Facebook и Google+.

Больше колонок Food Facts:

Самопомощь после швов или разрывов промежности

1. Как можно скорее выполняйте упражнения для тазового дна, чтобы улучшить кровообращение и ускорить заживление.

2.Ходьба предотвращает скованность и помогает уменьшить отек.

3. Сядьте на надувную резиновую подушку (НЕ резиновое кольцо) или на две подушки под каждым бедром. (ПОДУШКА VALLEY CUSHION удобна и может быть арендована непосредственно в местном NCT.)

4. Горячие компрессы (горячие фланели, отжатые в горячей воде) улучшают кровообращение и ускоряют заживление. В качестве альтернативы, если вы сидите на пакете со льдом (например, на пакете гороха), отек снимается.

5. Ванна в теплой прозрачной воде. НЕ ИСПОЛЬЗУЙТЕ СОЛЬ — это вызовет пересыхание и зуд.Смешайте пару капель масла лаванды с парой капель масла чайного дерева в небольшом количестве оливкового масла и добавьте в ванну — это намного добрее и поможет заживлению.

6. Не замачивайте слишком долго, так как это может смягчить стежки.

7. Таблетки арники, принятые как можно скорее, уменьшают отек и синяки.

8. Открывая чашу, прижмите чистую гигиеническую прокладку к швам, чтобы не натянуть их.

9. Сядьте поудобнее на унитазе. После мочеиспускания налейте кувшин теплой воды на вульву (или воспользуйтесь биде), чтобы прекратить жжение.

10. Пейте много жидкости, чтобы разбавить мочу и предотвратить запор. Ешьте много грубых кормов — отрубей, цельнозернового хлеба, сухофруктов, свежих фруктов и овощей.

11. Посмотрите в зеркало на свои швы — они могут выглядеть не так плохо, как вы думаете!

12. Используйте мягкие гигиенические прокладки. Плетеные трусики могут быть более удобными или носить эластичные брюки (можно приобрести в NCT), или трусики при недержании превосходны! Немного KY Jelly предотвращает прилипание полотенца к швам и подходит для возобновления полового акта.

13. Сообщайте о любых продолжающихся проблемах во время послеродового осмотра. Не соглашайтесь с тем, что «вы больше никогда не будете прежними». Ваше тазовое дно и объем мочевого пузыря должны быть такими же, как до рождения ребенка в течение 3 месяцев. Если у вас есть проблемы с тазовым дном или спиной, вы можете самостоятельно обратиться к своему акушерскому физиотерапевту в течение 8 недель после родов. После этого вам понадобится направление к терапевту.

Стежки должны нормально заживать в течение 3 недель

ОЧЕНЬ ВАЖНЫ УПРАЖНЕНИЯ ДЛЯ Тазового дна.

СДЕЛАЙТЕ ИХ ДЛЯ ОТДЫХА СВОЕЙ ЖИЗНИ!

Спасибо North Surrey Midwives за то, что поделились этим сообщением.

Мумие что это такое что лечит как правильно развести: Страница не найдена

Добавить комментарий

Ваш адрес email не будет опубликован.

Джин Грунтовка Температура отжига
Osterix-F TAGGACTGTAGGACCGGAGC 60.11 ° C в течение 30 секунд
Osterix-R TGTCCCGAGTCTCTCCTCTC 59,75 ° C в течение 30 секунд
Интегрин субъединица бета 1-F GCCGCGCG3 90 секунд GCCGCGCG 90 с Субъединица интегрина бета 1-R CACAATTTGGCCCTGCTTGTA 61,75 ° C в течение 30 с
Остеокальцин -F TCCTTTGGGGTTTTGGTACTAC 0 9019 CCGCCC3 9019 90 CCCC6 30 CC96 ° C в течение 30 секунд
RUNX2-F CCACCGAGACCAACAGAGTC 60,04 ° C в течение 30 секунд
RUNX2- R TCACTGTGCTGAAGAGGCTG