Содержание

Глобулин, связывающий половые гормоны (ГСПГ)

Глобулин, связывающий половые гормоны (ГСПГ), – это производимый печенью белок, который соединяется с тестостероном, дигидротестостероном (ДГТ) и эстрадиолом (эстрогеном) и транспортирует их в кровь в метаболически неактивной форме.

Синонимы русские

Cекс-стероид-связывающий глобулин, ГСПГ, СССГ, тестостерон-эстрадиол-связывающий глобулин.

Синонимы английские

Sex Hormone Binding Globulin, Testosterone, Free Testosterone, Bioavailable Testosterone.

Метод исследования

Электрохемилюминесцентный анализ.

Диапазон определения: 0,35 — 2000 нмоль/л.

Единицы измерения

Нмоль/л (наномоль на литр).

Какой биоматериал можно использовать для исследования?

Венозную кровь.

Как правильно подготовиться к исследованию?

  • Исключить физическое и эмоциональное перенапряжение за 30 минут до исследования.
  • Не курить в течение 30 минут до исследования.

Общая информация об исследовании

ГСПГ – белок, производимый печенью. Он связывается с тестостероном, дигидротестостероном (ДГТ) и эстрадиолом (эстрогеном) и переносит их в кровяное русло. Содержание ГСПГ в кровотоке зависит от возраста человека, пола, от интенсивности производства тестостерона либо эстрогенов. Кроме того, на уровень ГСПГ в крови влияют заболевания печени, гипертиреоз, гипотиреоз и повышенная масса тела.

Количество тестостерона, доступного для использования тканями организма, зависит от колебания уровня ГСПГ. В нормальном состоянии с ГСПГ связано от 40 % до 60 % тестостерона, а большая часть оставшегося – слабо соединена с альбумином. И только около 2 % свободного тестостерона непосредственно доступно для тканей.

Анализ на общий тестостерон не выявляет различий между связанным и несвязанным тестостероном – он лишь определяет количество гормона в целом. Во многих случаях его хватает, чтобы определить избыток или недостаток образования гормона в организме, однако если показатель ГСПГ отклоняется от нормального, то выявленный уровень общего тестостерона не является точным отражением количества гормона, доступного тканям организма.

В настоящее время анализ на ГСПГ используется не очень часто – в большинстве случаев анализы на общий и свободный тестостерон дают достаточно информации.

Для чего используется исследование?

  • Для выяснения статуса мужских гормонов (андрогенов). Мужчинам он назначается при дефиците тестостерона, женщинам – при его избытке. Вместе с тестом на ГСПГ или перед ним может быть проведен анализ на общий тестостерон.
  • Для определения причин бесплодия, пониженной сексуальной активности и эректильной дисфункции у мужчин, особенно когда показатели общего тестостерона не согласуются с клинической картиной.
  • Для диагностики синдрома поликистозных яичников и болезней, характеризующихся избыточным производством андрогенов.
  • Для оценки существующего баланса гормонов – вместе с анализами на свободный тестостерон, альбумин, пролактин, эстрадиол и лютеинизирующий гормон.
  • Для определения уровня свободных андрогенов посредством вычисления их индекса (ИСА) – вместе с тестом на общий тестостерон. Это дает возможность узнать количество тестостерона, не связанного с ГСПГ: ИСА = общий тестостерон / ГСПГ.

Когда назначается исследование?

  • Если результаты теста на общий тестостерон не согласуются с клиническими наблюдениями, например с пониженной сексуальной активностью у мужчин и гирсутизмом у женщин.

Что означают результаты?

Референсные значения

Пол

Возраст

Референсные значения

Женский

Меньше 1 месяца

11,8 — 51 нмоль/л

1 месяц – 1 год

50 — 181 нмоль/л

1-4 лет

51 — 158 нмоль/л

4-7 лет

48 — 142 нмоль/л

7-10 лет

31 — 103 нмоль/л

10-13 лет

20 — 100 нмоль/л

13-16 лет

16,6 — 77 нмоль/л

16-20 лет

9,3 — 75 нмоль/л

20-50 лет

32,4 — 128 нмоль/л

Больше 50 лет

27,1 — 128 нмоль/л

Мужской

Меньше 1 месяца

10,8 — 71 нмоль/л

1 месяц – 1 год

60 — 209 нмоль/л

1-4 лет

42 — 156 нмоль/л

4-7 лет

39 — 146 нмоль/л

7-10 лет

38 — 114 нмоль/л

10-13 лет

32 — 93 нмоль/л

13-16 лет

13 — 63 нмоль/л

16-20 лет

10,6 — 54 нмоль/л

20-50 лет

18,3 — 54,1 нмоль/л

Больше 50 лет

20,6 — 76,7 нмоль/л

При повышенном уровне ГСПГ вполне вероятно, что свободного тестостерона, доступного тканям, гораздо меньше того количества, которое показал тест на общий тестостерон. Если же концентрация ГСПГ понижена, то тестостерона, не связанного с ГСПГ, образуется больше его общего уровня.

Что может влиять на результат?

  • Концентрация ГСПГ бывает довольно высокой у детей – это нормально.
  • Уровень ГСПГ у взрослых достаточно стабилен. У мужчин он поднимается с возрастом. У женщин после менопаузы концентрация ГСПГ уменьшается по мере снижения гормональной активности яичников.
  • Заболевания печени, гипертиреоз и анорексия могут способствовать повышению уровня ГСПГ. Понижение уровня ГСПГ наблюдается при избыточной массе тела, гипотиреозе, употреблении андрогенов и болезни Иценко – Кушинга.

Как мужское здоровье зависит от уровня тестостерона

Тестостерон — главный половой гормон у мужчин. В этой статье мы расскажем, в каких процессах он участвует, что влияет на уровень тестостерона в организме, а также как понять, если с ним начались проблемы.

Как организм синтезирует тестостерон

Тестостерон у мужчин производят клетки Лейдига, которые расположены в семенниках или тестикулах. Небольшое его количество также синтезируют надпочечники и у мужчин, и у женщин.

5 миллиграмм тестостерона синтезируется в организме здорового мужчины каждый день.

Последний настолько крепко связывается с гормоном, что организм не может его больше использовать для своих нужд. Таким образом, глобулин контролирует количество тестостерона, которое попадает в клетки и в ткани.

Тестостерон, который связывается с альбумином, так же как и свободный, легко расходуется клетками и тканями организма, поэтому их называют биодоступными. Чтобы не запутаться в разных формах тестостерона, мы изобразили их на схеме.

В предстательной железе, мышцах, волосяных фолликулах и других чувствительных к тестостерону тканях около 10% тестостерона конвертируется в более мощный по действию дегидротестостерон. Именно он отвечает за все функции, которые приписываются тестостерону.


Какие функции выполняет тестостерон

Тестостерон достигает пика в подростковом возрасте и молодости. Он активно участвует в изменениях в теле во время переходного периода.

У мальчиков тестостерон влияет на:

  • Развитие половых органов;
  • Рост волос на лице, груди, в подмышках и области паха;
  • Изменение голоса;
  • Сексуальное желание;
  • Укрепление костей и набор мышечной массы;
  • Рост.

У взрослых мужчин тестостерон на постоянной основе регулирует сексуальное желание, костную и мышечную массу, количество волос на теле и лице. От него зависит производство клеток крови и спермы.

Как работают гормоны

Тестостерон влияет также на производство эстрогена. Этот гормон считается женским, но у мужчин он тоже есть. Он влияет на работу жировых тканей и плотность костей.

От тестостерона во время беременности зависит соотношение указательного пальца к безымянному, которое называется пальцевым индексом. У мужчин из-за высокого уровня тестостерона безымянный палец чаще длиннее, чем у женщин, поэтому индекс ниже.


Признаки низкого тестостерона

Недостаток тестостерона у плода может приводить к нарушениям развития мужских половых признаков. У подростков дефицит этого гормона связан с меньшей мышечной силой и выносливостью, а руки и ноги могут расти не пропорционально туловищу.

С возрастом по мере старения уровень гормона постепенно снижается — примерно на 1% ежегодно после 30–40 лет. При этом синтез глобулина, связывающего половые гормоны, из-за которого часть тестостерона становится неактивной — увеличивается. Таким образом, с возрастом повышается риск дефицита активной формы этого полового гормона.

Около 40% мужчин старше 45 имеют низкий уровень тестостерона.

Американское общество урологов считает низким тестостерон меньше 300 нанограмм на децилитр. Симптомами такого уровня гормонов являются:

  • Низкое либидо;
  • Усталость;
  • Уменьшение мышечной массы;
  • Раздражительность;
  • Эректильная дисфункция;
  • Депрессия.

К другим признакам, которые могут быть связаны с дефицитом, относится нехватка энергии, снижение выносливости и физической силы, проблемы с памятью, формированием фраз, концентрацией.

Однако все вышеперечисленные симптомы присущи не только низкому уровню тестостерона. Они нередко возникают из-за других заболеваний, поэтому при их появлении стоит сначала обратиться к врачу. А если специалист заподозрит нехватку половых гормонов, то сможет подобрать список анализов, необходимый для оценки вашего состояния.


Как поддерживать уровень тестостерона

Снижение уровня тестостерона с возрастом — естественная часть старения. Однако некоторые заболевания и состояния ускоряют этот процесс.

К факторам, которые способствуют снижению уровня тестостерона, относятся:

  • Травмы или инфекции семенников;
  • Стресс;
  • Чрезмерное употребление алкоголя;
  • Ожирение;
  • Хронические заболевания;
  • Некоторые препараты, в основном кортикостероиды и гормоны для лечения рака предстательной железы;
  • Лечение рака химио- или радиотерапией.

Еще одно состояние, которое связано с низким уровнем тестостерона — апноэ во сне. Оно характеризуется частыми остановками дыхания, которые сопровождаются храпом. После начала лечения апноэ уровни тестостерона возвращаются в норму.

С низким уровнем гормона также связан прием анаболических стероидов. Долгий прием таких препаратов может привести к бесплодию, снижению либидо, уменьшению семенников и увеличению молочных желез.

Наследственные заболевания тоже могут быть причиной низкого тестостерона. К ним относится синдром Каллмана, синдром Прадера — Вилли, синдром Клайнфельтера, гемохроматоз, миотоническая дистрофия.


Мужское здоровье в Генетическом тесте Атлас

Уровень мужских половых гормонов зависит от вариантов различных генов. В Генетическом тесте Атлас мы оцениваем вашу предрасположенность к определенному уровню тестостерона. Этот признак находится у мужчин в разделе Спорт, так как гормон влияет на набор мышечной массы.

Уровень тестостерона и эффективность его работы зависит также от других гормонов, поэтому в Генетическом тесте мы также оцениваем, как варианты генов влияют на них.

Гормон Связь с тестостероном
Дегидротестостерон Конвертируется в тканях. Отвечает за все функции, которые приписываются тестостерону.
Глобулин, связывающий половые гормоны Отвечает за неактивную форму тестостерона
Дегидроэпиандростерон-сульфат Гормон-предшественник тестостерона
Лютеинизирующий гормон Стимулирует выработку тестостерона
Фолликулостимулирующий гормон Регулирует выработку тестостерона


Генетический тест не показывает уровень гормонов в крови. С помощью него вы узнаете о своей генетической предрасположенности к низкому, среднему или высокому уровню гормонов и рисках заболеваний. Это поможет оценить, какие меры профилактики нужны в вашем случае, чтобы оставаться здоровым как можно дольше.

Сейчас в честь 23 февраля на сайте Атласа действуют скидки до 50%. Генетический тест можно приобрести за 14900 вместо 29900.

Компания Новые Медицинские Технологии, сеть клиник

Уважаемые клиенты, чтобы заказать исследования, необходимо

на нашем сайте.

Лаборатория Компании Новые медицинские технологии», медицинские центры «Медлайн» предлагают широкий спектр анализов, ультразвуковые исследования, консультации врачей.

Ознакомиться со списком услуг Вы можете в каталоге, который обладает возможностью поиска необходимого исследования как по группам, так и по алфавиту. Если Вы не знакомы со спецификой какого-либо исследования, то Вы можете прочесть его описание, нажав на соответствующую ссылку.

Пройдите предварительную интернет-регистрацию исследований, распечатайте сформированный заказ и БЕЗ ОЧЕРЕДИ получите необходимые услуги.

При посещении выбранного Вами медицинского подразделения:
   1.БЕЗ ОЧЕРЕДИ подайте администратору Ваш распечатанный бланк интернет-регистрации.
   2.Администратор проверит правильность выбора исследований и указанной Вами личной информации, добавит (при необходимости) платную услугу по забору крови или другого биологического материала, примет оплату, выдаст кассовый и товарный чек, распечатает договор (если он не был распечатан ранее), даст все необходимые рекомендации и инструкции.
   3.БЕЗ ОЧЕРЕДИ пройдите в процедурный кабинет на забор крови или сдачу другого биологического материала
После готовности Ваших анализов — получите результат в своем личном кабинете на сайте или с товарным чеком в любом нашем медицинском подразделении.

указанные сроки актуальны для г.Воронежа, сроки готовоности в прочих городах уточняйте в регистратурах НМТ соответствующего города

Наименование Биоматериал Срок
ANA-профиль, кровь кровь 3 рабочих дня* Заказать
Альфа-1 кислый гликопротеин (орозомукоид), кровь, мг/дл кровь 1 рабочий день* Заказать
Альфа-1-антитрипсин, кровь, г/л кровь 1 рабочий день* Заказать
Антиген HLA B27 / HLA B7 кровь 1 рабочий день* Заказать
Антинуклеарные антитела ANA (АНФ), кровь сыворотка крови 10 дней* Заказать
Антиовариальные антитела, кровь, Ед/мл Заказать
Антиспермальные антитела на сперматозоидах (сперма) сперма 1 рабочий день* Заказать
Антиспермальные антитела, кровь, Е/мл кровь 1 рабочий день* Заказать
Антиспермальные антитела, семенная плазма, колич. , ИФА * Заказать
Антистрептолизин-О (АСЛО) колич., кровь, МЕ/мл кровь 1 рабочий день* Заказать
Антитела к MCV, кровь, ед/мл кровь 20 рабочих дней* Заказать
Антитела к аннексину V IgG, кровь, ед/мл 15 рабочих дней* Заказать
Антитела к аннексину V IgM, кровь, ед/мл кровь 15 рабочих дней* Заказать
Антитела к антигенам нейтрофилов спектр, кровь кровь 2 рабочих дня* Заказать
Антитела к клеткам островков Лангерганса (бета-клетки), IgG, кровь кровь 20 рабочих дней* Заказать
Антитела к протромбину, кровь, ед/мл кровь 15 рабочих дней* Заказать
Антитела к тканевой трансглутаминазе, кровь кровь 15 рабочих дней* Заказать
Антитела к фосфатидил-инозитолу, IgG, кровь кровь 1 рабочий день* Заказать
Антитела к фосфатидил-серину, IgG, кровь кровь 1 рабочий день* Заказать
Антитела к фосфатидиловой кислоте, IgG, кровь кровь 1 рабочий день* Заказать
Антитела к фосфолипидам скрининг (5 антигенов), кровь кровь 1 сутки* Заказать
АТ к бета2-гликопротеину 1 суммарные, кровь, Ед/мл кровь 20 рабочих дней* Заказать
АТ к ДНК, кровь сыворотка крови 10 рабочих дней* Заказать
Ат к инсулину, кровь, Ед/мл кровь 1 рабочий день* Заказать
АТ к кардиолипину, суммарные кровь 15 рабочих дней. * Заказать
АТ к микросомам печени и почек (LKM-1), IgG, кровь кровь 15 рабочих дней* Заказать
АТ к митохондриям (AMA M2), IgG, кровь кровь 15 рабочих дней* Заказать
Ат к фосфолипидам сумм. (кардиолипин, фосфатидилсерин, фосфатидилинозитол, фосфатидиловая к-та)кровь кровь 1 сутки* Заказать
АТ к циклическому цитруллин-содержащему пептиду, IgG, кровь, Е/мл кровь 5 рабочих дней* Заказать
АТ к цитоплазматическим антигенам нейтрофилов кровь 15 рабочих дней* Заказать
Гаптоглобин, кровь, мг/дл кровь 1 рабочий день* Заказать
Гастро-5-лайн кровь 1 рабочий день* Заказать
Печеночный аутоиммунный профиль (9 параметров), кровь кровь 1 рабочий день* Заказать
Ревматоидный фактор, количественно, МЕ/мл кровь 1 день* Заказать
С-реактивный белок суперчувствительный (Siemens), кровь, мг/л кровь 1 рабочий день* Заказать
С-реактивный белок, кровь, мг/л кровь 1 рабочий день* Заказать
титрование (1 разведение) * Заказать
Церулоплазмин, кровь, мг/дл кровь 1 рабочий день* Заказать
Наименование Биоматериал Срок
АЛАТ, кровь, Е/л кровь 1 рабочий день* Заказать
Альбумин, кровь, г/л кровь 1 рабочий день* Заказать
Амилаза (диастаза), моча, Ед/л * Заказать
Амилаза панкреатическая, кровь, Е/л кровь 1 рабочий день* Заказать
Амилаза, кровь, Е/л * Заказать
Амилаза-альфа, кровь, Е/л кровь 1 рабочий день* Заказать
Аполипопротеины А1 и В кровь 1 рабочий день* Заказать
АСАТ, кровь, Е/л кровь 1 рабочий день* Заказать
АЧТВ, сек. кровь 1 рабочий день* Заказать
Бикарбонаты, кровь, мМоль/л кровь, сыворотка 1 день* Заказать
Билирубин общий, кровь, мкМоль/л кровь 1 рабочий день* Заказать
Билирубин свободный, кровь, мкМоль/л кровь 1 рабочий день* Заказать
Билирубин связанный, кровь, мкМоль/л кровь 1 рабочий день* Заказать
Гастрин, кровь, мЕД/мл кровь 1 рабочий день* Заказать
ГГТП, кровь, Е/л кровь 1 рабочий день* Заказать
Глюкоза, кровь, мМоль/л кровь 1 рабочий день* Заказать
Креатинин, кровь, мкМоль/л кровь 1 рабочий день* Заказать
Креатинкиназа, кровь, Е/л кровь 1 рабочий день* Заказать
КФ (кислая фосфатаза) общая, кровь, Е/л кровь 1 рабочий день* Заказать
КФК-МВ, ЕД/л Заказать
Лактат (молочная кислота), кровь, Ед/л кровь 1 рабочий день* Заказать
ЛДГ, кровь, Е/л кровь 1 рабочий день* Заказать
Липаза панкреатическая, кровь, Е/л кровь 1 рабочий день* Заказать
Мочевая кислота, кровь, мкМоль/л кровь 1 рабочий день* Заказать
Мочевина(Diasys), кровь, мМоль/л кровь 1 рабочий день* Заказать
Мочевина, кровь, мМоль/л в день обращения, в течении часа* Заказать
Насыщение трансферрина железом (%) * Заказать
Общий белок, кровь, г/л кровь 1 рабочий день* Заказать
Протромбин, МНО кровь 1 рабочий день* Заказать
Тимоловая проба, кровь, ед. кровь 1 рабочий день* Заказать
Трансферрин, кровь, мг/дл кровь 1 рабочий день* Заказать
Триглицериды, кровь, мМоль/л кровь 1 рабочий день* Заказать
Тромбиновое время, сек кровь 1 рабочий день* Заказать
Ферритин, кровь, мкг/л кровь 1 рабочий день* Заказать
Фибриноген, кровь, г/л кровь 1 рабочий день* Заказать
Холестерин ЛПВП (HDL), кровь, мМоль/л кровь 1 рабочий день* Заказать
Холестерин ЛПНП (LDL), кровь, мМоль/л кровь 1 рабочий день* Заказать
Холестерин общий, кровь, мМоль/л кровь 1 рабочий день* Заказать
Холестериновый коэффициент атерогенности кровь 1 рабочий день* Заказать
Щелочная фосфатаза, кровь, Е/л кровь 1 рабочий день* Заказать
Наименование Биоматериал Срок
D1 sIgE к аллергенам Dermatophagoides pteronissinus, кровь, kU/L кровь 1 рабочий день* Заказать
D2 sIgE к аллергенам Dermatophagoides farinae, кровь, kU/L кровь 1 рабочий день* Заказать
E1 sIgE к аллергенам эпителия кошки, кровь, kU/L кровь 1 рабочий день* Заказать
E2 sIgE к аллергенам эпителия собаки, кровь, kU/L кровь 1 рабочий день* Заказать
E5 sIgE к аллергенам перхоти собаки, кровь, kU/L кровь 1 рабочий день* Заказать
E6 sIgE к аллергенам морской свинки, кровь, kU/L кровь 1 рабочий день* Заказать
E78 sIgE к аллергенам волнистого попугая, кровь, kU/L кровь 1 рабочий день* Заказать
E81 sIgE к аллергенам эпителия овцы, кровь, kU/L кровь 1 рабочий день* Заказать
E82 sIgE к аллергенам эпителия кролика, кровь, kU/L * Заказать
E84 sIgE к аллергенам хомяка, кровь, kU/L кровь 1 рабочий день* Заказать
E85 sIgE к аллергенам пера курицы, кровь, kU/L кровь 1 рабочий день* Заказать
F1 sIgE к аллергенам яичного белка, кровь, kU/L кровь 1 рабочий день* Заказать
F10 sIgE к аллергенам кунжута (сезама), кровь, kU/L кровь 1 рабочий день* Заказать
F105 sIgE к аллергенам шоколада, кровь, kU/L кровь 1 рабочий день* Заказать
F11 sIgE к аллергенам гречневой муки, кровь, kU/L кровь 1 рабочий день* Заказать
F12 sIgE к аллергенам гороха, кровь, kU/L кровь 1 рабочий день* Заказать
F13 sIgE к аллергенам арахиса, кровь, kU/L кровь 1 рабочий день* Заказать
F14 sIgE к аллергенам соевых бобов, кровь, kU/L кровь 1 рабочий день* Заказать
F17 sIgE к аллергенам фундука, кровь, kU/L кровь 1 рабочий день* Заказать
F2 sIgE к аллергенам коровьего молока, кровь, kU/L кровь 1 рабочий день* Заказать
F20 sIgE к аллергенам миндаля, кровь, kU/L кровь 1 рабочий день* Заказать
F204 sIgE к аллергенам форели, кровь, kU/L * Заказать
F221 sIgE к аллергенам кофе, кровь, kU/L кровь 1 рабочий день* Заказать
F225 sIgE к аллергенам тыквы, кровь, kU/L * Заказать
F237 sIgE к аллергенам абрикоса, кровь, kU/L кровь 1 рабочий день* Заказать
F25 sIgE к аллергенам помидоров, кровь, kU/L кровь 1 рабочий день* Заказать
F256 sIgE к аллергенам грецкого ореха, кровь, kU/L кровь 1 рабочий день* Заказать
F26 sIgE к аллергенам свинины, кровь, kU/L кровь 1 рабочий день* Заказать
F260 sIgE к аллергенам брокколи, кровь, kU/L * Заказать
F27 sIgE к аллергенам говядины, кровь, kU/L кровь 1 рабочий день* Заказать
F284 sIgE к аллергенам индейки, кровь, kU/L * Заказать
F3 sIgE к аллергенам трески, кровь, kU/L кровь 1 рабочий день* Заказать
F31 sIgE к аллергенам моркови, кровь, kU/L кровь 1 рабочий день* Заказать
F33 sIgE к аллергенам апельсина, кровь, kU/L кровь 1 рабочий день* Заказать
F35 sIgE к аллергенам картофеля, кровь, kU/L кровь 1 рабочий день* Заказать
F4 sIgE к аллергенам пшеничной муки, кровь, kU/L кровь 1 рабочий день* Заказать
F40 sIgE к аллергенам тунца, кровь, kU/L кровь 1 рабочий день* Заказать
F49 sIgE к аллергенам яблока, кровь, kU/L кровь 1 рабочий день* Заказать
F5 sIgE к аллергенам ржаной муки, кровь, kU/L кровь 1 рабочий день* Заказать
F61 sIgE к аллергенам сардины, кровь, kU/L кровь 1 рабочий день* Заказать
F7 sIgE к аллергенам овсяной муки, кровь, kU/L кровь 1 рабочий день* Заказать
F75 sIgE к аллергенам яичного желтка, кровь, kU/L кровь 1 рабочий день* Заказать
F78 sIgE к аллергенам казеина, кровь, kU/L кровь 1 рабочий день* Заказать
F8 sIgE к аллергенам кукурузной муки, кровь, kU/L * Заказать
F83 sIgE к аллергенам куриного мяса, кровь, kU/L кровь 1 рабочий день* Заказать
F87 sIgE к аллергенам дыни, кровь, kU/L * Заказать
F88 sIgE к аллергенам баранины, кровь, kU/L кровь 1 рабочий день* Заказать
F9 sIgE к аллергенам риса, кровь, kU/L кровь 1 рабочий день* Заказать
F92 sIgE к аллергенам бананов, кровь, kU/L кровь 1 рабочий день* Заказать
F93 sIgE к аллергенам какао, кровь, kU/L кровь 1 рабочий день* Заказать
F94 sIgE к аллергенам груши, кровь, kU/L кровь 1 рабочий день* Заказать
F95 sIgE к аллергенам персика, кровь, kU/L кровь 1 рабочий день* Заказать
FP5 sIgE к миксту пищевых аллергенов (F1, F2, F3, F4, F13, F14), кровь кровь 1 рабочий день* Заказать
FP73 sIgE к миксту пищевых аллергенов (F26, F27, F83, F88), кровь кровь 1 рабочий день* Заказать
G12 sIgE к аллергенам ржи культивированной, кровь, kU/L кровь 1 рабочий день* Заказать
G15 sIgE к аллергенам пшеницы, кровь, kU/L кровь 1 рабочий день* Заказать
G3 sIgE к аллергенам ежи сборной, кровь, kU/L кровь 1 рабочий день* Заказать
G4 sIgE к аллергенам овсяницы луговой, кровь, kU/L кровь 1 рабочий день* Заказать
G5 sIgE к аллергенам ржи многолетней, кровь, kU/L кровь 1 рабочий день* Заказать
G6 sIgE к аллергенам тимофеевки, кровь, kU/L кровь 1 рабочий день* Заказать
G8 sIgE к аллергенам мятлика лугового, кровь, kU/L кровь 1 рабочий день* Заказать
GP1 sIgE к миксту аллергенов травы (G3, G4, G5, G6, G8), кровь кровь 1 рабочий день* Заказать
h2 sIgE к аллергенам домашней пыли (Greer), кровь, kU/L кровь 1 рабочий день* Заказать
h3 sIgE к аллергенам домашней пыли (Hollister-Stier), кровь, kU/L кровь 1 рабочий день* Заказать
HP1 sIgE к миксту аллергенов пыли (h2, D1, D2, I6), кровь кровь 1 рабочий день* Заказать
I6 sIgE к аллергенам таракана-прусака, кровь, kU/L кровь 1 рабочий день* Заказать
IP8 sIgE к миксту ингаляционных аллергенов (E1, D1, T3, E5, W6, G6, G12, M2), кровь кровь 1 рабочий день* Заказать
M1 sIgE к аллергенам Penicillium notatum, кровь, kU/L кровь 1 рабочий день* Заказать
M2 sIgE к аллергенам Cladosporium herbarum, кровь, kU/L кровь 1 рабочий день* Заказать
M3 sIgE к аллергенам Aspergillus fumigatus, кровь, kU/L кровь 1 рабочий день* Заказать
M5 sIgE к аллергенам Candida albicans, кровь, kU/L кровь 1 рабочий день* Заказать
M6 sIgE к аллергенам Alternaria tenuis, кровь, kU/L кровь 1 рабочий день* Заказать
M70 sIgE к аллергенам Pityrosporum orbiculare, кровь, kU/L кровь 1 рабочий день* Заказать
MP1 sIgE к миксту аллергенов микроскопических грибов (M1, M2, M3, M5, M6), кровь кровь 1 рабочий день* Заказать
O1 sIgE к аллергенам хлопка, кровь, kU/L * Заказать
O72 sIgE к энтеротоксину А Staph. aureus, кровь, kU/L кровь 1 рабочий день* Заказать
O73 sIgE к энтеротоксину B Staph. aureus, кровь, kU/L кровь 1 рабочий день* Заказать
P1 sIgE к аллергенам аскариды, кровь, kU/L кровь 1 рабочий день* Заказать
T1 sIgE к аллергенам клена ясенелистного, кровь, kU/L кровь 1 рабочий день* Заказать
T12 sIgE к аллергенам ивы, кровь, kU/L кровь 1 рабочий день* Заказать
T14 sIgE к аллергенам тополя, кровь, kU/L кровь 1 рабочий день* Заказать
T19 sIgE к аллергенам акации, кровь, kU/L кровь 1 рабочий день* Заказать
T2 sIgE к аллергенам ольхи, кровь, kU/L кровь 1 рабочий день* Заказать
T3 sIgE к аллергенам березы, кровь, kU/L кровь 1 рабочий день* Заказать
T4 sIgE к аллергенам лещины обыкновенной, кровь, kU/L кровь 1 рабочий день* Заказать
T7 sIgE к аллергенам дуба, кровь, kU/L кровь 1 рабочий день* Заказать
TP9 sIgE к миксту аллергенов деревьев (T2, T12, T4, T7, T3), кровь кровь 1 рабочий день* Заказать
W1 sIgE к аллергенам амброзии обыкновенной, кровь, kU/L кровь 1 рабочий день* Заказать
W10 sIgE к аллергенам мари белой, кровь, kU/L кровь 1 рабочий день* Заказать
W11 sIgE к аллергенам солянки/зольника, кровь, kU/L кровь 1 рабочий день* Заказать
W15 sIgE к аллергенам лебеды, кровь, kU/L кровь 1 рабочий день* Заказать
W6 sIgE к аллергенам полыни обыкновенной, кровь, kU/L кровь 1 рабочий день* Заказать
W8 sIgE к аллергенам одуванчика лекарственного, кровь, kU/L * Заказать
W9 sIgE к аллергенам подорожника, кровь, kU/L кровь 1 рабочий день* Заказать
WP1 sIgE к миксту аллергенов сорных трав (W1, W11, W8, W9, W6), кровь кровь 1 рабочий день* Заказать
К20 sIgE к аллергенам шерсти, кровь, kU/L * Заказать
К74 sIgE к аллергенам шелка, кровь, kU/L * Заказать
К82 sIgE к аллергенам латекса, кровь, kU/L * Заказать
Общий IgE (Siemens), кровь, МЕ/мл кровь 1 рабочий день* Заказать
Пищевая IgG аллергия, 90 аллергенов (Российская панель) кровь 2 рабочих дня* Заказать
С1-ингибитор эстеразы, кровь кровь 1 рабочий день* Заказать
Эозинофильный катионный белок (Siemens), кровь, нг/мл кровь 1 рабочий день* Заказать
Наименование Биоматериал Срок
HbeAg, кровь кровь 5 рабочих дней* Заказать
HbsAg, Cito!, кровь * Заказать
HbsAg, кровь кровь 5 рабочих дней* Заказать
АТ Chlamydia pneumonia IgG, кровь, Е/мл кровь 10 рабочих дней* Заказать
АТ Chlamydia pneumonia IgА, кровь кровь 10 рабочих дней* Заказать
АТ Chlamydia pneumonia IgМ, кровь кровь 10 рабочих дней* Заказать
АТ Chlamydia trachomatis IgA, кровь кровь 10 рабочих дней* Заказать
АТ Chlamydia trachomatis IgG cHSP60, кровь кровь 10 рабочих дней* Заказать
АТ Chlamydia trachomatis IgG Cito, кровь * Заказать
АТ Chlamydia trachomatis IgG Ед/Мл (количественно), кровь кровь 10 рабочих дней* Заказать
АТ Chlamydia trachomatis IgG МОМР+pgp3, кровь кровь 10 рабочих дней* Заказать
АТ Chlamydia trachomatis IgG, кровь кровь 10 рабочих дней* Заказать
АТ Chlamydia trachomatis IgM, кровь кровь 10 рабочих дней* Заказать
АТ Herpes simplex IgG (титр), кровь кровь 10 рабочих дней* Заказать
АТ Herpes simplex IgG авидность, кровь, % кровь 10 рабочих дней* Заказать
АТ Herpes simplex IgM, кровь кровь 10 рабочих дней* Заказать
АТ Herpes simplex II типа IgG, кровь кровь 10 рабочих дней* Заказать
АТ Herpes simplex II типа IgM, кровь кровь 10 рабочих дней* Заказать
АТ Mycoplasma hominis (IgA, IgG) кровь 10 рабочих дней* Заказать
АТ Mycoplasma hominis IgM, кровь Заказать
АТ Mycoplasma pneumonia IgA, кровь кровь 10 рабочих дней* Заказать
АТ Mycoplasma pneumonia IgM, кровь кровь 10 рабочих дней* Заказать
АТ Mycoplasma pneumoniae IgG, количественно, МЕ/мл, кровь кровь 10 рабочих дней* Заказать
АТ Toxoplasma gondii IgG (Siemens), кровь, МЕ/мл кровь 1 рабочий день* Заказать
АТ Toxoplasma gondii IgG авидность, кровь, % кровь 10 рабочих дней* Заказать
АТ Toxoplasma gondii IgG+IgM кровь 10 рабочих дней* Заказать
АТ Toxoplasma gondii IgM (Siemens), кровь кровь 1 рабочий день* Заказать
АТ Toxoplasma gondii IgА (кач. ), кровь кровь 10 рабочих дней* Заказать
АТ Treponema pallidum Cito!, суммарные * Заказать
АТ Trichomonas vaginalis IgG, кровь кровь 10 рабочих дней* Заказать
АТ Trichomonas vaginalis IgА, кровь кровь 10 рабочих дней* Заказать
АТ Ureaplasma urealyticum кровь 10 рабочих дней* Заказать
АТ Varicella zoster virus (VZV) IgG, кровь кровь 5 рабочих дней* Заказать
АТ Varicella zoster virus (VZV) IgM, кровь кровь 5 рабочих дней* Заказать
АТ Вирус Эпштейна-Барр (капсидный антиген) IgM, кровь кровь 10 рабочих дней* Заказать
АТ Вирус Эпштейна-Барр (ранний антиген EA) IgG, кровь кровь 10 рабочих дней* Заказать
АТ Вирус Эпштейна-Барр (ядерный антиген NA) IgG, кровь кровь 10 рабочих дней* Заказать
АТ к HBcAg IgG, кровь кровь 10 рабочих дней* Заказать
АТ к HBcAg IgM, кровь кровь 10 рабочих дней* Заказать
АТ к HBcAg суммарные, кровь кровь 10 рабочих дней* Заказать
АТ к B. pertussis (коклюш) IgA (кач.), кровь кровь 14 рабочих дней* Заказать
АТ к B. pertussis (коклюш) IgG Ед/мл, кровь кровь 14 рабочих дней* Заказать
АТ к B. pertussis (коклюш) IgM, (кач.), кровь кровь 14 рабочих дней* Заказать
АТ к Borrelia burgdorferi s.l., IgG, кровь кровь 1 рабочий день* Заказать
АТ к Candida, IgA, кровь * Заказать
АТ к Candida, IgG, кровь кровь 10 рабочих дней* Заказать
АТ к Candida, IgM, кровь * Заказать
АТ к H. pylori IgG колич. (Siemens), кровь кровь 1 рабочий день* Заказать
АТ к HAV IgG, Cito!, кровь кровь 1 рабочий день* Заказать
АТ к HAV IgM, Cito!, кровь кровь 1 рабочий день* Заказать
АТ к HbeAg, кровь кровь 10 рабочих дней* Заказать
АТ к HbsAg качественно, кровь кровь 10 рабочих дней* Заказать
АТ к HbsAg количественно, кровь, МЕ/мл * Заказать
АТ к HCV IgG авидность, кровь, % кровь 10 рабочих дней* Заказать
АТ к HCV IgM, кровь кровь 10 рабочих дней* Заказать
АТ к HCV подтверждающий тест кровь 10 рабочих дней* Заказать
АТ к HCV суммарные (скрининг!), кровь кровь 10 рабочих дней* Заказать
АТ к HCV суммарные Cito!, кровь кровь 10 рабочих дней* Заказать
АТ к HDV сумм. , кровь * Заказать
АТ к HDV суммарные, Cito!, кровь кровь 10 рабочих дней* Заказать
Ат к HEV, IgG, кровь кровь 10 рабочих дней* Заказать
Ат к HEV, IgM, кровь кровь 10 рабочих дней* Заказать
АТ к HGV IgG, скрининг, кровь кровь 15 рабочих дней* Заказать
АТ к Mycobacterium tuberculosis Cito!, кровь кровь 1 рабочий день* Заказать
АТ к Treponema pallidum IgG, качественно Заказать
АТ к Treponema pallidum, суммарные, качественно кровь 10 рабочих дней* Заказать
АТ к Yersinia enterocolitica (факторы вирулентности) IgG Ед/Мл (количественно), кровь кровь 15 рабочих дней* Заказать
Ат к Yersinia Enterocolitica + Pseudotuberculosis IgA, кровь * Заказать
Ат к Yersinia Enterocolitica + Pseudotuberculosis IgG, кровь * Заказать
Ат к Yersinia Enterocolitica + Pseudotuberculosis IgM, кровь * Заказать
АТ к антигенам HCV * Заказать
АТ к аскариде IgG скрининг, кровь кровь 10 рабочих дней* Заказать
АТ к аскариде IgG титр, кровь кровь 10 рабочих дней* Заказать
АТ к аспергилле сумм. титр, кровь * Заказать
АТ к аспергилле, IgG, кровь кровь 10 рабочих дней* Заказать
АТ к вирусу кори IgG (количественно) кровь 9 рабочих дней* Заказать
АТ к вирусу кори IgM (качественно) * Заказать
Ат к вирусу паротита, IgG, кровь кровь 9 рабочих дней* Заказать
Ат к вирусу паротита, IgM, кровь кровь 9 рабочих дней* Заказать
АТ к вирусу ТТ (торкутенувирус гепатита неясной этиологии) IgG, кровь * Заказать
АТ к ВИЧ, кровь, cito * Заказать
Ат к возбудителю бруцеллеза IgA, кровь * Заказать
Ат к возбудителю бруцеллеза IgG, кровь кровь 11 рабочих дней* Заказать
Ат к возбудителю бруцеллеза IgM, кровь * Заказать
АТ к гельминтам кровь 10 рабочих дней* Заказать
АТ к глиадину кровь 10 рабочих дней* Заказать
АТ к краснухе IgG (Siemens), кровь, МЕ/мл кровь 1 рабочий день* Заказать
АТ к краснухе IgG авидность, кровь, % кровь 1 рабочий день* Заказать
АТ к краснухе IgM (ИФА), кровь Заказать
АТ к краснухе IgM, кровь кровь 1 рабочий день* Заказать
АТ к лямблиям IgM, кровь кровь 10 рабочих дней* Заказать
АТ к лямблиям сумм. скрининг, кровь кровь 10 рабочих дней* Заказать
АТ к лямблиям сумм. титр, кровь кровь 10 рабочих дней* Заказать
АТ к Описторхису IgG скрининг, кровь кровь 10 рабочих дней* Заказать
АТ к Описторхису IgG титр, кровь кровь 10 рабочих дней* Заказать
АТ к Сlonorchis sinensis IgG (китайской двуустке) скрининг, кровь кровь 10 рабочих дней* Заказать
АТ к Сlonorchis sinensis IgG (китайской двуустке) титр, кровь кровь 10 рабочих дней* Заказать
Ат к сальмонеллам, кровь кровь 11 рабочих дней* Заказать
АТ к токсокарам IgG скрининг, кровь кровь 10 рабочих дней* Заказать
АТ к токсокарам IgG титр, кровь кровь 10 рабочих дней* Заказать
АТ к трихинелле IgG, кровь кровь 10 рабочих дней* Заказать
АТ к трихинелле IgG, титр, кровь кровь 10 рабочих дней* Заказать
АТ к трихинелле IgМ, кровь кровь 10 рабочих дней* Заказать
АТ к эхинококку, кровь кровь 10 рабочих дней* Заказать
АТ к эхинококку, титр, кровь кровь 10 рабочих дней* Заказать
АТ ЦМВ IEA (предранний белок) кровь 10 рабочих дней* Заказать
АТ ЦМВ IgG (титр), кровь кровь 10 рабочих дней* Заказать
АТ ЦМВ IgG авидность, кровь, % кровь 10 рабочих дней* Заказать
АТ ЦМВ IgG количественно, кровь, РЕ/мл кровь 10 рабочих дней* Заказать
АТ ЦМВ IgG, кровь кровь 10 рабочих дней* Заказать
АТ ЦМВ IgM, кровь кровь 10 рабочих дней* Заказать
Наименование Биоматериал Срок
Биоценоз * Заказать
Биоценоз (G. vag., Atop.vag., Lactobact., бакмасса) количественно соскоб 4 рабочих дня* Заказать
Генетика Метаболизма Лактозы кровь 5 рабочих дней* Заказать
Генетика Метаболизма Фолатов кровь 5 рабочих дней* Заказать
Генотипирование HCV, кровь кровь 10 рабочих дней* Заказать
ДНК Atopobium vagine, соскоб (PCR real time) * Заказать
ДНК C.alb./C.glabr./C.crusei качественно соскоб 1 рабочий день* Заказать
ДНК Candida (C.albicans, C.glabrata, C.krusei, C.parapsilosis и C.tropicalis) количественно, соскоб * Заказать
ДНК Candida albicans, кровь кровь 1 рабочий день* Заказать
ДНК Candida albicans, соскоб соскоб 1 рабочий день* Заказать
ДНК Chl. trach./N.gonorr./M.genit./Tr.vag. соскоб 1 рабочий день* Заказать
ДНК Chlamydia trachomatis, количественно, соскоб (PCR real time) * Заказать
ДНК Chlamydia trachomatis, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Cytomegalovirus (CMV), кровь (PCR real time) кровь 5 рабочих дней* Заказать
ДНК Cytomegalovirus (CMV), ликвор (PCR real time) ликвор 5 рабочих дней* Заказать
ДНК Cytomegalovirus (CMV), соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Gardn. vaginalis / Lactobacillus spp. количественно, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Gardnerella vaginalis, соскоб соскоб 1 рабочий день* Заказать
ДНК H. pylori, биоптат слизистой оболочки желудка * Заказать
ДНК H.pylori, кал кал 1 рабочий день* Заказать
ДНК HBV (вирус гепатита B), кровь (PCR real time) кровь 5 рабочих дней* Заказать
ДНК HBV, копий/мл (PCR real time) кровь 15 рабочих дней* Заказать
ДНК Herpes simplex I, II, кровь кровь 5 рабочих дней* Заказать
ДНК Herpes simplex I, II, ликвор ликвор 5 рабочих дней* Заказать
ДНК Herpes simplex I, II, соскоб соскоб 1 рабочий день* Заказать
ДНК Herpes simplex I, II, типирование, кровь * Заказать
ДНК Herpes simplex I, II, типирование, соскоб * Заказать
ДНК HPV 16/18 количественно, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК HPV 16/18 количественно, соскоб (PCR real time) * Заказать
ДНК HPV 6, 11, соскоб соскоб 3 рабочих дня* Заказать
ДНК HPV ВКР скрининг количественно, соскоб соскоб 3 рабочих дня* Заказать
ДНК HPV высокого онкогенного риска (тип 16,18,31,33,35,39,45,51,52,56,58,59) типирование, соскоб соскоб 3 рабочих дня* Заказать
ДНК HPV высокого онкогенного риска тип 16, соскоб соскоб 3 рабочих дня* Заказать
ДНК HPV высокого онкогенного риска тип 18, соскоб соскоб 3 рабочих дня* Заказать
ДНК HPV скрининг высокого онкогенного риска (тип 16,18,31,33,35,39,45,52,58,59,67), соскоб соскоб 3 рабочих дня* Заказать
ДНК Mycoplasma genitalium, количественно, соскоб (PCR real time) * Заказать
ДНК Mycoplasma genitalium, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Mycoplasma hominis, количественно, соскоб (PCR real time) * Заказать
ДНК Mycoplasma hominis, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Mycoplasma pneumoniae/Chlamydophila pneumoniae, мокрота (PCR real time) Заказать
ДНК Neisseria gonorrhoeae, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Trichomonas vaginalis, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Ur. parv./Ur.ur./M.hom. количественно соскоб 1 рабочий день* Заказать
ДНК Ureaplasma parvum, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Ureaplasma spp. количественно, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Ureaplasma urealyticum (T960) + Ureaplasma parvum, соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК Ureaplasma urealyticum (T960), соскоб (PCR real time) соскоб 1 рабочий день* Заказать
ДНК вируса Varicella zoster (VZV), кровь кровь 5 рабочих дней* Заказать
ДНК вируса Varicella zoster (VZV), ликвор ликвор 5 рабочих дней* Заказать
ДНК вируса Varicella zoster (VZV), соскоб * Заказать
ДНК вируса герпеса тип VI, кровь кровь 1 рабочий день* Заказать
ДНК вируса герпеса тип VI, соскоб соскоб 1 рабочий день* Заказать
ДНК вируса Эпштейна-Барр количественно, кровь (PCR real time) кровь 1 рабочий день* Заказать
ДНК вируса Эпштейна-Барра (EBV), кровь кровь 1 рабочий день* Заказать
ДНК вируса Эпштейна-Барра (EBV), соскоб соскоб 1 рабочий день* Заказать
ДНК коклюша, паракоклюша и бронхисептикоза, мокрота (PCR real time) Заказать
КардиоГенетика Гипертония кровь * Заказать
КардиоГенетика Тромбофилия кровь 5 дней* Заказать
Полиморфизм гена BRCA, PCR real-time, кровь кровь 2 рабочих дня. * Заказать
Полиморфизм гена IL28B, PCR real-time, кровь * Заказать
РНК HCV, кровь, копий/мл кровь 15 рабочих дней* Заказать
РНК HDV, кровь кровь 5 рабочих дней* Заказать
РНК HGV, кровь кровь 5 рабочих дней* Заказать
РНК HСV (вирус гепатита С), кровь кровь 5 рабочих дней* Заказать
УБП-8 мазок 7 рабочих дней* Заказать
ФармакоГенетика Варфарин * Заказать
Фемофлор 4(G.vag., Candida spp. , Lactobact., бакмасса) количественно * Заказать
Фемофлор 8(gard vag, cand sp, lactob, strept., myc hom., eubact, enterobac, б/масса), количественно * Заказать
Наименование Биоматериал Срок
Аденовирус респираторный (Adenovirus Ag), ИХА-скрининг, мазок, аспират * Заказать
Аллоиммунные антитела (включая антитела к Rh-антигену) Заказать
БАК исследование кала на возбудителя Дизентерии (Shigella spp.) Заказать
Бак. посев отделяемое влагалища, уретры, цервикального канала, стенки глотки и любая другая биологическая среда. 10 рабочих дней* Заказать
Бакпосев мокроты * Заказать
Бакпосев мочи с определением чувствительности к антибиотикам моча 10 рабочих дней* Заказать
Бакпосев на стафилококк * Заказать
Бакпосев отделяемого зева * Заказать
Бакпосев отделяемого урогенитального тракта с определением чувствительности к антибиотикам отделяемое урогенитального тракта 10 рабочих дней* Заказать
Гомоцистеин, кровь, мкмоль/л кровь 13 рабочих дней* Заказать
Гриппа вирус А/В (Influenza Ag А/В), ИХА-скрининг, мазок, аспират * Заказать
Грудное молоко на стерильность — одна проба Грудное молоко 10 рабочих дней* Заказать
Группа крови и резус-фактор (метод колоночной агглютинаций) Заказать
Забор крови на дому I Заказать
Забор крови на дому II Заказать
Забор крови с иглой бабочкой Заказать
Забор материала (в т. ч. контейнер с транспортной средой) * Заказать
Забор материала (Исполнитель ГКБ №7) Заказать
Забор материала на бакпосев * Заказать
Исследование на кандидамикоз отделяемое влагалища, уретры, цервикального канала, стенки глотки и любая другая биологическая среда. 10 рабочих дней* Заказать
Кал на дисбактериоз кал 10 рабочих дней* Заказать
Кал на кишечные инфекции кал 10 рабочих дней* Заказать
Кал на скрытую кровь (Иммунохроматография, Германия) кал 5 рабочих дней* Заказать
Кал на яйца гельминтов кал 2 рабочих дня* Заказать
Кальпротектин (количественно), кал, мкг/г кал 1 рабочий день* Заказать
Копрограмма кал 5 рабочих дней* Заказать
Лимонная кислота, фруктоза * Заказать
Мазок на онкоцитологию мазок из шейки матки 5-7 рабочих дней* Заказать
Мазок на флору мазок из влагалища у женщин, из уретры – у мужчин. 2 рабочих дня* Заказать
Мазок на флору гинекологический Заказать
Мазок на флору урологический Заказать
Микроскопия секрета простаты * Заказать
Моча на степень бактериурии моча 10 рабочих дней* Заказать
Посев мокроты * Заказать
Посев на дисбактериоз * Заказать
Посев на уреамикоплазму с определением чувствительности к антибиотикам * Заказать
Респираторно-синцитиальный вирус (RSA), ИХА-скрининг, мазок, аспират * Заказать
Скрининг 6 наркотических веществ и метаболитов, моча * Заказать
Соскоб с языка на кандиды (микроскопия) соскоб с языка 10 рабочих дней* Заказать
Стрептококк А (Strep-A Ag), ИХА-скрининг, мазок, аспират * Заказать
Типирование HLA II класса локус DQA1 кровь 14 рабочих дней* Заказать
Типирование HLA II класса локус DQB1 кровь 14 рабочих дней* Заказать
Типирование HLA II класса локус DRB1 кровь 14 рабочих дней* Заказать
ФНО (фактор некроза опухоли), кровь, пг/мл кровь 10 рабочих дней* Заказать
Цитологическое исследование материала ТАБ аспират содержимого узловых образований щитовидной железы 2(рабочих) дня * Заказать
Чувствительность к антибиотикам любой биологический материал (отделяемое влагалища, уретры, цервикального канала, стенки глотки и т. д.). 10 рабочих дней* Заказать
Чувствительность к антибиотикам (моча) * Заказать
Чувствительность к антимикотикам любой биологический материал (отделяемое влагалища, уретры, цервикального канала, стенки глотки и т.д.). 10 рабочих дней* Заказать
Чувствительность к антисептикам * Заказать
Чувствительность к бактериофагам * Заказать
Эластаза-1 панкреатическая (количественно), кал, мкг Э/г кал 14 рабочих дней* Заказать
Эритропоэтин, кровь, мМЕ/мл кровь 9 рабочих дней* Заказать
Наименование Биоматериал Срок
Выдача повторного снимка * Заказать
Дополнительное контрастирование * Заказать
МРТ артерий головного мозга в день обращения, в течении часа* Заказать
МРТ артерий шеи в день обращения, в течении часа* Заказать
МРТ брюшной полости и холангиография в день обращения, в течении часа* Заказать
МРТ вен головного мозга в день обращения, в течении часа* Заказать
МРТ гипофиза в день обращения, в течении часа* Заказать
МРТ глазных орбит и зрительного нерва в день обращения, в течении часа* Заказать
МРТ головного мозга в день обращения, в течении часа* Заказать
МРТ грудного отдела позвоночника в день обращения, в течении часа* Заказать
МРТ исследование одного сустава в день обращения, в течении часа* Заказать
МРТ исследование стопы в день обращения, в течении часа* Заказать
МРТ исследоование кисти в день обращения, в течении часа* Заказать
МРТ копчика в день обращения, в течении часа* Заказать
МРТ краниовертебрального перехода в день обращения, в течении часа* Заказать
МРТ крестца и копчика в день обращения, в течении часа* Заказать
МРТ крестцово-подвздошных сочленениий в день обращения, в течении часа* Заказать
МРТ мягких тканей в день обращения, в течении часа* Заказать
МРТ органов брюшной полости в день обращения, в течении часа* Заказать
МРТ органов забрюшинного пространства (почки, надпочечники) в день обращения, в течении часа* Заказать
МРТ органов малого таза в день обращения, в течении часа* Заказать
МРТ органов средостения в день обращения, в течении часа* Заказать
МРТ печени в день обращения, в течении часа* Заказать
МРТ плюсне-фаланговых суставов в день обращения, в течении часа* Заказать
МРТ поджелудочной железы в день обращения, в течении часа* Заказать
МРТ пояснично-крестцового отдела позвоночника в день обращения, в течении часа* Заказать
МРТ придаточных пазух носа в день обращения, в течении часа* Заказать
МРТ пястно-фаланговых суставов в день обращения, в течении часа* Заказать
МРТ тазобедренных суставов в день обращения, в течении часа* Заказать
МРТ шейного отдела позвоночника в день обращения, в течении часа* Заказать
МРТ щитовидной железы в день обращения, в течении часа* Заказать
МРТ щитовидной железы и слюнных желез в день обращения, в течении часа* Заказать
Наименование Биоматериал Срок
Доплерография полового члена на УЗ-томографе * Заказать
Дублексное сканирование брахиоцефальных артерий (шея+голова) Заказать
Дублексное сканирование брахицефальных артерий (голова) Заказать
Дублексное сканирование брахицефальных артерий (шея) Заказать
Нейросонография (дети до 1 года) * Заказать
Обследование новорожденного до 1 мес. (нейросонография,брюшная полость,тазобедренные суставы,сердце) Заказать
Снимок УЗИ Заказать
Транскраниальная доплерография * Заказать
Транскраниальное дублексное сканирование (ТКДС) Заказать
Транскраниальное дублексное сканирование (ТКДС) + поворотные пробы Заказать
Триплексное сканирование почечных артерий с ЦДК * Заказать
Триплексное сканирование почечных вен с ЦДК * Заказать
УЗДГ беременных Заказать
УЗДГ брюшной аорты и ее висцеральных ветвей с ЦДК * Заказать
УЗДГ брюшной аорты и подвздошных артерий с ЦДК * Заказать
УЗДГ нижней полой вены с ЦДК * Заказать
УЗДГ почечных артерий с ЦДК * Заказать
УЗДГ почечных вен с ЦДК * Заказать
УЗДС с ЦДК артерий верхних конечностей * Заказать
УЗДС с ЦДК артерий нижних конечностей * Заказать
УЗДС с ЦДК брахиоцефальных артерий (БЦА) * Заказать
УЗДС с ЦДК брюшной аорты и ее висцеральных ветвей Заказать
УЗДС с ЦДК брюшной аорты и подвздошных артерий Заказать
УЗДС с ЦДК вен верхних конечностей * Заказать
УЗДС с ЦДК вен нижних конечностей * Заказать
УЗДС с ЦДК нижней полой вены Заказать
УЗДС с ЦДК почечных артерий Заказать
УЗДС с ЦДК почечных вен Заказать
УЗИ беременных 1 триместр Заказать
УЗИ беременных 2 триместр Заказать
УЗИ беременных 3 триместр с доплером Заказать
УЗИ брюшной полости(печень,желчный пузырь,поджелудочная железа,селезенка, почки) Заказать
УЗИ брюшной полости (печень, желчный пузырь, поджелудочная железа, селезенка) * Заказать
УЗИ брюшной полости дети Заказать
УЗИ брюшной полости с ЦДК Заказать
УЗИ вилочковой железы Заказать
УЗИ голеностопных суставов и стопы * Заказать
УЗИ женских половых органов дополнительным датчиком * Заказать
УЗИ женских половых органов ТВ датчиком с ЦДК сосудов миоматозных узлов, опухолей матки и яичников * Заказать
УЗИ женских половых органов ТВ датчиком с ЦДК сосудов яичников, эндометрия, миометрия * Заказать
УЗИ женских половых органов трансабдоминальным датчиком * Заказать
УЗИ женских половых органов трансабдоминальным датчиком (врач вышей категории) Заказать
УЗИ женских половых органов трансвагинальным датчиком * Заказать
УЗИ женских половых органов трансвагинальным датчиком (врач высшей категории) Заказать
УЗИ кава-фильтра с ЦДК * Заказать
УЗИ коленных суставов * Заказать
УЗИ коленных суставов (2 сустава) Заказать
УЗИ лимфатических узлов дети Заказать
УЗИ лимфоузлов * Заказать
УЗИ локтевых суставов * Заказать
УЗИ лучезапястных суставов и мелких суставов кистей * Заказать
УЗИ малого таза дети Заказать
УЗИ мелких суставов стоп Заказать
УЗИ молочных желез * Заказать
УЗИ молочных желез (дети) Заказать
УЗИ мочевого пузыря с определением остаточной мочи * Заказать
УЗИ мошонки дети Заказать
УЗИ мошонки с доплером * Заказать
УЗИ мягких тканей * Заказать
УЗИ печени и желчного пузыря * Заказать
УЗИ печени и желчного пузыря с определением функции * Заказать
УЗИ пищевода и желудка Заказать
УЗИ плевральной полости Заказать
УЗИ плечевых суставов * Заказать
УЗИ плода * Заказать
УЗИ плода 4D с записью на DVD * Заказать
УЗИ плода с исследованием кровотока * Заказать
УЗИ поджелудочной железы * Заказать
УЗИ полового члена на УЗИ-томографе * Заказать
УЗИ почек и мочевыводящих путей с доплером дети Заказать
УЗИ почек и надпочечников * Заказать
УЗИ почек, надпочечников дети Заказать
УЗИ почек, надпочечников, мочевого пузыря и предстательной железы * Заказать
УЗИ предстательной железы и мочевого пузыря с определением остаточной мочи * Заказать
УЗИ предстательной железы трансректальным датчиком * Заказать
УЗИ селезенки * Заказать
УЗИ сердца * Заказать
УЗИ сердца дети Заказать
УЗИ слюнной железы Заказать
УЗИ суставов (2 суставов) дети Заказать
УЗИ тазобедренных суставов * Заказать
УЗИ тазобедренных суставов (дети до 1 года) * Заказать
УЗИ тазобедренных суставов дети Заказать
УЗИ щитовидной железы * Заказать
УЗИ щитовидной железы дети Заказать
УЗИ яичек * Заказать
УЗИ яичек (старше 12 лет) * Заказать
Фолликулометрия * Заказать
Экстракраниальное триплексное сканирование венозной системы головного мозга * Заказать
Наименование Биоматериал Срок
17-кетостероиды, моча, мг/сут моча (суточная) 5 рабочих дней* Заказать
17-ОН прогестерон (ИФА), кровь, нг/мл кровь 5 рабочих дней* Заказать
D-димер, кровь, нг FEU/мл кровь 1 рабочий день* Заказать
N-терминальный фрагмент мозгового натрийуретического пептида (NTproBNP) кровь 7 рабочих дней* Заказать
PAPP-A (плазменный белок А, ассоциированный с беременностью) кровь 10 рабочих дней* Заказать
АКТГ (Siemens), кровь, пг/мл кровь 1 рабочий день* Заказать
Альбумин/креатинин, моча 1 рабочий день* Заказать
Альдостерон (ИФА), кровь, пг/мл кровь 5 рабочих дней* Заказать
Андростендион (Siemens), кровь, нг/мл кровь 10 рабочих дней* Заказать
Анти-ТГ (Siemens), кровь, МЕ/мл кровь 1 рабочий день* Заказать
Анти-ТПО (Siemens), кровь, МЕ/мл кровь 1 рабочий день* Заказать
Антимюллеров гормон (MIS/AMH), кровь, нг/мл кровь 1 рабочий день* Заказать
АТ к декарбоксилазе глутаминовой кислоты (AT-GAD), кровь кровь 14 рабочих дней* Заказать
АТ к рецепторам ТТГ, кровь, МЕ/л кровь 10 рабочих деней* Заказать
Вальпроевая кислота (Siemens), кровь, мкг/мл кровь 1 рабочий день* Заказать
Ванилилминдальная кислота, моча, мг/24 ч моча (суточная) 2 рабочих дня* Заказать
Витамин В12, плазма, пг/мл кровь 1 рабочий день* Заказать
Витамин Д (25-ОН), нг/мл * Заказать
Гликоделин, кровь, нг/мл кровь 14 рабочих дней* Заказать
Гликозилированный гемоглобин (HbA1c), кровь, % кровь 5 рабочих дней* Заказать
Глобулин, связывающий половые гормоны (Siemens), кровь, нМоль/л кровь 1 рабочий день* Заказать
Гомованилиновая кислота (HVA, моча), мг/сутки суточная моча 1 месяц* Заказать
Гомоцистеин (Siemens), кровь, мкмоль/л Заказать
ДГЭА (дегидроэпиандростерон), кровь, ИФА, нг/мл Заказать
Дезоксипиридинолин (ДПИД, Pyrilinks-D, Siemens), моча моча 1 рабочий день* Заказать
Дезоксипиридинолин, нМоль/мМоль креатинина, моча моча 1 рабочий день* Заказать
ДЭАС (дегидроэпиандостерон сульфат) (Siemens), мкг/дл кровь 1 рабочий день* Заказать
Ингибин В, кровь, пг/мл кровь 1 рабочий день* Заказать
Индекс свободных андрогенов кровь 1 рабочий день* Заказать
Инсулин (Siemens), кровь, мкМЕ/мл кровь 1 рабочий день* Заказать
Кальцитонин (Siemens), кровь, пг/мл кровь 1 рабочий день* Заказать
Карбамазепин (Siemens), кровь, мкг/мл кровь 1 рабочий день* Заказать
Кортизол (Siemens), кровь, мкг/дл кровь 1 рабочий день* Заказать
Кортизол свободный, моча, мкг/сут моча 15 рабочих дней* Заказать
Креатинин, моча, мМоль/л моча 1 рабочий день* Заказать
КФК МВ mass (Siemens), кровь, мкг/дл кровь 1 рабочий день* Заказать
ЛГ (Siemens), кровь, мМЕ/мл кровь 1 рабочий день* Заказать
Лептин, кровь, нг/мл кровь 19 рабочих дней* Заказать
Макропролактин, кровь, нг/мл кровь 1 рабочий день* Заказать
Мета-комби (Метанефрин+Норметанефрин), моча, мг/сутки моча (суточная) 14 рабочих дней* Заказать
Микроальбуминурия (Siemens), мкг/мин моча 1 рабочий день* Заказать
Остеокальцин (Siemens), кровь, нг/мл кровь 1 рабочий день* Заказать
Остеокальцин (ИФА), кровь, нг/мл Заказать
Паратгормон (Siemens), пг/мл кровь 1 рабочий день* Заказать
Пепсиногены I и II кровь 1 рабочий день* Заказать
Плацентарный лактоген, кровь, мг/л кровь 19 рабочих дней* Заказать
Прогестерон (Siemens), кровь, нг/мл кровь 1 рабочий день* Заказать
Проинсулин, кровь, пмоль/л кровь 19 рабочих дней* Заказать
Пролактин (Siemens), кровь, нг/мл кровь 1 рабочий день* Заказать
Ренин + ангиотензин I кровь 12 рабочих дней* Заказать
Ренин прямой, кровь, мкМЕ/мл кровь 12 рабочих дней* Заказать
С-пептид (Siemens), нг/мл кровь 1 рабочий день* Заказать
Соматомедин (инсулиноподобный фактор роста, IGF-1), сыворотка, нг/мл кровь 1 рабочий день* Заказать
Соматотропин (Siemens), кровь, нг/мл кровь 1 рабочий день* Заказать
Стимулирующие АТ-рТТГ , кровь, МЕ/л кровь 14 рабочих дней* Заказать
Т3 общий (Advia Siemens), кровь, нг/дл Кровь 1 рабочий день* Заказать
Т3 общий (Immulite Siemens), кровь, нг/дл кровь 1 рабочий день* Заказать
Т3 свободный (Advia Siemens), кровь, пг/мл кровь 1 рабочий день* Заказать
Т4 общий (Advia Siemens), кровь, мкг/дл кровь 1 рабочий день* Заказать
Т4 общий (Immulite Siemens), кровь, мкг/дл кровь 1 рабочий день* Заказать
Т4 свободный (Advia Siemens), кровь, нг/дл кровь 1 рабочий день* Заказать
Т4 свободный (Immulite Siemens), кровь, нг/дл кровь 1 рабочий день* Заказать
Т4 свободный (Immulite Siemens), кровь, пМоль/л Заказать
Тестестерон свободный (Siemens), кровь, % * Заказать
Тестостерон (Siemens), кровь, нг/дл кровь 1 рабочий день* Заказать
Тестостерон биодоступный, кровь, % * Заказать
Тестостерон свободный, кровь, пг/мл кровь 15 рабочих дней* Заказать
Тиреоглобулин (Siemens), кровь, нг/мл кровь 1 рабочий день* Заказать
Тропонин I (Siemens), кровь, нг/мл кровь 1 рабочий день* Заказать
ТТГ (Immulite 2000 Siemens), кровь, мкМЕ/мл кровь 1 рабочий день* Заказать
ТТГ 3-я генер. (Immulite 2000 Siemens), кровь, мкМЕ/мл кровь 1 рабочий день* Заказать
Фолиевая кислота, плазма, нг/мл кровь 1 рабочий день* Заказать
Фолиевая кислота, цельная кровь, нг/мл кровь 1 рабочий день* Заказать
Фолиевая кислота, эритроциты, нг/мл кровь 1 рабочий день* Заказать
ФСГ (Siemens), кровь, мМЕ/мл кровь 1 рабочий день* Заказать
ХГЧ (Siemens), кровь, мМЕ/мл кровь 1 рабочий день* Заказать
ХГЧ (Siemens), моча, мМЕ/мл моча 1 рабочий день* Заказать
Эстрадиол (Siemens), кровь, пг/мл кровь 1 рабочий день* Заказать

почему низкий тестостерон у мужчин

почему низкий тестостерон у мужчин

почему низкий тестостерон у мужчин

>>>ПЕРЕЙТИ НА ОФИЦИАЛЬНЫЙ САЙТ >>>

Что такое почему низкий тестостерон у мужчин?

Тестостерон — это стероидный гормон из группы андрогенов и самый важный мужской гормон. Если вы хотите быть сильным альфа-самцом, полным силы, харизмы и уверенности в себе, вам нужно достаточно тестостерона. Дефицит тестостерона у мужчин — печальная тенденция. Год за годом естественный уровень тестостерона у естественного мужчины стремительно снижается. Например, в 2013 году оптимальный предел тестостерона был установлен в пределах 300 — 1070 нг/дл. Но если мы оглянемся на 100 лет назад, то в то время был зафиксирован средний уровень около 800 — 2000 нг/ дл. Это означает, что мужчины с «низким уровнем тестостерона» 100 лет назад считались бы мужчинами с высоким уровнем гормона сегодня. Как поднять тестостерон? Это может сделать каждый! Приходи на курс Тестостерон Мах и узнай как это сделать. На курсе ты получишь знания, способные изменить всю твою жизнь и сделать тебя альфа самцом (даже по меркам прошлого века)

Эффект от применения почему низкий тестостерон у мужчин

И если ты не умеешь управлять своим тестостероном или даже не пытаешься этого делать, то твое тело медленно, но верно превращает тебя в женщину, все больше снижая уровень этого гормона в организме. Приходи на курс Тестостерон Мах и узнай как всегда оставаться в форме.

Мнение специалиста

Мощь тестостерона почти легендарная, и это не удивительно: он способствует росту мышц и сжиганию жира, а также облагает целой кучей других преимуществ, в том числе улучшает настроение, сон, либидо, энергию и здоровье в целом. К сожалению, после 30 лет большинство мужчин начинают испытывать постепенное снижение уровня тестостерона в организме, что подвергает их большему риску заболеваний сердца, сахарному диабету 2 типа, ожирению, низкой минеральной плотности костной ткани, нарушению половой функции, снижению мышечной массы и физической работоспособности. Изменить жизнь и повысить уровень тестостерона возможно в любом возрасте — Тестостерон Max поможет вам в этом.

Как заказать

Для того чтобы оформить заказ почему низкий тестостерон у мужчин необходимо оставить свои контактные данные на сайте. В течение 15 минут оператор свяжется с вами. Уточнит у вас все детали и мы отправим ваш заказ. Через 3-10 дней вы получите посылку и оплатите её при получении.

Отзывы покупателей:

Юля

У многих в голове тестостерон ассоциируется вообще со всем мужественным, что только существует на этом свете. Но тестостерон это не только гора мышц и густая щетина. Высокий уровень тестостерона это в первую очередь полноценное мужское здоровье. Для сохранения и поддержания мужского здоровья не достаточно ходить в зал и качать мышцы, необходим комплексный подход, состоящий в здоровом питании, в полноценном психологическом состоянии мужчины. Для улучшения состояния мужского здоровья и уровня тестостерона врачи советуют не только гормоны, но и пройти курс Тестостерон Мах. На этом курсе вы узнаете как сохранить, преумножить и поддержать свою мужскую энергию, свой уровень тестостерона.

Вика

Снижение концентрации тестостерона чревато ухудшением половой функции, умственной деятельности, метаболизма, потерей мышечной массы, силы, а также угнетенным эмоциональным состоянием. Повысить уровень тестостерона можно с помощью сбалансированного рациона, приема витаминно-минеральных комплексов и других методов. Витамины для повышения тестостерона содержатся в продуктах питания, как растительного, так и животного происхождения. Ведь не зря многие мужчины любят мясо и другую белковую пищу, вместе с которой в организм попадают витамины, повышающие тестостерон. Интересно? Пройдя курс Тестостерон Max, ты сможешь взять не только свой тестостерон под контроль, но и научишься быть властелином своей жизни.

Тестостерон — основной гормон мужского организма. Он отвечает за физическую силу, сексуальное здоровье, состояние костно-мышечной системы и эмоции. Как повысить тестостерон у мужчин, интересует каждого второго представителя сильного пола. Это не удивительно — после 35-40 лет (а иногда и раньше) уровень андрогена начинает снижаться, что прежде всего отражается на самочувствии и половой функции (либидо, эрекция, фертильность). Существуют простые и безопасные методы для поднятия гормона, которые может применять каждый мужчина. Узнать их просто – подпишись на курс Тестостерон Max и научись управлять своим мужским здоровьем. Где купить почему низкий тестостерон у мужчин? Мощь тестостерона почти легендарная, и это не удивительно: он способствует росту мышц и сжиганию жира, а также облагает целой кучей других преимуществ, в том числе улучшает настроение, сон, либидо, энергию и здоровье в целом. К сожалению, после 30 лет большинство мужчин начинают испытывать постепенное снижение уровня тестостерона в организме, что подвергает их большему риску заболеваний сердца, сахарному диабету 2 типа, ожирению, низкой минеральной плотности костной ткани, нарушению половой функции, снижению мышечной массы и физической работоспособности. Изменить жизнь и повысить уровень тестостерона возможно в любом возрасте — Тестостерон Max поможет вам в этом.
Низкий уровень тестостерона у мужчин. Тестостерон известен в народе, как основной начальник мужских качеств. От того, насколько высок его уровень в крови, будет зависеть физическая сила, крепость мышц, степень оволосения, голосовые данные.  . Тестостерон – один из наиболее важных для мужчины гормонов. Именно он определяет такие мужские черты как голос, внешность и даже некоторые поведенческие особенности. Однако не стоит задаваться вопросом, как повысить тестостерон у мужчин, если цель – стать более мужественным и привлекательным для женщин, или улучшить личную жизнь. Низкий уровень тестостерона у мужчины. Дефицит тестостерона у мужчин – причина нарушения половой функции, снижения либидо и трудностей с выработкой сперматозоидов. Низкий уровень тестостерона также повышает риск возникновения симптомов, подобных женской менопаузе. У мужчин отмечаются приливы, усталость, раздражительность. Возрастает риск развития остеопороза. . Низкий тестостерон – лечение. Есть ли необходимость лечения низкого уровня тестостерона? Большинство исследований, посвященных лечению тестостероном, указывают на улучшение либидо и сексуальной функции у мужчин с гипогонадизмом или низким уровнем мужских гормонов. Почему низкий уровень тестостерона? Пониженный уровень тестостерона – большая проблема для мужчин. И дело даже не в снижении сексуальной активности и росте пивного живота, а в том, что тестостерон во многом определяет жизненную энергию, упорство, высокий иммунитет и работоспособность (как физическую, так и умственную). Признаками снижения уровня мужского гормона являются: хроническая усталость, упадок сил, частые инфекции, раздражительность, эмоциональная нестабильность, апатия, плохой сон и т.д. и т.п. Каковы же причины снижения уровня тестостерона и можно ли вернуть его уровень к норме? Причины снижения уровня тестостерона. Из — за чего снижается тестостерон? Диагностика и лечение дефицита тестостерона (гипогонадизма) у мужчин, Общественная организац. . Рекомендации по диагностике и лечению дефицита тестостерона (гипогонадизма) у мужчин. Год разработки протокола: 2016. ОПРЕДЕЛЕНИЕ. Гипогонадизм у мужчин – это клинический и биохимический синдром, связанный с низким уровнем тестостерона, а так же нечувствительностью рецепторного аппарата к андрогенам, который может оказывать негативное воздействие на множество органов и систем, ухудшая качество жизни и жизненный прогноз. Стероидный гормон тестостерон у мужчин вырабатывается в яичках. Именно он делает из мужчин – мужчин. Оказывает биологическое действие практически на все органы и ткани. В 10-12 лет (пубертатный возраст) начинается усиленная выработка тестостерона, которая приводит к . Распространенность гипогонадизма (снижения тестостерона) у мужчин составляет 6%, а при ожирении и сахарном диабете – более 50%. В отличие от женского климакса (ступень в переводе с французского) возрастное снижение тестостерона происходит постепенно, поэтому не так остро ощущается мужчинами. Как правило, первые симптомы появляются в 50 лет, их количество нарастает как снежный ком”. Почему у мужчин возникает андрогенный дефицит: в подростковом и зрелом возрасте. Как понять, что у вас дефицит тестостерона. Методы лечения андрогенодефицита. . Андрогенный дефицит – это недостаток в организме мужчины мужского полового гормона тестостерона. Может развиваться и в подростковом, и в зрелом возрасте. Вызывает расстройства половой жизни, иногда приводит к психологическим травмам и бесплодию. Тестостерон у мужчин: где вырабатывается, почему снижается и повышается, к кому обращаться за помощью при отклонениях тестостерона от нормы — узнайте на нашем сайте. . Как удержать его в норме? Широкие плечи и низкий голос, борода и хорошо развитые мышцы… Эти, а также целый ряд других мужских признаков обеспечиваются веществом, которое мы знаем как тестостерон. О нём мы говорим с врачом-эндокринологом Клиника Эксперт Тула Макаровой Оксаной Викторовной. . Тестостерон — это стероидный мужской гормон. Но сразу оговорюсь, что вырабатывается он не только у мужчин, но и (в меньшем количестве) у женщин. Сегодня мы будем говорить о взрослых мужчинах. Тестостерон — преобладающий гормон в крови мужчины, вырабатывается преимущественно (95 %) яичками, в значительно меньших количествах — корой надпочечников; образуется из холестерина. В сутки в плазму крови выделяется около 6 мг тестостерона, незначительное количество откладывается в яичках. . Это состояние характеризуется низкой продукцией тестостерона при нормальном уровне гонадотропинов.  . Диагноз гипогонадизма у мужчин устанавливают на основании данных анамнеза, клинической картины, подтвержденной данными лабораторного и инструментального исследований. У мужчин в возрасте 20–30 лет эндокринная патология встречается относительно нечасто — почти в десять раз реже, чем у женщин. Но если уж у мужчины в молодом возрасте развивается, допустим, Базедова болезнь, то она протекает значительно тяжелее и с худшим прогнозом. Почему? Сложно сказать, четко доказанных объяснений нет. . Цифра ниже нормы. А это понятие весьма относительное, особенно для гормонов. Тот случай, когда слово норма надо поставить в большие кавычки. . Тестостерон — это анаболик мужского организма, он делает практически все то, что отличает мужчину от женщины, он способствует развитию не только половой, но и мышечной системы, мозга, даже продукции эритроцитов.
http://www.gorzow2.komornik.org/userfiles/kak_znachitelno_uvelichit_testosteron9693.xml
http://xn--42-jlclgg6a3e.xn--p1ai/userfiles/uprazhneniia_uvelichivaiushchie_testosteron9747. xml
https://tailor.ru/upload/luchshii_preparat_dlia_povysheniia_testosterona_u_muzhchin9228.xml
http://pazarnakliyecilerkooperatifi.com/userfiles/kak_vospolnit_testosteron_v_organizme3305.xml
https://www.dispatchpressimages.com/images/uploads/ne_khvataet_muzhskoi_energii6690.xml
И если ты не умеешь управлять своим тестостероном или даже не пытаешься этого делать, то твое тело медленно, но верно превращает тебя в женщину, все больше снижая уровень этого гормона в организме. Приходи на курс Тестостерон Мах и узнай как всегда оставаться в форме.
почему низкий тестостерон у мужчин
Тестостерон — это стероидный гормон из группы андрогенов и самый важный мужской гормон. Если вы хотите быть сильным альфа-самцом, полным силы, харизмы и уверенности в себе, вам нужно достаточно тестостерона. Дефицит тестостерона у мужчин — печальная тенденция. Год за годом естественный уровень тестостерона у естественного мужчины стремительно снижается. Например, в 2013 году оптимальный предел тестостерона был установлен в пределах 300 — 1070 нг/дл. Но если мы оглянемся на 100 лет назад, то в то время был зафиксирован средний уровень около 800 — 2000 нг/ дл. Это означает, что мужчины с «низким уровнем тестостерона» 100 лет назад считались бы мужчинами с высоким уровнем гормона сегодня. Как поднять тестостерон? Это может сделать каждый! Приходи на курс Тестостерон Мах и узнай как это сделать. На курсе ты получишь знания, способные изменить всю твою жизнь и сделать тебя альфа самцом (даже по меркам прошлого века)
Все способы повысить тестостерон у мужчины естественным путем: тренировки, питание, режим дня. Что делать, если эти методы не помогают. Условия приема препаратов. . Как повысить тестостерон в организме: естественные способы и препараты. 9 июля 2021. Пик выработки тестостерона в организме мужчины приходится на период с 25 до 30 лет. Затем количество гормона начинает постепенно снижаться — на 1-2% каждый год. Но уровень тестостерона может уменьшаться не только по естественным причинам. На его содержание влияют стрессы, недостаток калорий и переедание, прием лекарств, перетренированность, а также болезни, недостаток сна и алкоголь. Как повысить тестостерон и какие продукты помогают. Норма гормона у мужчин. Низкий тестостерон: что делать и как сдавать анализ. . Что делать при повышенном и пониженном уровне тестостерона? Подготовка к диагностике. Как проводится анализ? Ход исследования. Как поддержать уровень гормона? Какие продукты помогут повысить тестостерон? Гормоны ¾ главные регуляторы обмена веществ в организме человека. Эндокринная система человека ¾ сложный механизм, который контролирует разные функции систем и органов человека благодаря биологическим веществам, обладающим высокой активностью ¾ гормонам. Тестостерон — это стероидный гормон из группы андрогенов и самый важный мужской гормон. Если вы хотите быть сильным альфа-самцом, полным силы, харизмы и уверенности в себе, вам нужно достаточно тестостерона. Дефицит тестостерона у мужчин — печальная тенденция. Год за годом естественный уровень тестостерона у естественного мужчины стремительно снижается. Например, в 2013 году оптимальный предел тестостерона был установлен в пределах 300 — 1070 нг/дл. Но если мы оглянемся на 100 лет назад, то в то время был зафиксирован средний уровень около 800 — 2000 нг/ дл. Норма тестостерона у женщин и мужчин. Нормальные показатели этого гормона меняются в разном возрасте: Пол (возраст). . Имбирь Имбирь может увеличить уровень тестостерона и повысить мужскую фертильность. Люди давно используют имбирь в лечебных и кулинарных целях. Современные исследования показывают, что этот корень может улучшить фертильность мужчин. . Однако важно помнить, что витамин D необходим для общего здоровья. Зеленые листовые овощи Овощи, такие как шпинат, швейцарский мангольд и капуста, богаты магнием — минералом, который повышает уровень тестостерона. Однако не стоит задаваться вопросом, как повысить тестостерон у мужчин, если цель – стать более мужественным и привлекательным для женщин, или улучшить личную жизнь. Дело в том, что избыток тестостерона вызывает обратную реакцию – мужчина теряет половое влечение и потенцию. Повышать уровень тестостерона следует только в том случае, если его недостаток показывают анализы. Роль тестостерона в мужском организме. . Забор крови производится в утренние часы, так как это время показатели уровня тестостерона наиболее адекватны и сопоставимы с общим самочувствием. В некоторых случаях назначается исследование костной ткани. Тестостерон — основной мужской половой гормон, который присутствует как у мужчин, так и у женщин. Значение и влияние тестостерона тяжело переоценить. В любом организме он должен быть: норма его для мужчин и женщин отличается, но без него здоровое половое развитие невозможно. Связанный + свободный тестостерон = общий тестостерон. Общий тестостерон состоит из: 2% гормона в свободном (несвязанном) состоянии; 44% гормона, связанного глобулином (ГСПГ) . Как повысить тестостерон у мужчин, мы рассмотрим дальше. У женщин, наоборот, чаще встречается избыток этого гормона. Он провоцирует избыточный рост темных, жестких и длинных волос по мужскому типу (на лице, груди и так далее). Тестостерон – мужской половой гормон, который отвечает за развитие половых желез и вторичных половых признаков, защищает организм от многих заболеваний. Его уровень может снижаться по разным причинам. Увеличить содержание этого гормона можно не только с помощью лекарственных средств, но и естественными способами. О том, как повысить уровень тестостерона у мужчин, пойдет речь в этой статье. Содержание. . В норме показатель уровня общего тестостерона для мужчин 20-50 лет составляет 11-33 нмоль/л, для мужчин от 50 лет и старше – не ниже 11. Уровень свободного тестостерона для первой категории колеблется в пределах 8,8-42,5 нмоль/л, для второй – от 6,5 до 30. Тестостерон — это анаболик мужского организма, он делает практически все то, что отличает мужчину от женщины, он способствует развитию не только половой, но и мышечной системы, мозга, даже продукции эритроцитов. Без него мужчина превращается в евнуха — тонкий голосок, отсутствие оволосения, дряблая мышечная система, ожирение, животик.  . Исследований, которые изучали назначение тестостерона мужчинам более старшего возраста, во-первых, не так много, во-вторых, они не такие длительные. . Во-первых, мужик выспался. Во-вторых, мы привели в порядок какие-то общие показатели. И через две недели у него тестостерон уже в норме! Широкие плечи и низкий голос, борода и хорошо развитые мышцы… Эти, а также целый ряд других мужских признаков обеспечиваются веществом, которое мы знаем как тестостерон. О нём мы говорим с врачом-эндокринологом Клиника Эксперт Тула Макаровой Оксаной Викторовной. Кроме того, у мужчин, со стабильно более высоким уровнем тестостерона в крови, обычно короткие и кривые ноги, очень волосатое тело, зато на голове волос мало, они быстро лысеют. Короче говоря, не стоит хвататься за банку с гормонами, если вы вдруг решили стать настоящим мачо и соблазнять женщин одним своим животным взглядом первобытного самца. Но вот повысить немного уровень тестостерона бывает полезно, особенно тем мужчинам, которые и сами ощущают его нехватку. Она может напрямую влиять не только на снижение либидо и полового влечения, но также повышает раздражительность, снижает память, когнитивные функции, приводит к депрессии и бессоннице, даже остеопорозу.

что это такое, норма и нарушения

Значение гормональных веществ для организма мужчины трудно переоценить. Ведь они регулируют все химические процессы нашего тела. Однако излишек андрогенов и эстрадиола так же опасен, как и их дефицит. Поэтому для подавления излишней активности половых гормонов, а также для их транспортировки по крови природа предусмотрела наличие белка (ГСПГ). Его норма и возможные отклонения отражены в нашей статье.

Роль в организме мужчины

ГСПГ – не единственное название этого полезного белка. На медицинских бланках он может обозначаться и под другой аббревиатурой:

  • СССГ – секс-стероид связывающий глобулин.
  • ТЭСГ – тестостерон эстрадиол связывающий глобулин.
  • ПССГ – половой стероид связывающий глобулин.
  • ГСПС – гормон, связывающий половые стероиды.

ГСПГ расшифровывается как «глобулин, связывающий половые гормоны». Он вырабатывается в печени и используется организмом для транспортировки по крови тестостерона и эстрадиола. При повышении количества эстрадиола увеличивается продуцирование ГСПГ, а повышение концентрации андрогенов вызывает понижающий эффект. Именно поэтому норма этого белка у женщин в два раза выше, чем у мужчин.

Для мужского организма чрезвычайно важно регулирование тестостерона в крови. Так, этот половой гормон находится в трех состояниях:

  1. Свободном – для взаимодействия с различными тканями и клетками.
  2. В соединении с альбумином – неустойчивая фракция, легко отслаивающая тестостерон.
  3. Связанный с глобулином – прочное соединение, не взаимодействующее с другими клетками.

Андрогены, прикрепленные к белку, теряют свою биологическую активность, но в то же время они не могут быть разрушены в результате внутренних химических процессов. Все фракции находятся в постоянном равновесии, а общее количество тестостерона в первых двух состояниях в медицине называется биологически доступным.

Какие еще функции выполняет этот белок? Он способен связывать и транспортировать лекарственные препараты, регулировать свертываемость крови, защищать организм мужчины от токсинов, грибков, чужеродных микроорганизмов.

Глобулин вырабатывается в печени.

Нормативные показатели для разных возрастных групп

Чем старше становится человек, тем больше белка вырабатывается в его организме. Для мужчин разного возраста нормой являются следующие показатели:

Возраст (лет)

Показатели (нмоль/л)

До 12

76-137

12-18

44-113

18-60

13-71

Старше 60

15-85

Специалисты объясняют, что анализ для определения СССГ (секс-стероид связывающего глобулина) назначается довольно редко. Ведь гораздо легче рассмотреть количество общего и свободного тестостерона у мужчин и на основании этих сведений вычислить концентрацию ГСПГ. Но существуют и патологические процессы, для выявления причин которых требуется изучение именно этого белка, вырабатываемого печенью.

Подобный анализ ГСПГ необходим мужчинам с угнетенным либидо, низкой потенцией, бесплодием. Тщательное изучение СССГ (секс-стероид связывающего глобулина) поможет выявить причины изменения гормонального фона и понять, из-за чего понижен уровень половых гормонов. Обычно данный анализ проводится совместно с определением концентрации пролактина, эстрадиола, кортизола и других гормональных веществ.

Существуют и внешние симптомы, появление которых может означать как низкий или высокий ГСПГ, так и развитие других заболеваний, не имеющих отношения к концентрации в крови половых гормонов. Поэтому подобный анализ назначается при возникновении себореи, ожирения, угревых высыпаниях, мышечной дистрофии, депрессивных состояниях. Важность этого диагностического исследования трудно переоценить, ведь, увидев отклонение от нормы, врач может назначить точную дозировку лекарственных препаратов, чтобы качественно снижать любые аномалии.

Перед обследованием мужчинам необходимо соблюдать некоторые правила. Так, за 5-7 дней до взятия крови необходимо отказаться от алкоголя, прекратить прием лекарственных средств. Завтрак и сладкие напитки остаются под запретом, но занятия сексом и употребление чистой воды допустимы. В клинике специалист возьмет кровь из вены и выдаст результаты через 24-48 часов.

Концентрация ГСПГ определяется количеством общего и свободного тестостерона.

Что означает несоответствие норме

Врачи всегда объясняют пациентам, что их образ жизни может повлиять на уровень белка, связывающего половые гормоны. Так, усиление его выработки в печени вызывает принятие спиртных напитков, интенсивные физические нагрузки, прием препаратов для купирования судорог в мышцах. Снижающий фактор – курение, голодание, вегетарианское питание, прием глюкокортикоидов.

Расшифровка результатов исследования способствует выявлению различных заболеваний. Так, повышенное содержание ТЭСГ (тестостерон эстрадиол связывающего глобулина) вызывает активное деление клеток предстательной железы, из-за чего увеличивается риск возникновения рака простаты. Своевременная диагностика помогает остановить это явление и спасти мужской организм от разрушающего действия раковых клеток.

Такой же эффект наблюдается и в тканях щитовидной железы. Усиленная выработка глобулина в печени повышает активность железы, из-за чего патологически ускоряются все обменные реакции организма. В результате человек становится нервозным, суетливым, быстро утомляется, ощущает сердцебиение, потливость, тошноту. Лечение гипертиреоза осуществляется посредством гормонотерапии.

Сама печень также страдает от повышенной выработки СССГ (секс-стероид связывающего глобулина). Особенно опасным является сочетание активного синтеза и гепатита. Тогда болезнь может протекать стремительно и остро или переродиться в хроническую форму и подтачивать организм скрытыми симптомами. Если не блокировать синтез, повышающий уровень белка, соединяющего половые гормоны, то клетки печени постепенно сменятся соединительной тканью, и наступит цирроз.

Увеличивают уровень выработки белка интенсивные физические нагрузки.

Иногда печень начинает уменьшать количество ТЭСГ (тестостерон эстрадиол связывающий глобулина). Это происходит из-за развития синдрома Кушинга. Так называется группа заболеваний, при которых в крови находится повышенная концентрация гормонов коры надпочечников. Своевременное выявление излишка глюкокортикоидов и дефицит СССГ (секс-стероид связывающий глобулина) позволяет нормализовать уровень половых гормонов и не допустить развития необратимых реакций.

Нефротический синдром также способствует уменьшению синтеза белка, соединяющего половые гормоны. Из-за того что организм вынужден снизить его выработку, а также из-за постоянной потери белкового вещества с мочой происходит сбой в обмене жиров и удержание влаги в тканях, что выражается в характерном внешнем виде больного. Сочетание этих патологических состояний особенно опасно своими осложнениями. Так, без квалифицированного лечения возможно появление инфаркта, инсульта, тромбоэмболии, тромбоза глубоких вен.

ГСПГ – белок, прикрепляющий к себе излишки секс-гормонов (эстрадиола и андрогенов), необходим организму для регулирования обменных процессов. Лабораторное исследование сыворотки крови способно увидеть его концентрацию. А своевременное лечение позволяет получить сниженный эффект его выработки вплоть до пределов нормы.

Особенно актуально данное обследование при проблеме с сексом или при возникновении трудностей с зачатием ребенка. Оценив результаты анализа, врач сможет не только вылечить мужское бесплодие, но и предотвратить развитие множества опасных заболеваний.

Дефицит тестостерона – цены на лечение низкого уровня тестостерона у мужчин в Москве

Последствия низкого уровня тестостерона в организме

Если организм вырабатывает тестостерон в недостаточном количестве, это негативно сказывается на общем состоянии здоровья. Иммунная система в этом случае не способна справляться с возложенными на нее нагрузками, заметно снижается работоспособность мужчины. От недостатка гормона страдают также сердечно-сосудистая и нервная системы.

Можно определить низкий уровень тестостерона визуально, ведь падение уровня гормона всего на 10-12 процентов провоцирует развитие таких качеств, как излишняя мягкость, женоподобность, повышенный уровень чувствительности.

В ходе возрастных изменений у мужчин постепенно снижается уровень гормона тестостерона в крови. Данный процесс начинается с 40 лет. С каждым годом показатель падает на 1 процент. К 60 годам уровень тестостерона в крови мужчины составляет всего 80 процентов от нормы, что проявляется целым рядом визуальных симптомов. Среди них:

  • заметное уменьшение мышечной массы,
  • увеличение ломкости костей,
  • снижение потенции,
  • уменьшение работоспособности,
  • снижение иммунитета,
  • появление недомоганий возрастного характера,
  • повышение риска заболеваний сердца и сердечно-сосудистой системы,
  • возможны приступы меланхолии.

Весь этот набор симптомов носит название «мужского климакса». Своевременное обращение к специалисту способно заметно продлить молодость организма, отсрочив наступление мужского климакса. Также грамотно подобранная терапия позволяет значительно уменьшить проявления возрастных изменений в организме мужчин. В Клинике Современной Медицины имеется все необходимое диагностическое оборудование, позволяющее определить уровень тестостерона и провести комплекс анализов, необходимых для квалифицированного и грамотного лечения.

Признаки симптоматической нехватки тестостерона

Если низкий уровень тестостерона вызван не возрастными изменениями, на наличие данной проблемы могут указать следующие симптомы:

  • головокружения;
  • сонливость;
  • повышение уровня потоотделения;
  • колебания артериального давления, которые ощущаются как нахлынувшее внезапно чувство жара;
  • гинекомастия;
  • покраснения лица и шеи;
  • ощущение нехватки воздуха;
  • кардиалгия.

При обнаружении подобных симптомов обращайтесь в Клинику Современной Медицины, где высококлассные врачи помогут обнаружить их причины и устранить их посредством высокоэффективного терапевтического лечения.

Причины дефицита тестостерона

В настоящее время дефицит тестостерона является проблемой не только пожилых людей. Все чаще встречаются случаи временного снижения в крови уровня данного гормона. Это провоцирует увеличение количества инфарктов у молодых мужчин.

Дефицит тестостерона может быть вызван целым комплексом причин. Помимо возрастных изменений, происходящих в организме мужчин, нехватка тестостерона может быть спровоцирована следующими факторами:

  • болезнь и вызванная ею нагрузка на иммунную систему;
  • голодание либо недостаточное питание, вызванное, к примеру, диетами;
  • нервное перенапряжение;
  • излишняя физическая нагрузка;
  • ожирение (при превышении массы тела на треть от нормы выработка тестостерона приостанавливается при одновременном повышении в крови уровня эстрогенов и прогестерона, так называемых «женских» гормонов).

Систематический прием алкоголя подавляет выработку тестостерона. Данные изменения, которые вызываются приемом спиртных напитков, носят постоянный характер.

Лечение дефицита тестостерона

Эффективное лечение дефицита тестостерона предполагает в первую очередь определение причин, повлекших за собой гормональный дисбаланс.

Также имеется перечень заболеваний, которые напрямую связаны с уровнем тестостерона в крови. Прямым показанием для определения количества гормона являются:

  • наличие увеличений, располагающихся в зоне турецкого седла, а также всевозможных заболеваний данной области;
  • резкое снижение массы тела, которое осуществляется на фоне положительного ВИЧ-статуса;
  • прием лекарств, принадлежащих к группам глюкокортикоидов, опиодов, кетоконазола;
  • почечная недостаточность в последней стадии;
  • бесплодие;
  • переломы костей при незначительных травмах либо остеопороз;
  • диабет второго типа;
  • присутствие обструкций средней и повышенной тяжести;
  • гемодиализ (очищение крови внепочечного типа), применяющийся при хронической и острой почечной недостаточности.

В Клинике Современной Медицины вы можете пройти комплексное исследование. У нас работают высококвалифицированные специалисты, имеющие большой опыт в лечении заболеваний, связанных с гормональным дисбалансом, в частности – дефицитом тестостерона.

Наш медицинский центр оказывает самый широкий спектр услуг. Вы всегда можете обратится к нам по вопросам лечения андрологических заболеваний. Мы готовы оказать вам услуги лечения эпидидимита и лечения эректильной дисфункции.

Мужское здоровье — 10 ответов

˙˙·٠•●ИРА●•٠·˙˙

Анализ крови на гормоны  Какие же гормоны приходится исследовать у мужчин для определения способности к зачатию или при неудовлетворительных результатах спермограммы?  1. Гормон ФСГ (фолликулостимулирующий гормон) вырабатывается гипофизом.  В организме мужчины ФСГ регулирует деятельность половых желез: стимулирует рост семявыносящих канальцев (активирует клетки Сертоли), увеличивает уровень тестостерона крови, тем самым способствуя образованию и созреванию половых клеток (сперматозоидов). Норма в крови у мужчин: 1.37-13.58 мЕд\л.  Высокий ФСГ может стать для врача основанием поставить следующий диагноз: недостаточность функции половых желез алкоголизм орхит опухоль гипофиза почечная недостаточность.  Повышенный ФСГ в крови характерен для человека, прошедшего курс лечения некоторыми медицинскими препаратами. Высокий уровень ФСГ наблюдается после воздействия рентгеновского излучения.  Снижение ФСГ наблюдается при: гипофункция гипофиза или гипоталамуса ожирение.  Обычно ФСГ понижен при голодании, после хирургических вмешательств, как следствие приема некоторых медицинских препаратов (анаболических стероидов и проч.).  2. Гормон ЛГ (лютеинизирующий гормон) производится гипофизом.  Ррегулирует деятельность половых желез: стимулирует выработку тестостерона клетками Лейдига у мужчин, стимулирует образование белков, связывающих половые гормоны, повышает проницаемость семенных канальцев для тестостерона.  Под влиянием гармона ЛГ увеличивается уровень тестостерона в крови, благодаря чему происходит созревание сперматозоидов. Норма в крови для мужчин: 1.8-8.16 мЕд\л.  Повышенный ЛГ в крови обычно означает: недостаточность функции половых желез опухоль гипофиза почечная недостаточность голодание и спортивные тренировки  Высокий ЛГ наблюдается при опухоли гипофиза, но и как следствие перенесенного стресса — вот почему никогда не стоит самостоятельно пытаться поставить себе диагноз. Правильную расшифровку анализа на гормоны может дать только врач.  Снижение ЛГ происходит при гипофункции гипофиза или гипоталамуса, при генетических синдромах, ожирении, курении и стрессе. Низкий гормон ЛГ в крови — проявление нервной анорексии.  3. Тестостерон  Тестостерон — мужской половой гормон. Тестостерон образуется в половых железах и коре надпочечников.  Тестостерон у мужчин влияет на развитие вторичных половых признаков, активизирует половую функцию мужчины (либидо и потенция), стимулирует выработку сперматозоидов.  Кроме того, тестостерон воздействует на многие органы и системы организма. Гормон тестостерон влияет на развитие скелета и мышечной массы, регулирует деятельность костного мозга, сальных желез, улучшает настроение.  В процессе полового созревания уровень тестостерона в крови мужчины увеличивается. Причем утром обычно наблюдается повышение тестостерона, а вечером — как правило, тестостерон низкий.  Норма в крови у мужчин старше 14 лет: 5,76 — 28,14 нмоль\л.  Анализ тестостерона показывает возможные отклонения от нормы уровня тестостерона и как следствие возможные заболевания различных органов и систем.  Повышение уровня тестостерона скажет врачу о возможной гиперплазии коры надпочечников и избытке тестостерона, который создают различные опухоли, вырабатывающие гормон тестостерон. Избыток мужских гормонов у женщины может возникать при опухоли яичника. Повышенный уровень тестостерона у мальчиков может наблюдаться при преждевременном половом созревании.  Снижение тестостерона характерно для синдрома Дауна, при почечной недостаточности, ожирении и недостаточной функции половых желез. Низкий тестостерон — характерный симптом хронического простатита.  Отклонения от нормы половых гормонов, как в большую, так и в меньшую сторону возможны при приеме некоторых медицинских препаратов.  Также определяют индекс свободного тестостерона (ИСТ): отношение общего тестостерона к ГСПГ. мужчины 14,8 – 95% женщины 0,8 – 11%  4. Пролактин  Пролактин вырабатывается гипофизом. Гормон пролактин регулирует водно-солевой обмен в организме, задерживая выделение воды и соли почками.  Пролактин у мужчин способствуют выработке тестостерона, а также образование и правильное развитие сперматозоидов.  При отсутствии стресса пролактин и его уровень находятся в пределах нормы. На уровень пролактина эстроген оказывает прямое влияние. Тем более высокий пролактин, чем более высокий уровень эстрогенов синтезируется в организме.  В норме повышение пролактина происходит во время сна, физической нагрузки, полового акта.  Норма пролактина в крови у мужчин: 53-360 мЕд\л.  Если анализ пролактина в крови показывает повышенный уровень пролактина, то для врача подобные результаты дают основание предполагать: дисфункции, опухоли гипофиза заболевания гипоталамуса гипотиреоз почечную недостаточность цирроз печени аутоиммунные заболевания — ревматоидный артрит, диффузный токсический зоб, системная красная волчанка… гиповитаминоз В6 стресс повреждения грудной клетки.  Повышенный пролактин в крови может быть и следствием приема антигистаминных препаратов, эстрогена и некоторых других лекарств.  Постоянно повышенный уровень пролактина в крови называется гиперпролактинемией. Гипрепролактинемия отражает нарушения функции половых желез у мужчин. Поэтому высокий пролактин очень плохо влияет на зачатие. Гиперпролактинемия — одна из ведущих причин бесплодия у мужчин.  Низкий пролактин может быть симптомом недостаточности гипофиза, апоплексии гипофиза. Также снижение уровня пролактина происходит вследствие приема некоторых медицинских препаратов (противосудорожных средств, морфина и др.).  Как сдать анализ пролактина правильно  Анализ на пролактин сдается утром натощак, однако не ранее чем через 3 часа после пробуждения.  За один день до взятия анализа крови на гармон пролактин нужно исключить половые отношения, не посещать сауну, не употреблять алкоголь, избегать стресса (или не сдавать анализ после перенесенного волнения), избегать воздействия на молочные железы. Врачи рекомендуют также не курить в течение часа перед анализом на гормоны и быть в состоянии покоя около 30 минут — отдохнуть и успокоиться перед анализом.  5. Эстрадиол  Эстриол — женский половой гормон, относящийся к классу эстрогенов.  Это наиболее активный эстрогенный (женский) половой стероидный гормон. С точки зрения биосинтеза эстрадиол представляет собой производное холестерина, а его непосредственными предшественниками являются андростендион и тестостерон.  У мужчин эстрадиол образуется в семенниках, в коре надпочечников, но большая часть — в периферических тканях за счет преобразования тестостерона. Поэтому, чем большее количество подкожно-жировой клетчатки имеет мужчина (ожирение), тем больше будет преобразование тестостерона в эстрадиол!  Эстрадиол обладает анаболическим действием, усиливает обмен костной ткани и ускоряет рост костей в длину. Способствует задержке натрия и воды в организме. Снижает уровень холестерина и повышает свер тывающую активность крови. Эстрадиол способствует повышению нервного напряжения, раздражительности.  Когда уровень эстрадиола повышен?  °  Эстрогенсекретирующая опухоль яичек.  °  Цирроз печени.  °  Прием лекарственных препаратов (анаболические стероиды, карбамазепин, циметидин -у мужчин и у женщин в постменопаузе, мифепристон — у пациентов с менингиомами, фенитоин, тамоксифен, тролеандомицин, вальпроевая кислота)  Избыточная масса тела у мужчин способствует накоплению эстрогенов в жировой ткани.  Когда уровень эстрадиола понижен?  °  Значительной потере веса    Диета с высоким содержанием углеводов и низким содержанием жиров, у вегетарианцев  °  Табакокурение  °  Синдром Шершевского-Тернера  °  Тестикулярная феминизация   °  Гипогонадизм   °  Гиперпролактинемия   °  Гипофизарный нанизм   °  Хронический простатит.  °  Прием лекарственных препаратов (аминоглютетимид, бузерелин, химиотерапевтические препараты, циметидин, ципротерон, даназол, дексаметазон, эпостан, мегестрол, моклобемид, нафарелин, нандролон, октреотид, правастатин).  У мужчин показанием к определению уровня эстрадиола я вляется гинекомастия. Норма эстрадиола в крови 15-71 пг\мл.  6. ХГЧ (хорионический гонадотропин человека)  У мужчин используется для диагностики опухолей яичек. В норме в крови мужчин ХГЧ должен быть менее  5 мЕд\мл.  7. ГСПГ (секс-гормон) — глобулин, связывающий половые гормоны  ГСПГ — это белок плазмы крови, участвующий в связывании и транспорте половых гормонов.Имеется несколько синонимов названия этого белка: секс-стероид связывающий глобулин, андроген-связывающий глобулин, половой стероид-связывающий глобулин. Этот гликопротеин, синтезируется в печени, обладает высоким сродством к тестостерону и связывает его .  Тестостерон циркулирует преимущественно в виде связанного с ГСПГ, в меньшей степени с альбумином и кортизол-связывающим глобулином. Поскольку вариации содержания белков-переносчиков могут влиять на концентрацию тестостерона в циркуляции, содержание ГСПГ обычно определяют в дополнение к измерению общего тестостерона. Уровень синтеза ГСПГ в печени зависит от половых гормонов: эстрогены увеличивают, а андрогены снижают его продукцию. Поэтому содержание ГСПГ у женщин почти вдвое выше, чем у мужчин. При снижении продукции эстрадиола общее содержание гормона и концентрация свободного гормона в крови снижаются параллельно.  При снижении продукции андрогенов увеличение продукции ГСПГ обуславливает сохранение на постоянном уровне общего тестостерона, хотя концентрация свободного гормона снижается. Поэтому уровень общего тестостерона плазмы может быть парадоксально нормальным при ранних стадиях тестикулярных заболеваний. Сниженные уровни ГСПГ часто находят при гирсутизме, acne vulgaris и синдроме поликистозных яичников. При гирсутизме описывают снижение ГСПГ примерно у 30% обследованных женщин.   Уровень ГСПГ на поздних стадиях беременности или после введения эстрогенов может быть существенно увеличен. Введение андрогенов часто сочетается со сниженным уровнем ГСПГ.  После 60 лет содержание ГСПГ растет примерно на 1,2% в год, таким образом, с возрастом уровень биологически доступного тестостерона снижается в большей степени, чем уровень общего тестостерона.   Показания к назначению анализа:   У обоих полов:   1.Клинические признаки увеличения или снижения уровня андрогенов при нормальном уровне тестостерона;   2. Облысение;   3. Угревая сыпь;   4.Жирная себорея;   5.Выявление маркеров инсулинорезистентности.   У женщин:   1.Гирсутизм;   2. Ановуляция;   3. Аменорея;   4. Синдром поликистозных яичников;   5. Прогнозирование развития гестоза (ГСПГ снижен).   У мужчин:   1. Мужской климакс;   2. Хронический простатит;   3. Нарушение потенции;   4. Снижение либидо   Нормы в крови ГСПГ: мужчины13 – 71 нмоль/л женщины 28-112 нмоль/л

9 лет

Ответить

Десульфатация HSPG клеточной поверхности является эффективной стратегией лечения карциномы желчного пузыря

Протеогликан гепарансульфата клеточной поверхности (HSPG) представляет собой группу критических гликопротеинов, которые опосредуют передачу сигнала. Сульфатированный HSPG может опосредовать активацию различных сигнальных путей фактора роста клеток, способствуя прогрессированию карциномы желчного пузыря (GBC). В этом исследовании было проанализировано 527 клинических образцов ГБЖ и подтверждено, что уровень сульфатирования HSPG был значительно выше в тканях ГБЖ, чем в тканях слизистой оболочки желчного пузыря (ГБМ).Высокий уровень сульфатирования HSPG был тесно связан с плохой дифференциацией, локальными метастазами и поздней клинической стадией GBC; это также было связано с сокращением безрецидивной выживаемости (БВР) и общей выживаемости (ОВ) и влияло на исход химиотерапии или радиохимиотерапии у пациентов с рецидивом ГБ. Ингибирование сульфатирования HSPG на поверхности клеток GBC с помощью человеческой сульфатазы 1 (hSulf-1) значительно снижало уровни фосфорилирования рецепторов факторов роста и сигнальных протеинкиназ в клетках GBC, уменьшало клеточные ответы на факторы роста и ингибировало пролиферацию и миграционные способности клеток.В модели голых мышей с ксенотрансплантатами GBC мы наблюдали, что рост опухоли ксенотрансплантата подавлялся, а уровни фосфорилирования сигнальных белков снижались вместе со снижением экспрессии Ki67 и снижением чувствительности к индукции bFGF (основного фактора роста фибробластов) после ингибирования HSPG. сульфатация. Наше исследование показало, что высокое сульфатирование HSPG наделяет GBC высоким злокачественным биологическим поведением и плохим прогнозом. Десульфатирование HSPG клеточной поверхности может ингибировать киназную активность различных сигнальных белков, препятствовать клеточному ответу на факторы роста и эффективно ингибировать злокачественное биологическое поведение клеток GBC.

Ключевые слова: карцинома желчного пузыря; Сигнальный путь рецептора фактора роста; гепарансульфат протеогликан; сульфатация; Таргетная терапия.

Границы | Гепарансульфат и гепарансульфатные протеогликаны в инициации и прогрессировании рака

Введение

Нормальные клетки приобретают ряд генетических и эпигенетических аберраций, чтобы стать раковыми. Приобретенные признаки роста и прогрессирования рака вместе называются отличительными признаками рака (1). Некоторые признаки рака, такие как устойчивый сигнал роста, подавление апоптоза, нарушение регуляции метаболизма, уклонение от иммунитета и ангиогенез, также могут быть усилены за счет патологических изменений нормальных физиологических процессов (1).

Гепарансульфаты (HS) представляют собой неразветвленные цепи дисахаридных повторов, которые сильно сульфатированы в различных положениях своих сахарных остатков (2, 3). HS может быть либо конъюгирован с аминокислотами, образуя гепарансульфатные протеогликаны (HSPG), либо в виде неконъюгированных цепей (4).И HS, и HSPG играют важную роль в инициации и прогрессировании рака. Предыдущие исследования выявили роль HS и HSPG в нескольких типах солидных опухолей, а также в гематологических злокачественных новообразованиях (5–11).

HSPG представляют собой сложные биополимеры, синтез которых управляется многими ферментами, которые катализируют различные этапы синтеза HS с очень небольшой избыточностью (рис. 1). В большинстве случаев нарушение регуляции HS при раке происходит из-за изменения экспрессии HS-синтезирующих и HS-модифицирующих ферментов, однако изменения в HSPG также могут способствовать дерегуляции HS (12) (см. также Таблицу 1) (10, 11, 13). –84).

Таблица 1 . Нарушение регуляции HS и HSPG и ферментов, участвующих в метаболизме HSPG при раке.

Рисунок 1 . Обзор ферментов, участвующих в синтезе и модификации гепарансульфата.

В этом обзоре мы представляем обзор клеточно-автономной и клеточно-неавтономной роли HS и HSPG в инициации и прогрессировании рака. Кроме того, мы также обсудим возможности разработки методов лечения рака, нацеленных на оси HS и HSPG.

клеточно-автономная роль HS и HSPG в инициации и прогрессировании рака

HS и HSPG регулируют различные клеточно-автономные функции, включая онкогенную передачу сигналов, апоптоз и клеточную дифференцировку. В этом разделе мы описываем клеточно-автономные функции HS и HSPG при инициации и прогрессировании рака.

Сигнализация фактора роста и регуляция пролиферации

Предыдущие исследования показали важную роль HS и HSPG в онкогенной передаче сигналов (85–88). В этом отношении взаимодействия связывания FGF лучше всего характеризуются ролью HS в измененной передаче сигналов Receptor Tyrosine Kinase (RTK). Напр., HS-модифицированные HSPGs связывают лиганды и рецепторы FGF с образованием тройного комплекса и усиливают передачу сигналов, способствуя димеризации рецептора FGF (FGFR) (89-91). Это, в свою очередь, приводит к активации рецепторов и усилению передачи сигналов FGFR, что впоследствии способствует росту опухоли (89–91). В дополнение к FGF, HS связывается с несколькими различными митогенными факторами роста, такими как PDGF, гепарин-связывающий эпидермальный фактор роста, подобный фактору роста (HB-EGF) и фактору роста гепатоцитов (HGF), и модулирует их передачу сигналов контекстно-зависимым образом. 86).

Также показано, что клетки рака молочной железы сверхэкспрессируют HSPG, такие как Glypican 1 (GPC1) и Syndecan 1 (SDC1), которые усиливают пролиферативный ответ после лечения различными факторами роста из-за продолжительной передачи сигналов (86). Подобно раку молочной железы, было показано, что GPC1 оказывает стимулирующее влияние на рост при раке поджелудочной железы и глиомах (49, 92, 93). В совокупности эти исследования подчеркивают широко распространенную дерегуляцию HSPG при различных видах рака, которые играют роль, способствующую развитию опухоли.

Кроме того, HSPG также влияют на взаимодействие клетки с матриксом, связывая белки матрикса, такие как фибронектин, ламинин, тромбоспондин и коллаген (89, 94).Например, было показано, что SDC2 сверхэкспрессируется в клеточных линиях рака толстой кишки, и ингибирование SDC2 в этих клетках приводит к остановке клеточного цикла (69). Точно так же было показано, что RKIP и HMGB2-зависимая выживаемость и метастазирование рака молочной железы регулируются зависимым от SDC2 образом (67). Однако важно отметить, что в дополнение к проонкогенным эффектам некоторые HSPG, такие как SDC2, оказывают подавляющее действие на опухоль в зависимости от типа рака (95, 96).

Интересно, что HSPG на клеточной поверхности также могут теряться, генерируя растворимые белки, которые влияют на клеточную пролиферацию, накапливаясь в межклеточном пространстве и секвестрируя факторы роста (89). HSPG также часто экспрессируются в строме опухоли и влияют на некоторые функции, способствующие росту раковых клеток (89). Например, стромальный SDC1, который высвобождается в микроокружение опухоли, способствует росту карциномы молочной железы путем усиления передачи сигналов FGF2 (97). Интересно, что выделение SDC1 в строму усиливается экспрессией гепараназы, частично за счет удаления и восстановления цепей гепарансульфата (30). Таким образом, различные компоненты сигнального пути HS координируются, способствуя канцерогенезу.

HSPG, секретируемые в строму, также могут ингибировать пролиферацию раковых клеток.Например, повышенная передача сигналов FGF2 из-за растворимых HSPG подавляет пролиферацию нейробластомы (11, 98). В частности, было показано, что растущие клетки нейробластомы с растворимыми HSPG способствуют ее дифференцировке за счет усиления как базального, так и опосредованного FGF1 фосфорилирования ERK1/2 и экспрессии транскрипционного фактора ID1 (11). Другое исследование показало, что HSPG, рецептор TGF-β типа III (TGFBR3), действует как корецептор в опосредованной FGF2 дифференцировке нейробластома (98). Сходным образом было показано, что SDC1, который экспрессируется при множественной миеломе, активирует передачу сигналов WNT двумя механизмами (99).Во-первых, Wnts связываются с боковыми цепями SDC1 HS и активируют путь WNT паракринным образом через Frizzled. Во-вторых, SDC1 связывается с R-спондинами, продуцируемыми в остеобластах, и стабилизирует Frizzled зависимым от LGR4 образом (99). В других случаях растворимые HSPG изолируют факторы роста, снижая определенные пролиферативные сигналы. Например, GPC3 способствует росту гепатоцеллюлярной карциномы путем активации передачи сигналов WNT (100). Однако, в противоположность этому, было показано, что растворимый GPC3 блокирует рост гепатоцеллюлярной карциномы, блокируя передачу сигналов WNT, MAP-киназу и пути AKT (101).В совокупности эти исследования подтверждают, что HS и HSPG могут выполнять различные функции, стимулирующие или ингибирующие рак, в зависимости от контекста.

Регулирование апоптоза и клеточного старения

HS и HSPG также могут играть важную роль в регуляции апоптоза и клеточного старения. Например, активация сигнального пути RTK с помощью HSPG индуцирует антиапоптотический эффект за счет активации путей выживания, опосредованных фосфатидилинозитол-3-киназой (PI3K) и митоген-активируемой протеинкиназой (MAPK) (102).Кроме того, HS и хондроитинсульфат непосредственно ингибируют H 2 O 2 -индуцированный апоптоз, блокируя высвобождение цитохрома с и активацию каспаз-3 и -9 (103). Путь апоптоза, опосредованный рецептором смерти, который опосредуется через рецепторы клеточной поверхности для лиганда Fas (FasL) и лиганда, индуцирующего апоптоз, связанный с фактором некроза опухоли (TRAIL), также может регулироваться HSPG. Например, SDC1 подавляет TRAIL-опосредованный апоптоз в клетках множественной миеломы (104). В том же исследовании также сообщалось, что нокдаун SDC1 в клетках лимфомы защищал их от FasL-опосредованного апоптоза.В дополнение к регуляции апоптоза недавнее исследование также показало, что гепарансульфатирование необходимо для предотвращения старения (105). Это исследование показало, что истощение 3′-фосфоаденозин-5′-фосфосульфатсинтетазы 2 (PAPSS2), фермента, который синтезирует донор серы PAPS, и репрессия сульфатирования HS, опосредованная низкомолекулярным ингибитором, приводит к преждевременному старению клеток (105). В совокупности эти исследования дополнительно демонстрируют важность HS и HSPG в регуляции клеточных процессов, связанных с ростом рака, таких как апоптоз и старение.

Регламент клеточной дифференцировки

Также было показано, что

HS, HSPG и модификаторы HS определяют состояние клеточной дифференцировки. В связи с этим заслуживает внимания роль модификаторов ГС в регуляции эпителиально-мезенхимального перехода (ЭМП). ЕМТ играет важную роль в метастазировании и лекарственной устойчивости (106). Клетки со сверхэкспрессией модификатора HS сульфатазы 2 (SULF2) обнаруживают пониженные уровни трисульфатированного дисахарида UA(2S)-GlcNS(6S). За этим снижением следует увеличение маркеров ЕМТ и передачи сигналов WNT (107). Опосредованная опухолевыми клетками модуляция стромы опухоли также может подавлять дифференцировку и усиливать пролиферацию. Экспрессия некоторых HSPG низкая в нейробластах и ​​высокая в шванновской строме, а нейробластомы с высокой экспрессией TβRIII, GPC1 и SDC3 имеют улучшенный прогноз (11). В том же исследовании также было обнаружено, что растворимые HSPG и гепарин способствуют дифференцировке и снижают пролиферацию посредством фосфорилирования FGFR1 и ERK. Точно так же другое исследование показало, что дифференцировке нейробластомы способствует высвобождение GPI-заякоренного HSPG, Glypican-6 (GPC6) через глицерофосфодиэстеразу (GDE2).Это исследование также показало, что высокий уровень GDE2 или низкий уровень GPC6 при нейробластоме значительно повышает выживаемость пациентов (108). Эти исследования имеют большое значение, поскольку они касаются двух основных моментов; во-первых, состояние дифференцировки раковых клеток предсказывает выживание, а во-вторых, что HS и HSPG являются одними из ключевых регуляторов состояний дифференцировки рака.

Неавтономные клеточные роли передачи сигналов HS при раке

Некоторые особенности рака, такие как устойчивый ангиогенез, тканевая инвазия и миграция и уклонение от иммунитета, требуют сложного взаимодействия между более чем одним типом клеток и вовлекают несколько систем органов.В этом разделе мы описываем клеточно-неавтономные функции HS и HSPG в инициации и прогрессировании рака.

Роль в ангиогенезе

Ангиогенез считается ключевым условием роста и прогрессирования рака (109). Это подчеркивается тем фактом, что несколько ингибиторов ангиогенеза проходят клинические испытания для лечения рака (110). HS и HSPG модифицируют ангиогенез из-за их влияния на ангиогенные факторы, такие как FGF, PDGF и VEGF. Например, SDC1 связывается с VEGF, и выделение SDC1 увеличивает концентрацию VEGF в матриксе и способствует ангиогенезу при миеломе (111).Это же исследование также показало, что экспрессия гепараназы увеличивает выделение SDC1 (112). SDC1 сверхэкспрессирован в эндотелиальных клетках, полученных от пациентов с множественной миеломой. В дополнение к подавлению клеточной пролиферации, РНКи-сайленсинг SDC1 в эндотелиальных клетках, полученных от пациентов, снижает организацию капилляроподобной структуры, что коррелирует со сниженной поверхностной экспрессией рецептора VEGF (VEGFR)-2 (111). Другие члены семейства синдеканов, такие как SDC2 и SDC3, также влияют на ангиогенез опухоли (113, 114).

Другим HSPG с противоположным действием на ангиогенез является Perlecan. Перлекан представляет собой секретируемый HSPG, который также обнаруживается на поверхности раковых клеток и в микроокружении рака (115). Показано, что перлекан способствует ангиогенезу в своей интактной форме (115). Однако перлекан также может частично расщепляться протеазами, в результате чего образуется С-концевой фрагмент, называемый эндорепеллином, который, как было показано, оказывает антиангиогенное действие (116). Таким образом, HSPG модулируют опухолевый ангиогенез несколькими способами: они увеличивают концентрацию VEGF в микроокружении опухоли, влияют на локализацию VEGFR на поверхности и тонко настраивают взаимодействие VEGF с его рецептором и корецептором.

Роль в уклонении от иммунитета

Иммунный ответ является первой линией системной защиты от онкогенеза (117). Недавний успех иммунотерапевтических подходов к лечению рака еще больше подчеркивает важность механизмов уклонения от иммунитета для инициации и прогрессирования рака (118, 119). HSPG могут служить биомаркерами рака, которые также можно использовать для нацеливания на антитела для иммунотерапии (120, 121). В то же время данные свидетельствуют о том, что HSPG во внеклеточном матриксе (ECM) или те, которые экспрессируются на клетках-свидетелях, участвуют в снижении передачи иммунных сигналов к дендритным клеткам (DC) (122).Одна из хорошо изученных ролей HSPG в иммунитете против меланомы связана с клетками-супрессорами миелоидного происхождения (MDSC), которые подавляют иммунитет против меланомы (122). Предыдущие исследования показали, что уклонение от иммунного ответа при меланоме связано с клетками-супрессорами миелоидного происхождения (MDSC), которые экспрессируют иммуносупрессивную молекулу, называемую ассоциированным с дендритными клетками, зависимым от HSPG лигандом интегрина (DC-HIL) (122). DL-HIL взаимодействует с синдеканом-4 на эффекторных Т-клетках, вызывая анергию (122). Кроме того, воздействие на DC-HIL нейтрализующими антителами или их генетическим нокаутом задерживает рост трансплантируемой меланомы B16 у сингенных мышей, что еще больше усиливает роль DC-HIL как потенциальной мишени для усиления иммунного ответа и эрадикации опухоли (123).

HSPG также влияют на врожденный иммунный ответ против раковых клеток, модулируя опосредованную клетками Natural Killer (NK) активность против раковых клеток. NK-клетки проявляют свою цитотоксическую активность в отношении раковых клеток посредством узнавания специфических лигандов, одна группа которых называется рецепторами естественной цитотоксичности (NCR) (124). NCR связываются с HSPG, и их взаимодействие способствует эрадикации раковых клеток, опосредованной NK-клетками (125). Кроме того, было показано, что раковые клетки усиливают регуляцию гепараназы за счет активации фактора транскрипции пальцев бромодомена PHD (BPTF), что приводит к уменьшению взаимодействия NCR-HSPG, что приводит к ослаблению ответа NK-клеток (126). В совокупности эти исследования демонстрируют, что, активируя иммунную толерантность, усиливая сигнальные пути и вмешиваясь во взаимодействие иммунных клеток с опухолью, HSPG регулируют функции уклонения от иммунного ответа в раковых клетках.

Роль в регуляции модификации внеклеточного матрикса

HSPG, свободные цепи HS и гепарин являются структурными компонентами внеклеточного матрикса (ECM) (12). ECM является основной частью микроокружения опухоли и влияет на прогрессирование опухоли несколькими механизмами, включая концентрацию фактора роста, ангиогенез и иммунную инфильтрацию (127).Изменения в HSPG и ферментах, метаболизирующих HS, сильно различаются в зависимости от типа рака и играют различную роль в зависимости от контекста.

Правосторонний колоректальный рак показывает, что экспрессия HSPG глипикан-1,-3 и -6 и бетагликан изменены в неметастатических опухолях, тогда как в метастатических опухолях изменены только глипикан-1 и SDC1. Интересно, что изменения были обнаружены только в неметастатических опухолях, влияющих на N-сульфатацию и изоформы гепарансульфат-6-О-сульфотрансферазы 1 (HS6ST1), гепарансульфат-глюкозамин-3-сульфотрансферазы 3B1 (HS3ST3B1) и гепарансульфат-глюкозамина 3. -сульфотрансфераза 5 (HS3ST5) (128).HSPG SDC2 индуцирует MMP-7-опосредованное выделение Е-кадгерина при колоректальном раке. Отщепление E-Cadherin привело к уменьшению межклеточных контактов и приобретению фибробластоподобной морфологии, которые оба связаны с метастазированием рака (129). Другое важное исследование показало, что SDC1-положительные фибробласты молочной железы человека (HMF) индуцируют ремоделирование внеклеточного матрикса, способствуя выровненной архитектуре волокон, что способствует направленной миграции и инвазии клеток рака молочной железы (130).

Помимо синдекана, перлекана и агрина, два других компонента базальной мембраны также участвуют в развитии рака (131–133).Антисмысловая РНК против перлекана ингибирует рост опухоли и ангиогенез при карциноме толстой кишки (134). Более того, белок ЕСМ агрин стимулировал рост и миграцию клеток остеосаркомы. Агрин также индуцирует переключение с топоизомеразы I на топоизомеразу II (135). Следовательно, эти исследования в совокупности раскрывают роль компонентов внеклеточного матрикса HSPG и HSPG клеточной поверхности в регуляции межклеточной адгезии и адгезии клеток к матриксу, которые, в свою очередь, контролируют миграцию и отторжение опухолевых клеток.

Ориентация на HS и HSPG для лечения рака

Понимание биологии, лежащей в основе дерегуляции HS и HSPG при раке, позволило разработать различные терапевтические стратегии, направленные на различные функции, способствующие росту и прогрессированию рака, опосредованного HS и HSPG.Были разработаны низкомолекулярные ингибиторы, которые препятствуют активности различных ферментов, участвующих в синтезе и модификации HSPG (6). Кроме того, разрабатываются низкомолекулярные ингибиторы и моноклональные антитела, нацеленные на взаимодействие между HSPG и их мишенями (136, 137). Ниже мы опишем некоторые из этих агентов и их значение в качестве противораковых агентов.

Антитела и малые молекулы, нацеленные на HS-модифицирующие ферменты, HS и HSPG

Среди ферментов, участвующих в синтезе и модификации ГС, гепараназы и сульфатазы считаются хорошими мишенями для лекарственных средств.Гепараназа сверхэкспрессируется в большом количестве солидных опухолей и гематологических злокачественных образований (29). В предыдущем исследовании оценивалась терапевтическая ценность нацеливания на гепараназу с использованием нейтрализующих гепаранс антител для лечения диффузной неходжкинской В-клеточной лимфомы и фолликулярной лимфомы (138). Это исследование показало, что ингибирование гепараназы блокирует ксенотрансплантатные опухоли и рост клеток лимфомы в костях мышей (138). Дополнительные исследования показали, что антигепараназная терапия, опосредованная антителами, ингибирует клеточную инвазию и метастазирование опухоли (138–140).Недавно был разработан низкомолекулярный ингибитор гепраназы, и было показано, что он снижает метастатические признаки в модели гепатоцеллюлярной карциномы (141). Таким образом, эти исследования в совокупности устанавливают гепараназу как потенциальную мишень для лечения рака.

Низкомолекулярные ингибиторы, которые предотвращают связывание гормона роста с HSPG, уменьшают пролиферативный сигнал, опосредованный HSPG. Скрининг библиотек малых молекул на основе сходства выявил бинонафталиновые соединения, которые могут ингибировать связывание FGF как с HSPG, так и со связыванием FGFR1. In vitro и ex vivo , эти соединения ингибируют активность FGF2 в моделях ангиогенеза с улучшенной терапевтической активностью (142). Моноклональные антитела, выработанные против цепи HS на GPC3, ингибируют активацию Wnt3a/β-катенина, повторяя нокдаун GPC3 за счет снижения миграции и подвижности HCC (137).

Низкомолекулярные ингибиторы сульфатаз продемонстрировали многообещающие результаты в подавлении роста опухоли. Дисульфонильное производное фенил-трет-бутилнитрона (PBN), называемое OKN-007, ингибировало активность Sulf2 в клеточных линиях гепатоцеллюлярной карциномы (ГЦК) и блокировало рост ксенотрансплантата опухоли ГЦК у мышей (136).

Модуляция передачи сигналов HS

также влияет на перенос иммунных клеток и связанные с ними иммунные реакции. Делеция гена гликозилтрансферазы экзостозингликозилтрансферазы 1 (Ext1), которая необходима для образования цепи HS, в стромальных клетках костного мозга, экспрессирующих устойчивость к миксовирусу-1 (Mx-1), увеличивала отток гемопоэтических стволовых клеток (ГСК) из костного мозга в костный мозг. селезенки в ответ на гранулоцитарный колониестимулирующий фактор. Таким образом, терапевтическое средство, нацеленное на Ext1, может помочь мобилизовать иммунные клетки для нацеливания на раковые клетки (143).Подробный обзор роли различных ферментов в синтезе и модификации ГС можно найти в обзоре Bishop et al. (12).

Миметики гепарансульфата

Миметики

HS также использовались в качестве противораковых агентов. Миметики HS индуцируют иммунный ответ против лимфомы посредством активации естественных клеток-киллеров (NK) (144). Миметик HS PG545, в дополнение к его антигепараназному и антиангиогенному действию, проявляет плейотропный эффект за счет усиления активации толл-подобного рецептора 9 (TLR9) за счет увеличения лиганда TLR9 CpG в ДК.Показано, что обработка PG545 приводила к накоплению CpG в лизосомальном компартменте ДК. Это, в свою очередь, увеличило продукцию IL-12, что было необходимо для способности PG545 активировать NK-клетки (144). Кроме того, было показано, что PG545 напрямую связывается с WNT3A и WNT7A и ингибирует передачу сигналов WNT/β-катенина, ингибируя пролиферацию клеточных линий опухоли поджелудочной железы (145). Эти исследования еще раз подчеркивают возможность использования миметиков сульфата гепарина в качестве агентов для терапии рака.

HSPG как иммунотерапевтические мишени

Некоторые недавние исследования также показали, что повышенная регуляция HSPGs на раковых клетках может использоваться в качестве уникальных биомаркеров, на которые можно ориентироваться для селективной доставки цитотоксических препаратов (146, 147). Недавнее исследование, в котором анализировалась дифференциальная экспрессия белков клеточной поверхности в нейробластоме, выявило, что HSPG, Glypican-2 (GPC2) избирательно экспрессируется в нейробластоме, где он усиливает пролиферацию нейробластомы (148). Исследователям удалось разработать конъюгат антитело-лекарство, которое избирательно устраняло GPC2-положительную нейробластому (148).Это еще одна захватывающая область новых исследований, где HSPG можно использовать в качестве мишеней для селективной доставки лекарств к раковым клеткам.

Заключение

Современные методы лечения рака в основном сосредоточены на воздействии на драйверные мутации и их нижестоящие эффекторы. Тем не менее, появляющаяся совокупность доказательств теперь показывает, что драйверные мутации на самом деле усиливаются и модифицируются множеством других модификаций по мере развития рака. Дерегуляция HS и HSPG является основным фактором, способствующим развитию рака.Этот обзор охватывает некоторые из хорошо известных и новых ролей HS и HSPG в раке. Однако новые, неканонические функции HSPG все еще обнаруживаются. Напр., помимо модулирования факторов роста и взаимодействий RTK, HSPG также транспортируют факторы роста непосредственно в ядро, где эти факторы модифицируют регуляцию генов (149). Также было показано, что HSPG влияют на отщепление и поглощение раковых экзосом, тем самым модулируя межклеточную связь между раком и здоровыми фибробластами, иммунными клетками и эндотелиальными клетками (150, 151).HSPG также могут влиять на ремоделирование актинового цитоскелета и подвижность раковых клеток (95). HSPG, SDC2, связывает Ezrin, белок цитоскелета (152) и служит адаптерными молекулами для IGF1-опосредованной активации ERK (95). Кроме того, HSPG участвуют в поглощении липопротеинов и передаче сигналов клеточного стресса (153, 154). По мере того, как все больше исследователей подтвердят эти результаты, будут обнаружены новые области HS- и HSPG-опосредованной регуляции. Кроме того, по мере того, как лечение рака переходит от единственной мишени к комбинированной терапии, терапия, нацеленная на HS и HSPG, вероятно, станет основным новым направлением терапии рака.

Вклад авторов

Все перечисленные авторы внесли существенный, непосредственный и интеллектуальный вклад в работу и одобрили ее для публикации.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы с благодарностью признательны Национальным институтам здравоохранения за гранты: R01CA195077-01A1 (NW) и R01CA200919-01 (NW), а также R01CA218008-01A1 и R21CA197758 (NW). NW также поддерживается грантом исследователя от Американского онкологического общества (128347-RSG-15-212-01-TBG). Грантовая поддержка от Фонда Эльзы У Парди, исследовательская поддержка от Yale SPORE в области рака легких (3P50CA196530) и административное приложение от NIH (3P50CA196530-02S1) также отмечены.

Каталожные номера

3. Lamanna WC, Kalus I, Padva M, Baldwin RJ, Merry CL, Dierks T. Гепараном – загадка кодирования и расшифровки сульфатирования гепарансульфата. Дж Биотехнолог .(2007) 129: 290–307. doi: 10.1016/j.jbiotec.2007.01.022

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

6. Hammond E, Khurana A, Shridhar V, Dredge K. Роль гепараназы и сульфатаз в модификации гепарансульфатных протеогликанов в микроокружении опухоли и возможности для новых методов лечения рака. Фронт Онкол. (2014) 4:195. doi: 10.3389/fonc.2014.00195

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

7. Александр К.М., Рейхсман Ф., Хинкс М.Т., Линсекум Дж., Беккер К.А., Камберледж С. и др. Синдекан-1 необходим для индуцированного Wnt-1 онкогенеза молочной железы у мышей. Нат Жене . (2000) 25:329–32. дои: 10.1038/77108

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

8. Dhodapkar MV, Abe E, Theus A, Lacy M, Langford JK, Barlogie B, et al. Синдекан-1 является многофункциональным регулятором патобиологии миеломы: контроля выживаемости опухолевых клеток, их роста и дифференцировки костных клеток. Кровь (1998) 91:2679–88.

Реферат PubMed | Академия Google

9. Kleeff J, Ishiwata T, Kumbasar A, Friess H, Buchler MW, Lander AD, et al. Гепарансульфатный протеогликан глипикан-1 клеточной поверхности регулирует действие фактора роста в клетках карциномы поджелудочной железы и сверхэкспрессируется при раке поджелудочной железы человека. Дж Клин Инвест . (1998) 102:1662–73. дои: 10.1172/JCI4105

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

10. Уильямсон Д., Селф Дж., Гордон Т., Лу Ю.Дж., Притчард-Джонс К., Мураи К. и др. Роль амплификации и экспрессии глипикана-5 при рабдомиосаркоме. Рак Res . (2007) 67:57–65. doi: 10.1158/0008-5472.CAN-06-1650

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

11. Knelson EH, Gaviglio AL, Nee JC, Starr MD, Nixon AB, Marcus SG, et al. Стромальный гепарансульфат дифференцирует нейробласты для подавления роста нейробластомы. Дж Клин Инвест . (2014) 124:3016–31.DOI: 10.1172/JCI74270

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

13. Фергюсон Б.В., Датта С. Роль гепарансульфат-2-о-сульфотрансферазы в пролиферации клеток рака предстательной железы, инвазии и передаче сигналов фактора роста. Рак простаты (2011) 2011:893208. дои: 10.1155/2011/893208

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

14. Хванг Дж.А., Ким Й., Хонг С.Х., Ли Дж., Чо Ю.Г., Хан Дж. И. и др. Эпигенетическая инактивация гепарансульфата (глюкозамин) 3-О-сульфотрансферазы 2 при раке легкого и ее роль в онкогенезе. PLoS ONE (2013) 8:e79634. doi: 10.1371/journal.pone.0079634

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

15. Виджая Кумар А., Салем Гассар Э., Спиллманн Д., Сток С., Сен Ю.П., Чжан Т. и др. HS3ST2 модулирует инвазивность клеток рака молочной железы посредством MAP-киназы и Tcf4 (Tcf7l2)-зависимой регуляции экспрессии протеазы и кадгерина. Int J Cancer (2014) 135:2579–92. doi: 10.1002/ijc.28921

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

16.Чжан Л., Сонг К., Чжоу Л., Се З., Чжоу П., Чжао И. и др. Гепарансульфат D-глюкозаминил 3-O-сульфотрансфераза-3B1 (HS3ST3B1) способствует ангиогенезу и пролиферации путем индукции VEGF в клетках острого миелоидного лейкоза. J Cell Biochem. (2015) 116:1101–12. doi: 10.1002/jcb.25066

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

17. Biroccio A, Cherfils-Vicini J, Augereau A, Pinte S, Bauwens S, Ye J, et al. TRF2 ингибирует внешний клеточный путь, посредством которого естественные клетки-киллеры уничтожают раковые клетки. Nat Cell Biol . (2013) 15:818–28. дои: 10.1038/ncb2774

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

18. Song K, Li Q, Jiang ZZ, Guo CW, Li P. Гепарансульфат D-глюкозаминил 3-O-сульфотрансфераза-3B1, новый индуктор эпителиально-мезенхимального перехода при раке поджелудочной железы. Рак Биол Тер . (2011) 12:388–98. doi: 10.4161/cbt.12.5.15957

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

19. Коул С.Л., Раштон Г., Джейсон Г.К., Авизените Э.Гепарансульфат-6-О-сульфотрансферазы раковых клеток яичников регулируют ангиогенную программу, индуцированную передачей сигналов гепарин-связывающего эпидермального фактора роста (EGF), подобного фактору роста/рецептору EGF. J Биол Хим . (2014) 289:10488–501. doi: 10.1074/jbc.M113.534263

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

20. Хатабе С., Кимура Х., Арао Т., Като Х., Хаяши Х., Нагаи Т. и др. Сверхэкспрессия гепарансульфат-6-О-сульфотрансферазы-2 при колоректальном раке. Мол Клин Онкол .(2013) 1:845–50. doi: 10.3892/mco.2013.151

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

21. Pollari S, Kakonen RS, Mohammad KS, Rissanen JP, Halleen JM, Warri A, et al. Гепариноподобные полисахариды уменьшают остеолитическую деструкцию кости и рост опухоли в мышиной модели метастазирования рака молочной железы в кости. Мол Рак Рез . (2012) 10: 597–604. doi: 10.1158/1541-7786.MCR-11-0482

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

22.Qu H, Zheng L, Pu J, Mei H, Xiang X, Zhao X и др. миРНК-558 способствует онкогенезу и агрессивности клеток нейробластомы за счет активации транскрипции гепараназы. Хум Мол Жене . (2015) 24:2539–51. DOI: 10.1093/hmg/ddv018

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

23. Theodoro TR, de Matos LL, Sant Anna AV, Fonseca FL, Semedo P, Martins LC, et al. Экспрессия гепараназы в циркулирующих лимфоцитах больных раком молочной железы зависит от наличия первичной опухоли и/или системных метастазов. Неоплазия (2007) 9:504–10. doi: 10.1593/neo.07241

Полнотекстовая перекрестная ссылка

24. Лернер И., Бараз Л., Пикарский Э., Мейровиц А., Эдовицкий Э., Перец Т. и соавт. Функция гепараназы в онкогенезе предстательной железы: потенциал для терапии. Клин Рак Res . (2008) 14:668–76. doi: 10.1158/1078-0432.CCR-07-1866

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

25. Friedmann Y, Vlodavsky I, Aingorn H, Aviv A, Peretz T, Pecker I, et al.Экспрессия гепараназы в нормальной, диспластической и неопластической слизистой оболочке и строме толстой кишки человека. Доказательства его роли в онкогенезе толстой кишки. Ам Дж. Патол. (2000) 157:1167–75. doi: 10.1016/S0002-9440(10)64632-9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

26. Cohen E, Doweck I, Naroditsky I, Ben-Izhak O, Kremer R, Best LA, et al. Гепараназа гиперэкспрессируется при раке легкого и обратно коррелирует с выживаемостью пациентов. Рак (2008) 113:1004–11.doi: 10.1002/cncr.23680

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

27. Chen X, Jiang W, Yue C, Zhang W, Tong C, Dai D, et al. Гепараназа способствует трансэндотелиальной миграции клеток гепатоцеллюлярной карциномы. J Рак (2017) 8:3309–17. doi: 10.7150/jca.20159

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

28. Zheng H, Ruan J, Zhao P, Chen S, Pan L, Liu J. Гепараназа участвует в пролиферации и инвазии клеток рака яичников. Cancer Biomark (2015) 15:525–34. дои: 10.3233/CBM-150459

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

29. Koliopanos A, Friess H, Kleeff J, Shi X, Liao Q, Pecker I, et al. Экспрессия гепараназы при первичном и метастатическом раке поджелудочной железы. Рак Res . (2001) 61:4655–9.

Реферат PubMed | Академия Google

30. Yang Y, Macleod V, Miao HQ, Theus A, Zhan F, Shaughnessy JD Jr, et al. Гепараназа усиливает выделение синдекана-1: новый механизм стимуляции роста опухоли и метастазирования. J Биол Хим . (2007) 282:13326–33. дои: 10.1074/jbc.M611259200

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

31. Tatrai P, Egedi K, Somoracz A, van Kuppevelt TH, Ten Dam G, Lyon M, et al. Количественные и качественные изменения гепарансульфата при фиброгенных заболеваниях печени и гепатоцеллюлярном раке. J Гистохим Цитохим . (2010) 58:429–41. doi: 10.1369/jhc.2010.955161

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

32.Лай Дж. П., Сандху Д. С., Шир А. М., Робертс Л. Р. Опухолесупрессорная функция сульфатазы 1 человека (SULF1) в канцерогенезе. J Gastrointest Cancer (2008) 39:149–58. doi: 10.1007/s12029-009-9058-y

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

33. Lai JP, Sandhu DS, Yu C, Han T, Moser CD, Jackson KK, et al. Сульфатаза 2 активирует глипикан 3, способствует передаче сигналов фактора роста фибробластов и снижает выживаемость при гепатоцеллюлярной карциноме. Гепатология (2008) 47:1211–22.doi: 10.1002/hep.22202

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

34. Phillips JJ, Huillard E, Robinson AE, Ward A, Lum DH, Polley MY, et al. Гепарансульфатсульфатаза SULF2 регулирует передачу сигналов PDGFR-альфа и рост злокачественной глиомы человека и мыши. Дж Клин Инвест. (2012) 122:911–22. DOI: 10.1172/JCI58215

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

35. Lai JP, Oseini AM, Moser CD, Yu C, Elsawa SF, Hu C, et al.Онкогенный эффект сульфатазы 2 при гепатоцеллюлярной карциноме человека частично опосредован глипиканом 3-зависимой активацией Wnt. Гепатология (2010) 52:1680–9. doi: 10.1002/hep.23848

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

36. Lai JP, Sandhu DS, Yu C, Moser CD, Hu C, Shire AM, et al. Сульфатаза 2 защищает клетки гепатоцеллюлярной карциномы от апоптоза, индуцированного ингибитором PI3K LY294002 и ингибиторами киназы ERK и JNK. Печень Инт .(2010) 30:1522–8. doi: 10.1111/j.1478-3231.2010.02336.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

37. Batmunkh E, Tatrai P, Szabo E, Lodi C, Holczbauer A, Paska C, et al. Сравнение экспрессии агрина, гепарансульфатного протеогликана базальной мембраны, при холангиокарциноме и гепатоцеллюлярной карциноме. Хум Патол . (2007) 38:1508–15. doi: 10.1016/j.humpath.2007.02.017

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

38.Татраи П., Дудас Дж., Батмунх Э., Мате М., Залатнаи А., Шафф З. и др. Агрин, новый компонент базальной мембраны печени человека и крысы, накапливается при циррозе и гепатоцеллюлярной карциноме. Лаборатория Инвест . (2006) 86:1149–60. doi: 10.1038/labinvest.3700475

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

39. Warth A, Kroger S, Wolburg H. Перераспределение аквапорина-4 в глиобластоме человека коррелирует с потерей иммунореактивности агрина из базальных пластинок капилляров головного мозга. Акта Нейропатол . (2004) 107:311–8. doi: 10.1007/s00401-003-0812-0

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

40. McFarlane S, Coulter JA, Tibbits P, O’Grady A, McFarlane C, Montgomery N, et al. CD44 повышает эффективность отдаленного метастазирования рака молочной железы. Oncotarget (2015) 6:11465–76. doi: 10.18632/oncotarget.3410

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

41. Huh JW, Kim HR, Kim YJ, Lee JH, Park YS, Cho SH, et al.Экспрессия стандартного CD44 при колоректальной карциноме человека: связь с прогнозом. Патол Инт . (2009) 59:241–6. doi: 10.1111/j.1440-1827.2009.02357.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

43. Дитрих А., Танцос Э., Ваншайдт В., Шопф Э., Саймон Дж.К. Высокая поверхностная экспрессия CD44 на первичных опухолях злокачественной меланомы коррелирует с повышенным риском метастазирования и снижением выживаемости. Eur J Cancer (1997) 33:926–30. дои: 10.1016/S0959-8049(96)00512-6

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

44. Мунчар М.Дж., Шарифа Н.А., Джамал Р., Луи Л.М. Экспрессия CD44 коррелирует с Международной классификацией патологии нейробластомы (система Шимада) для нейробластных опухолей. Патология (2003) 35:125–9. дои: 10.1097/01268031-200335020-00005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

45. Iozzo RV, Zoeller JJ, Nystrom A. Протеогликаны базальной мембраны: преимущественно модуляторы роста рака и ангиогенеза. Mol Cells (2009) 27:503–13. doi: 10.1007/s10059-009-0069-0

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

46. O’Reilly MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, et al. Эндостатин: эндогенный ингибитор ангиогенеза и роста опухоли. Cell (1997) 88: 277–85. doi: 10.1016/S0092-8674(00)81848-6

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

48. Танака М., Исикава С., Ушику Т., Морикава Т., Исагава Т., Ямагиши М. и соавт.EVI1 модулирует онкогенную роль GPC1 в канцерогенезе поджелудочной железы. Oncotarget (2017) 8:99552–66. doi: 10.18632/oncotarget.20601

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

49. Su G, Meyer K, Nandini CD, Qiao D, Salamat S, Friedl A. Glypican-1 часто сверхэкспрессируется в глиомах человека и усиливает передачу сигналов FGF-2 в клетках глиомы. Ам Дж. Патол . (2006) 168:2014–26. doi: 10.2353/ajpath.2006.050800

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

50. Фэн М., Гао В., Ван Р., Чен В., Ман Ю.Г., Фигг В.Д. и др. Терапевтическое нацеливание на глипикан-3 с помощью конформационно-специфического однодоменного антитела при гепатоцеллюлярной карциноме. Proc Natl Acad Sci USA. (2013) 110:E1083–91. doi: 10.1073/pnas.1217868110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

51. Яманака К., Ито Ю., Окуяма Н., Нода К., Мацумото Х., Йошида Х. и др. Иммуногистохимическое исследование глипикана 3 при раке щитовидной железы. Онкология (2007) 73:389–94.дои: 10.1159/000136159

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

52. Boily G, Ouellet S, Langlois S, Lariviere M, Drouin R, Sinnett D. Анализ футпринтинга in vivo промоторной области Glypican 3 (GPC3) в клетках нейробластомы. Biochim Biophys Acta (2007) 1769:182–93. doi: 10.1016/j.bbaexp.2007.01.014

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

53. Торецкий Дж.А., Зитомерский Н.Л., Эскенази А.Е., Фойгт Р.В., Штраух Э.Д., Сан С.К., и соавт.Экспрессия глипикана-3 в опухоли Вильмса и гепатобластоме. J Pediatr Hematol Oncol . (2001) 23:496–9. дои: 10.1097/00043426-200111000-00006

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

54. Esheba GE, Pate LL, Longacre TA. Онкофетальный белок глипикан-3 отличает опухоль желточного мешка от светлоклеточной карциномы яичника. Am J Surg Pathol. (2008) 32:600–7. doi: 10.1097/PAS.0b013e31815a565a

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

55.Lin Q, Xiong LW, Pan XF, Gen JF, Bao GL, Sha HF и др. Экспрессия белка GPC3 и его значение при плоскоклеточной карциноме легкого. Мед Онкол . (2012) 29:663–9. doi: 10.1007/s12032-011-9973-1

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

56. Midorikawa Y, Ishikawa S, Iwanari H, Imamura T, Sakamoto H, Miyazono K, et al. Глипикан-3, сверхэкспрессированный при гепатоцеллюлярной карциноме, модулирует передачу сигналов FGF2 и BMP-7. Int J Cancer (2003) 103:455–65.doi: 10.1002/ijc.10856

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

57. Li Y, Miao L, Cai H, Ding J, Xiao Y, Yang J, et al. Сверхэкспрессия глипикана-5 способствует миграции раковых клеток и связана с более короткой общей выживаемостью при немелкоклеточном раке легкого. Онкол Летт. (2013) 6:1565–72. doi: 10.3892/ol.2013.1622

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

58. Li Y, Sheu CC, Ye Y, de Andrade M, Wang L, Chang SC, et al.Генетические варианты и риск рака легких у никогда не курящих: исследование ассоциации всего генома. Ланцет Онкол . (2010) 11:321–30. дои: 10.1016/S1470-2045(10)70042-5

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

59. Датта С., Пирс М., Датта М.В. Передача сигналов Perlecan: помощь ежу в стимуляции роста рака простаты. Int J Biochem Cell Biol . (2006) 38:1855–61. doi: 10.1016/j.biocel.2006.03.022

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

60.Kadenhe-Chiweshe A, Papa J, McCrudden KW, Frischer J, Bae JO, Huang J, et al. Устойчивая блокада VEGF приводит к секвестрации VEGF в микроокружении опухолями и стойкой активации рецептора VEGF-2. Мол Рак Рез . (2008) 6:1–9. doi: 10.1158/1541-7786.MCR-07-0101

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

61. Gronborg M, Kristiansen TZ, Iwahori A, Chang R, Reddy R, Sato N, et al. Открытие биомаркеров из секретома рака поджелудочной железы с использованием дифференциального протеомного подхода. Mol Cell Proteomics (2006) 5:157–71. doi: 10.1074/mcp.M500178-MCP200

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

62. Коэн И.Р., Мердок А.Д., Насо М.Ф., Марчетти Д., Берд Д., Иоццо Р.В. Аномальная экспрессия перлеканового протеогликана в метастатических меланомах. Рак Res . (1994) 54:5771–4.

Реферат PubMed | Академия Google

63. Malek-Hosseini Z, Jelodar S, Talei A, Ghaderi A, Doroudchi M. Повышенные уровни синдекана-1 в сыворотке пациентов с раком молочной железы коррелируют с размером опухоли. Рак молочной железы (2017) 24:742–7. doi: 10.1007/s12282-017-0773-0

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

64. Conejo JR, Kleeff J, Koliopanos A, Matsuda K, Zhu ZW, Goecke H, et al. Экспрессия синдекана-1 повышается при раке поджелудочной железы, но не при других видах рака желудочно-кишечного тракта. Int J Cancer (2000) 88:12–20. doi: 10.1002/1097-0215(20001001)88:1<12::AID-IJC3>3.0.CO;2-T

Полнотекстовая перекрестная ссылка

65. Davies EJ, Blackhall FH, Shanks JH, David G, McGown AT, Swindell R, et al.Распределение и клиническое значение протеогликанов гепарансульфата при раке яичников. Clin Cancer Res. (2004) 10:5178–86. doi: 10. 1158/1078-0432.CCR-03-0103

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

66. Хотская Ю.Б., Дай Ю., Ритчи Дж.П., Маклеод В., Ян Ю., Зинн К. и соавт. Синдекан-1 необходим для надежного роста, васкуляризации и метастазирования миеломных опухолей in vivo . J Биол Хим . (2009) 284:26085–95. дои: 10.1074/jbc.M109.018473

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

67. Sun M, Gomes S, Chen P, Frankenberger CA, Sankarasharma D, Chung CH, et al. RKIP и HMGA2 регулируют выживаемость и метастазирование опухоли молочной железы посредством лизилоксидазы и синдекана-2. Онкоген (2014) 33:3528–37. doi: 10.1038/onc.2013.328

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

68. Попович А., Демирович А., Спайич Б., Стимац Г., Круслин Б., Томаш Д.Экспрессия и прогностическая роль синдекана-2 при раке предстательной железы. Рак предстательной железы Дис простаты . (2010) 13:78–82. doi: 10.1038/pcan.2009.43

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

70. Marzioni D, Lorenzi T, Mazzucchelli R, Capparuccia L, Morroni M, Fiorini R, et al. Экспрессия основного фактора роста фибробластов, его рецепторов и синдеканов при раке мочевого пузыря. Int J Immunopathol Pharmacol . (2009) 22:627–38. дои: 10.1177/039463200

0308

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

71.Fears CY, Gladson CL, Woods A. Синдекан-2 экспрессируется в микроциркуляторном русле глиом и регулирует ангиогенные процессы в эндотелиальных клетках микрососудов. J Биол Хим . (2006) 281:14533–6. doi: 10.1074/jbc.C600075200

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

72. Пак Х., Хан И., Квон Х.Дж., О. Э.С. Киназа фокальной адгезии регулирует опосредованную синдеканом-2 туморогенную активность клеток фибросаркомы НТ1080. Рак Res . (2005) 65:9899–905.doi: 10.1158/0008-5472.CAN-05-1386

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

74. Gatza CE, Holtzhausen A, Kirkbride KC, Morton A, Gatza ML, Datto MB, et al. Рецептор TGF-бета типа III усиливает миграцию раковых клеток толстой кишки и независимый от привязки рост. Неоплазия (2011) 13:758–70. doi: 10.1593/neo.11528

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

75. Bernabeu C, Lopez-Novoa JM, Quintanilla M. Новая роль корецепторов суперсемейства TGF-бета при раке. Biochim Biophys Acta (2009) 1792:954–73. doi: 10.1016/j.bbadis.2009.07.003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

76. Dong M, How T, Kirkbride KC, Gordon KJ, Lee JD, Hempel N, et al. Рецептор TGF-бета типа III подавляет прогрессирование рака молочной железы. Дж Клин Инвест. (2007) 117:206–17. DOI: 10.1172/JCI29293

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

77. Терли Р.С., Фингер Э.К., Хемпель Н., Хау Т., Филдс Т.А., Блоуб Г.К.Рецептор бета-трансформирующего фактора роста типа III как новый ген-супрессор опухоли при раке предстательной железы. Рак Res . (2007) 67:1090–8. doi: 10.1158/0008-5472.CAN-06-3117

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

78. Hempel N, How T, Dong M, Murphy SK, Fields TA, Blobe GC. Потеря экспрессии бетагликанов при раке яичников: роль в подвижности и инвазии. Рак Res. (2007) 67:5231–8. doi: 10.1158/0008-5472.CAN-07-0035

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

79.Ламберт К.Э., Хуанг Х., Митрей К., Блоуб Г.К. Рецептор бета-трансформирующего фактора роста типа III ингибирует пролиферацию, миграцию и адгезию в клетках миеломы человека. Мол Биол Ячейка . (2011) 22:1463–72. doi: 10.1091/mbc.e10-11-0877

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

80. Finger EC, Turley RS, Dong M, How T, Fields TA, Blobe GC. TbetaRIII подавляет инвазивность и онкогенность немелкоклеточного рака легкого. Канцерогенез (2008) 29:528–35.doi: 10.1093/carcin/bgm289

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

81. Гордон К.Дж., Донг М., Чизлок Э.М., Филдс Т.А., Блоуб Г.К. Потеря экспрессии бета-рецептора трансформирующего фактора роста типа III увеличивает подвижность и инвазивность, связанные с переходом от эпителия к мезенхиме во время прогрессирования рака поджелудочной железы. Канцерогенез (2008) 29:252–62. doi: 10.1093/carcin/bgm249

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

82.Копленд Дж. А., Луксон Б. А., Аджани Л., Майти Т., Кампаньяро Э., Го Х. и др. Геномное профилирование выявляет изменения в передаче сигналов TGFbeta посредством потери экспрессии рецептора TGFbeta при канцерогенезе и прогрессировании почечных клеток человека. Онкоген (2003) 22:8053–62. doi: 10.1038/sj.onc.1206835

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

83. Хэнкс Б.А., Хольцхаузен А., Эванс К.С., Джеймисон Р., Гимпел П., Кэмпбелл О.М. и соавт. Подавление рецептора TGF-бета типа III создает иммунотолерантное микроокружение опухоли. Дж Клин Инвест. (2013) 123:3925–40. DOI: 10.1172/JCI65745

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

85. Higashiyama S, Abraham JA, Klagsbrun M. Гепарин-связывающий EGF-подобный фактор роста, стимулирующий миграцию гладкомышечных клеток: зависимость от взаимодействия с гепарансульфатом клеточной поверхности. J Cell Biol . (1993) 122:933–40. doi: 10.1083/jcb.122.4.933

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

86.Мацуда К., Маруяма Х., Го Ф., Клефф Дж., Итакура Дж., Мацумото Ю. и др. Глипикан-1 сверхэкспрессируется при раке молочной железы человека и модулирует митогенные эффекты множественных гепарин-связывающих факторов роста в клетках рака молочной железы. Рак Res . (2001) 61:5562–9.

Реферат PubMed | Академия Google

87. Lindblom P, Gerhardt H, Liebner S, Abramsson A, Enge M, Hellstrom M, et al. Эндотелиальное удержание PDGF-B необходимо для правильного вложения перицитов в стенку микрососудов. Гены Дев . (2003) 17:1835–40. doi: 10.1101/gad.266803

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

88. Пейн-Сондерс С., Вивиано Б.Л., Экономидес А.Н., Сондерс С. Протеогликаны гепарансульфата удерживают Noggin на клеточной поверхности: потенциальный механизм формирования градиентов костного морфогенетического белка. J Биол Хим . (2002) 277:2089–96. doi: 10.1074/jbc.M109151200

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

91.Спивак-Кройзман Т., Леммон М.А., Дикич И., Лэдбери Дж.Е., Пинчаси Д., Хуанг Дж. и др. Индуцированная гепарином олигомеризация молекул FGF отвечает за димеризацию, активацию и клеточную пролиферацию рецепторов FGF. Cell (1994) 79:1015–24. дои: 10.1016/0092-8674(94)

-9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

93. Aikawa T, Whipple CA, Lopez ME, Gunn J, Young A, Lander AD, et al. Глипикан-1 модулирует ангиогенный и метастатический потенциал раковых клеток человека и мыши. Дж Клин Инвест . (2008) 118:89–99. дои: 10.1172/JCI32412

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

94. Carey DJ, Crumbling DM, Stahl RC, Evans DM. Ассоциация гепарансульфатных протеогликанов клеточной поверхности шванновских клеток с белками внеклеточного матрикса. J Биол Хим . (1990) 265:20627–33.

Реферат PubMed | Академия Google

95. Mytilinaiou M, Nikitovic D, Berdiaki A, Kostouras A, Papoutsidakis A, Tsatsakis AM, et al.Новые роли синдекана 2 в развитии эпителиального и мезенхимального рака. IUBMB Жизнь . (2017) 69:824–33. doi: 10.1002/iub.1678

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

96. Афратис Н.А., Никитович Д., Мультхаупт Х.А., Теохарис А.Д., Кучман Дж.Р., Караманос Н.К. Синдеканы — ключевые регуляторы клеточной сигнализации и биологических функций. FEBS J. (2017) 284:27–41. doi: 10.1111/февраль 13940

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

97.Maeda T, Desouky J, Friedl A. Экспрессия Syndecan-1 стромальными фибробластами способствует росту рака молочной железы in vivo и стимулирует ангиогенез опухоли. Онкоген (2006) 25:1408–12. doi: 10.1038/sj.onc.1209168

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

98. Knelson EH, Gaviglio AL, Tewari AK, Armstrong MB, Mythreye K, Blobe GC. Рецептор TGF-бета типа III способствует опосредованной FGF2 дифференцировке нейронов при нейробластоме. Дж Клин Инвест .(2013) 123:4786–98. дои: 10.1172/JCI69657

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

99. Ren Z, van Andel H, de Lau W, Hartholt RB, Maurice MM, Clevers H, et al. Синдекан-1 способствует передаче сигналов Wnt/бета-катенин при множественной миеломе путем презентации Wnts и R-spondins. Кровь (2017) 131:982–94. дои: 10.1182/кровь-2017-07-797050

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

100. Gao W, Ho M. Роль глипикана-3 в регуляции Wnt при гепатоцеллюлярной карциноме. Представитель рака . (2011) 1:14–9.

Реферат PubMed | Академия Google

101. Zittermann SI, Capurro MI, Shi W, Filmus J. Растворимый глипикан 3 ингибирует рост гепатоцеллюлярной карциномы in vitro и in vivo . Int J Cancer (2010) 126:1291–301. doi: 10.1002/ijc.24941

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

103. Yue XL, Lehri S, Li P, Barbier-Chassefiere V, Petit E, Huang QF, et al.Взгляд на новый путь регуляции премитохондриального апоптоза миметиком гликозаминогликанов. Различие смерти клеток . (2009) 16:770–81. doi: 10.1038/cdd.2009.9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

104. У Ю.Х., Ян Ц. И., Цзянь В.Л., Линь К.И., Лай М.З. Удаление синдекана-1 способствует индуцируемому TRAIL апоптозу в клетках миеломы. Дж Иммунол . (2012) 188:2914–21. doi: 10.4049/jimmunol.1102065

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

105.Jung SH, Lee HC, Yu DM, Kim BC, Park SM, Lee YS и другие. Гепарансульфатирование необходимо для предотвращения клеточного старения. Гибель клеток Отличие . (2016) 23:417–29. doi: 10.1038/cdd.2015.107

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

107. Vicente CM, Lima MA, Nader HB, Toma L. Сверхэкспрессия SULF2 положительно регулирует туморогенность клеток рака предстательной железы человека. J Exp Clin Cancer Res . (2015) 34:25. doi: 10.1186/s13046-015-0141-x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

108.Матас-Рико Э., Ван Вин М., Лейтон-Пуиг Д., Ван ден Берг Дж., Костер Дж., Кедзиора К.М. и др. Глицерофосфодиэстераза GDE2 способствует дифференцировке нейробластомы посредством высвобождения глипикана и является маркером клинического исхода. Раковая клетка (2016) 30:548–62. doi: 10.1016/j.ccell.2016.08.016

Полнотекстовая перекрестная ссылка

111. Lamorte S, Ferrero S, Aschero S, Monitillo L, Bussolati B, Omede P, et al. Синдекан-1 способствует ангиогенному фенотипу эндотелиальных клеток множественной миеломы. Лейкемия (2012) 26:1081–90. doi: 10.1038/leu.2011.290

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

112. Пурушотаман А., Уяма Т., Кобаяши Ф., Ямада С., Сугахара К., Рапрагер А.С. и соавт. Усиленное гепараназой выделение синдекана-1 клетками миеломы способствует эндотелиальной инвазии и ангиогенезу. Кровь (2010) 115:2449–57. дои: 10.1182/кровь-2009-07-234757

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

113.Ногер О., Виллена Дж., Лорита Дж., Виларо С., Рейна М. Понижающая регуляция синдекана-2 нарушает ангиогенез в эндотелиальных клетках микрососудов человека. Разрешение ячейки опыта . (2009) 315:795–808. doi: 10.1016/j.yexcr.2008.11.016

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

115. Дуглас С., Гоял А., Иоццо Р.В. Роль перлекана и эндорепеллина в контроле опухолевого ангиогенеза и аутофагии эндотелиальных клеток. Соединить ткани Res . (2015) 56:381–91. дои: 10.3109/03008207.2015.1045297

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

116. Goyal A, Pal N, Concannon M, Paul M, Doran M, Poluzzi C, et al. Эндорепеллин, ангиостатический модуль перлекана, взаимодействует как с интегрином альфа2бета1, так и с рецептором 2 фактора роста эндотелия сосудов (VEGFR2): двойной антагонизм к рецепторам. J Биол Хим . (2011) 286:25947–62. doi: 10.1074/jbc.M111.243626

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

121.Haruyama Y, Kataoka H. Glypican-3 является прогностическим фактором и иммунотерапевтической мишенью при гепатоцеллюлярной карциноме. World J Гастроэнтерол . (2016) 22: 275–83. дои: 10.3748/wjg.v22.i1.275

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

123. Chung JS, Tamura K, Cruz PD Jr, Ariizumi K. DC-HIL-экспрессирующие миеломоноцитарные клетки являются критическими промоутерами роста меланомы. Дж Инвест Дерматол . (2014) 134:2784–94. doi: 10.1038/jid.2014.254

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

125.Hecht ML, Rosental B, Horlacher T, Hershkovitz O, De Paz JL, Noti C, et al. Рецепторы естественной цитотоксичности NKp30, NKp44 и NKp46 связываются с различными последовательностями гепарансульфата/гепарина. J Протеом Рез. (2009) 8:712–20. дои: 10.1021/pr800747c

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

126. Mayes K, Elsayed Z, Alhazmi A, Waters M, Alkhatib SG, Roberts M, et al. BPTF ингибирует активность NK-клеток и изобилие естественных ко-лигандов рецепторов цитотоксичности. Oncotarget (2017) 8:64344–57. doi: 10.18632/oncotarget.17834

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

128. Фернандес-Вега И., Гарсия-Суарес О., Гарсия Б., Креспо А., Астудильо А., Кирос Л.М. Протеогликаны гепарансульфата подвергаются дифференциальным изменениям экспрессии при правостороннем колоректальном раке в зависимости от их метастатического характера. BMC Рак (2015) 15:742. doi: 10.1186/s12885-015-1724-9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

129.Jang B, Jung H, Chung H, Moon BI, Oh ES. Синдекан-2 усиливает отщепление Е-кадгерина и фибробластоподобные морфологические изменения, индуцируя экспрессию ММР-7 в клетках рака толстой кишки. Biochem Biophys Res Commun . (2016) 477:47–53. doi: 10.1016/j.bbrc.2016.06.019

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

130. Yang N, Friedl A. Синдекан-1-индуцированное выравнивание волокон внеклеточного матрикса требует интегрина αvβ3 и эктодомена синдекана-1 и цепей гепарансульфата. PLoS ONE (2016) 11:e0150132.doi: 10.1371/journal.pone.0150132

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

131. Chakraborty S, Njah K, Pobbati AV, Lim YB, Raju A, Lakshmanan M, et al. Агрин как сигнал механотрансдукции, регулирующий YAP через путь гиппопотама. Cell Rep. (2017) 18:2464–79. doi: 10.1016/j.celrep.2017.02.041

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

133. Kawahara R, Granato DC, Carnielli CM, Cervigne NK, Oliveria CE, Rivera C, et al.Агрин и перлекан опосредуют онкогенные процессы при плоскоклеточном раке полости рта. PLoS ONE (2014) 9:e115004. doi: 10.1371/journal.pone.0115004

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

134. Шарма Б., Хэндлер М., Эйхштеттер И., Уайтлок Дж.М., Ньюджент М.А., Иоццо Р.В. Антисмысловое нацеливание перлекана блокирует рост опухоли и ангиогенез in vivo . Дж Клин Инвест . (1998) 102:1599–608. дои: 10.1172/JCI3793

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

135.Хариси Р., Дудас Дж., Тимар Ф., Погани Г., Тимар Дж., Ковальски И. и др. Инвазивный рост и переключение топоизомеразы, индуцированные опухолевым внеклеточным матриксом в культуре клеток остеосаркомы. Cell Biol Int . (2005) 29:959–67. doi: 10.1016/j.cellbi.2005.08.010

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

136. Zheng X, Gai X, Han S, Moser CD, Hu C, Shire AM, et al. Ингибитор сульфатазы 2 человека 2,4-дисульфонилфенил-трет-бутилнитрон (ОКН-007) обладает противоопухолевым действием при гепатоцеллюлярной карциноме, опосредованным подавлением передачи сигналов TGFB1/SMAD2 и Hedgehog/GLI1. Гены Хромосомы Рак . (2013) 52:225–36. doi: 10.1002/gcc.22022

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

137. Gao W, Kim H, Ho M. Человеческое моноклональное антитело, нацеленное на гепарансульфатные цепи глипикана-3, ингибирует HGF-опосредованную миграцию и подвижность клеток гепатоцеллюлярной карциномы. PLoS ONE (2015) 10:e0137664. doi: 10.1371/journal.pone.0137664

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

138.Вайсманн М., Арвац Г., Горовиц Н., Фельд С., Народицкий И., Чжан Ю. и др. Антитела, нейтрализующие гепараназу, замедляют рост и метастазирование опухоли лимфомы. Proc Natl Acad Sci USA . (2016) 113:704–9. doi: 10.1073/pnas.1519453113

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

139. Чжан Ю.Ф., Тан С.Д., Гао Дж.Х., Фанг Д.К., Ян С.М. Гепараназа: универсальная иммунотерапевтическая мишень при раке человека. Drug Discov Today (2011) 16:412–7. doi: 10.1016/j.друдис.2011.02.015

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

140. Chen T, Tang XD, Wan Y, Chen L, Yu ST, Xiong Z, et al. HLA-A2-рестриктированные эпитопы цитотоксических Т-лимфоцитов из гепараназы человека как новые мишени для иммунотерапии опухолей широкого спектра действия. Неоплазия (2008) 10:977–86. doi: 10.1593/neo.08576

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

141. Baburajeev CP, Mohan CD, Rangappa S, Mason DJ, Fuchs JE, Bender A, et al.Идентификация нового класса триазоло-тиадиазолов как мощных ингибиторов гепараназы человека и их противоопухолевой активности. BMC Рак (2017) 17:235. doi: 10.1186/s12885-017-3214-8

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

142. Foglieni C, Pagano K, Lessi M, Bugatti A, Moroni E, Pinessi D, et al. Интеграция инструментов вычислительной и химической биологии в открытие антиангиогенных низкомолекулярных лигандов FGF2, полученных из эндогенных ингибиторов. Научный представитель . (2016) 6:23432. дои: 10.1038/srep23432

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

143. Saez B, Ferraro F, Yusuf RZ, Cook CM, Yu VW, Pardo-Saganta A, et al. Ингибирование синтеза гепарансульфата стромальными клетками улучшает мобилизацию стволовых клеток и обеспечивает приживление трансплантата без цитотоксического кондиционирования. Кровь (2014) 124:2937–47. дои: 10.1182/кровь-2014-08-593426

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

144.Brennan TV, Lin L, Brandstadter JD, Rendell VR, Dredge K, Huang X и другие. Противолимфомные эффекты, опосредованные миметиком гепарансульфата PG545, требуют TLR9-зависимой активации NK-клеток. Дж Клин Инвест . (2016) 126: 207–19. DOI: 10.1172/JCI76566

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

145. Jung DB, Yun M, Kim EO, Kim J, Kim B, Jung JH, et al. Миметик гепарансульфата PG545 вмешивается в передачу сигналов Wnt/бета-катенина и значительно подавляет онкогенез поджелудочной железы в одиночку и в комбинации с гемцитабином. Oncotarget (2015) 6:4992–5004. doi: 10.18632/oncotarget.3214

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

146. Gao W, Tang Z, Zhang YF, Feng M, Qian M, Dimitrov DS, et al. Иммунотоксин, нацеленный на глипикан-3, регрессирует рак печени за счет двойного ингибирования передачи сигналов Wnt и синтеза белка. Нац Коммуна . (2015) 6:6536. doi: 10.1038/ncomms7536

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

147. Ли Н, Фу Х, Хьюитт С.М., Димитров Д.С., Хо М.Терапевтическое нацеливание на глипикан-2 через химерные антигенные рецепторы на основе однодоменных антител и иммунотоксины при нейробластоме. Proc Natl Acad Sci USA . (2017) 114:E6623–E31. doi: 10.1073/pnas.1706055114

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

148. Bosse KR, Raman P, Zhu Z, Lane M, Martinez D, Heitzeneder S, et al. Идентификация GPC2 в качестве онкопротеина и потенциальной иммунотерапевтической мишени при нейробластоме высокого риска. Раковая клетка (2017) 32: 295–309.е12. doi: 10.1016/j.ccell.2017.08.003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

152. Granes F, Berndt C, Roy C, Mangeat P, Reina M, Vilaro S. Идентификация нового сайта связывания Ezrin в синдекан-2 цитоплазматическом домене. ФЭБС Письмо . (2003) 547: 212–6. doi: 10.1016/S0014-5793(03)00712-9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

153. Kasza I, Suh Y, Wollny D, Clark RJ, Roopra A, Colman RJ, et al. Синдекан-1 необходим для поддержания внутрикожного жира и предотвращения холодового стресса. Генетика PLoS. (2014) 10:e1004514. doi: 10.1371/journal.pgen.1004514

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

154. Menard JA, Christianson HC, Kucharzewska P, Bourseau-Guilmain E, Svensson KJ, Lindqvist E, et al. Стимуляция метастазирования гипоксией и индуцированным ацидозом поглощением внеклеточных липидов опосредована протеогликан-зависимым эндоцитозом. Рак Res. (2016) 76:4828–40. doi: 10.1158/0008-5472.CAN-15-2831

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

R-спондинов взаимодействуют с протеогликанами гепарансульфата для усиления передачи сигналов WNT

Домен TSP/BR в RSPO сохраняется у позвоночных, примитивных хордовых и полухордовых, что указывает на функциональную роль этих лигандов в передаче сигналов (de Lau et al. , 2012). Домен TSP/BR может связываться с цепями HS, но его роль в усилении передачи сигналов WNT/β-catenin остается неопределенной. Первоначальные исследования показали, что этот домен необязателен, поскольку фрагмент RSPO, содержащий только домены FU1 и FU2, может амплифицировать передачу сигналов WNT/β-катенина in vitro (Glinka et al., 2011; Казанская et al., 2004; Kim et al. ., 2008; Зебиш и др., 2013). Наша предыдущая (Lebensohn and Rohatgi, 2018) и текущая работа показывают четкую функцию домена TSP/BR RSPO3 в передаче сигналов WNT/β-катенина in vitro и ex vivo: (1) он необходим для передачи сигналов в отсутствие LGR. и (2) он усиливает сигнальную активность в присутствии LGR как в культивируемых клетках, так и в кишечных органоидах.В этом отчете мы сосредоточились на RSPO3, но ранее мы продемонстрировали, что RSPO2 (но не RSPO1 или RSPO4) также может усиливать передачу сигналов WNT/β-catenin в отсутствие LGR. Будет интересно определить, могут ли TSP/BR-домены RSPO1 и RSPO4 также повышать активность лиганда, особенно в свете наблюдения, что только RSPO2 и RSPO3, но не RSPO1 или RSPO4, связываются с SDC1-4 (Ohkawara et al. , 2011). Возможно, дивергентные биологические функции разных RSPO (de Lau et al., 2012) продиктованы их способностью передавать сигналы через HSPG, LGR или и то, и другое.Важно отметить, что мы не знаем, как концентрации RSPO в тканях сравниваются с концентрациями, обычно используемыми в системах культивирования in vitro, которые могут быть произвольно высокими. Т.о., домен TSP/BR может иметь решающее значение для некоторых RSPO для потенцирования передачи сигналов WNT in vivo, особенно в режимах ограничения концентрации лиганда в тканях.

До этого исследования было сложно отделить роль HSPGs в обеспечении передачи сигналов через основной путь WNT/β-catenin от их вклада в усиление передачи сигналов WNT с помощью RSPOs.HSPGs и HS цепи первоначально были вовлечены в распределение, стабильность и активность лигандов WNT в исследованиях Drosophila , у которых отсутствует сигнальный модуль RSPO для амплификации WNT (Baeg et al., 2001; Reichsman et al., 1996). В этих исследованиях HSPG стимулировали передачу сигналов WNT/β-catenin путем прямого связывания с лигандами WNT. Однако также было показано, что истощение цепей HS в результате генетического нарушения ферментов, необходимых для их синтеза, ухудшает передачу сигналов WNT/β-катенина и связанные с ними ответы в кишечнике мыши, молочной железе мыши и в клетках множественной миеломы, во всех контекстах, в которых RSPO играют заметную роль (Alexander et al., 2000; Рен и др., 2018 г.; Ямамото и др., 2013). Таким образом, снижение потенцированной RSPO передачи сигналов WNT, вызванное истощением HSPG, может быть связано с дефектом приема WNT, приема RSPO или того и другого. Фактически, ранее мы показали (Lebensohn et al., 2016; Lebensohn and Rohatgi, 2018), что нарушение рецепции WNT является причиной того, что гены, кодирующие белки, необходимые для биогенеза GPC, и GPC4, наиболее распространенный GPC в клетках HAP1, заметные попадания на обоих наших экранах RSPO (рис. 6A–C и дополнительные файлы 4 и 5).Наши нынешние эксперименты по мутагенезу и инженерии RSPO, которые оставляют репертуар клеток HSPG нетронутым и их роль в рецепции WNT не нарушены, ясно демонстрируют, что взаимодействия с HSPG также необходимы для рецепции RSPO.

Как функционируют HSPG во время рецепции лигандов RSPO? HSPG вовлечены в функцию многих лигандов (обзор в Sarrazin et al., 2011), включая хемокины и факторы роста, которые активируют рецепторные тирозинкиназы, такие как фактор роста фибробластов (FGF).В этих случаях HSPG могут функционировать как корецепторы, либо моделируя взаимодействие лиганд-рецептор (например, взаимодействие между FGF и его рецептором), либо индуцируя конформационные изменения в лиганде, повышающие его способность взаимодействовать с рецепторами (такие как индуцированный антитромбином). В обоих этих случаях можно предположить, что экзогенно добавленный гепарин (не привязанный к клеточной поверхности, в отличие от цепей HS HSPG) будет способствовать взаимодействию рецептор-лиганд. Альтернативно, HSPG могут функционировать как эндоцитарные рецепторы, опосредуя поглощение лиганда и деградацию в лизосомах (Belting, 2003; Sarrazin et al., 2011; Уильямс и Фуки, 1997). Наши результаты более согласуются с тем, что HSPGs функционируют как эндоцитарные рецепторы в передаче сигналов RSPO. Во-первых, экзогенно добавленный гепарин ингибирует, а не способствует передаче сигналов RSPO (Lebensohn and Rohatgi, 2018). Во-вторых, домен TSP/BR может быть заменен ненативным, HS-связывающим scFv, что делает стерические эффекты или конформационные изменения маловероятными. Вместо этого простого взаимодействия между RSPO и HSPG, по-видимому, достаточно для передачи сигналов. Наши результаты прямо демонстрируют, что как WT RSPO3, так и RSPO3 ΔTSP/BR HS20 могут вызывать интернализацию и деградацию RNF43-Flag в клетках, лишенных LGR (рис. 3B).Поскольку ZNRF3 и RNF43 представляют собой убиквитинлигазы E3, которые негативно регулируют рецепторы WNT, их удаление с клеточной поверхности, индуцированное взаимодействиями RSPO3-HSPG, было бы достаточным для усиления передачи сигналов WNT.

Наша работа также проливает свет на относительную роль HSPGs и LGRs в опосредовании передачи сигналов различными членами семейства RSPO. Предыдущие исследования предполагали, что одновременное связывание RSPO с LGR через домен FU2 и с ZNRF3/RNF43 через домен FU1 запускает убиквитинирование, эндоцитоз и деградацию ZNRF3/RNF43 (Hao et al. , 2012; Ку и др., 2012). Аффинность домена FU2 к LGR высока (в диапазоне нМ) для всех RSPO, в то время как аффинность домена FU1 к ZNRF3/RNF43 намного выше для RSPO2 и RSPO3 по сравнению с RSPO1 и RSPO4 (Zebisch et al., 2013). ). По крайней мере, для RSPO3 наши эксперименты показывают, что взаимодействия с LGR недостаточно для запуска эффективного эндоцитоза RNF43. Связывание HSPG, обеспечиваемое нативным доменом TSP/BR или ненативным scFv HS20, также необходимо даже в присутствии LGR (рис. 3А).В случае RSPO3, а также RSPO2 LGR не только недостаточны для обеспечения передачи сигналов RSPO, но и фактически необязательны. Скорее всего, это связано с более высоким сродством этих лигандов RSPO к ZNRF3/RNF43, поскольку замены ZNRF3/RNF43-связывающего домена FU1 RSPO1 на домен RSPO3 достаточно, чтобы сделать RSPO1 способным передавать сигналы без LGR (Lebensohn and Rohatgi, 2018). ). Однако, даже когда присутствуют LGR, HSPG могут заметно повышать эффективность RSPO3 (рис. 1D и рис. 5A и B) и, возможно, других RSPO. Одна возможность заключается в том, что HSPG захватывают RSPO вблизи клеточной поверхности, увеличивая их локальную концентрацию и степень их связывания с LGR. Эта модель подтверждается наблюдением, что генетическое или ферментативное истощение цепей HS или удаление домена TSP/BR снижает связывание RSPO с поверхностью клеток множественной миеломы, в то время как генетическое истощение LGR4 этого не делает (Ren и др., 2018). В качестве альтернативы может потребоваться одновременное связывание RSPO3 с LGR и HSPG для запуска эффективного эндоцитоза.

Осталось несколько вопросов. Мы не идентифицировали ни одного HSPG, который служит рецептором RSPO в клетках HAP1, скорее всего, потому, что HSPG многократно избыточны в этих клетках (Lebensohn and Rohatgi, 2018). Разрушение GPC3, GPC4, всех GPI-заякоренных GPC или всех SDC либо не влияло, либо лишь частично снижало сигнальную активность RSPO3 дикого типа и синтетических лигандов RSPO3 ΔTSP/BR HS20 (рис. 4B и C). Только разрушение всех HS-содержащих HSPG существенно снижает передачу сигналов этими RSPO, подтверждая функциональную избыточность HSPG. Однако специфические HSPG могут иметь значение в разных тканях, стадиях развития или патологических состояниях. Например, было показано, что взаимодействие SDC4 и RSPO3 регулирует передачу сигналов WNT/плоскостной клеточной полярности (PCP) во время гаструляции Xenopus посредством процесса, который требует клатрин-опосредованного эндоцитоза (Ohkawara et al., 2011), а SDC1, как было показано, способствуют передаче сигналов при множественной миеломе, представляя WNT и RSPO (Ren et al., 2018). Будет интересно проверить, опосредуют ли специфические HSPG передачу сигналов RSPO во время развития тканей, которым не требуется функция LGR, таких как конечности и легкие (Szenker-Ravi et al., 2018). Мы также не можем сбрасывать со счетов возможность того, что существуют другие неоткрытые корецепторы, способные опосредовать усиление передачи сигналов WNT с помощью RSPOs во время развития. Наши гаплоидные генетические скрининги, возможно, не смогли идентифицировать альтернативный корецептор RSPO, если он был избыточным, необходимым для жизнеспособности или роста клеток или просто не экспрессировался в клетках HAP1. Это известные предостережения относительно генетических скринингов потери функции.

Несмотря на эти возможности, наши текущие и предыдущие результаты (Lebensohn and Rohatgi, 2018) убедительно свидетельствуют о том, что HSPG, такие как GPC или SDC, являются основными корецепторами, помимо ZNRF3 или RNF43, которые передают сигналы RSPO в присутствии и в отсутствие ЛГР.

Функции гепарансульфата изменены в остеоартритном хряще | Arthritis Research & Therapy

Роль HSPG при ОА почти не исследована, в частности изменения их функциональных возможностей в зависимости от степени сульфатации цепей HS. Наш протокол экстракции GAG позволил выделить достаточное количество HS из хрящей для изучения их структуры и функциональных эффектов, включая их аффинность связывания с HBP. Мы обнаружили 2-кратное снижение уровня HS в хрящах ОА по сравнению с контролем, в соответствии с предыдущими работами, которые показали более низкое снижение HS, вероятно, из-за более низкого выхода экстракции HS [7]. Изменения коснулись и состава других ГАГ.

Мы показали, что уровни моносульфатированных дисахаридов CS были увеличены в хрящах OA. Этот вывод согласуется с отчетом, показывающим увеличение уровней моносульфатированного CS (GalNAc 6-O-сульфатирование) при ОА и изменения соотношения CS4/CS6 [22]. Это может быть связано с изменениями в составе аггрекана, что, в свою очередь, может влиять на метаболизм и свойства хондроцитов, приводя к ОА, но основные механизмы до сих пор плохо изучены [23].Моносульфатированные дисахариды были основными формами HS, наблюдаемыми в контрольных хрящах человека, и эта фракция была увеличена при ОА вместе с появлением дисульфатированных дисахаридов. Это может быть связано с наличием неосинтезированных ГВ с N-сульфатированием, что связано с активностью сульфотрансферазы Ndst, определяющей высокосульфатированные участки в цепи ГВ. Парра и др. показали очень высокую степень сульфатирования, сходную с гепарином, второстепенных HS, присутствующих в пластинках роста и зрелых суставных хрящах у молодых кроликов, с помощью структурного анализа ЯМР [21, 22]. Такой высокосульфатированный HS может быть получен как функциональный ответ на потребность в растущей ткани с сильной пролиферацией хондроцитов. Соответственно, Chanalaris et al. показали значительное увеличение 6-O-сульфатирования в дисахаридах HS из образцов OA человека по сравнению с контролем [7]. Таким образом, можно предположить, что характер сульфатирования HS может варьироваться в зависимости от вида, возраста, типа хряща и клеточного метаболизма.

По сравнению с другими опубликованными исследованиями, оценивающими изменения в уровнях HS и характере сульфатирования при ОА, основным исходным результатом нашей работы является то, что мы наблюдали изменения в связывающей способности HS, CS и KS, выделенных из образцов OA, для HBP и изменение в балансе между анаболизмом и катаболизмом в хондроцитах.

Вполне вероятно, что в используемой клеточной системе in vitro хондроциты, высеянные на чашки, экспрессировали клеточную поверхность и перицеллюлярные HS-протеогликаны, которые связывались с HS-лигандами, присутствующими в культуральной среде, при сохранении баланса между анаболической и катаболической активностью. Таким образом, повышенные катаболические эффекты, наблюдаемые при добавлении ГВ из хрящей ОА, можно объяснить различными биологическими эффектами: (i) прямым влиянием на связывание и активность катаболических факторов, присутствующих в культуральной среде и/или секретируемых хондроцитами, которые будут сильно индуцированы для взаимодействия со своими рецепторами, индуцируя катаболические фенотипы и (ii) непрямой или конкурентный эффект, поскольку экзогенные ГАГ могут вытеснять анаболические факторы роста из клеточного слоя, предотвращая их взаимодействие со своими рецепторами.Таким образом, усиленные катаболические эффекты, наблюдаемые в присутствии ГС из хрящей при ОА, могут быть связаны с более высоким сродством ко всем типам (анаболическим или катаболическим) факторов роста.

Интересно, что мы показали, что общее количество ГАГ из контрольных хрящей было способно связываться с FGF2, но в основном из-за аффинности связывания HS с этим HBP, которая была снижена в хрящах OA. FGF2 эндогенно продуцируется хондроцитами и секвестрируется перлеканом, матриксом HSPG, в ECM суставного хряща [24, 25]. Когда хрящ повреждается, FGF2 высвобождается из цепей перлекана HS [26], чтобы впоследствии активировать сигнальный путь ERK [27]. Это было связано с катаболическими эффектами в суставных хондроцитах человека посредством активации ферментов, разрушающих матрикс, ингибирования накопления ECM, увеличения синтеза PG и кластеризации клеток, характерных для ОА [28]. Мы показали здесь, что измененные уровни HS и характер сульфатирования в хрящах человека при OA были связаны со сниженной аффинностью связывания HS с FGF2.Мы предположили, что эта более низкая аффинность связывания цепей HS с FGF2 может быть связана с уменьшением его секвестрации перлеканом в ECM и, таким образом, с увеличением биодоступности FGF2 и катаболической активности на хондроцитах.

Мы наблюдали повышенные уровни моносульфатированных и дисульфатированных форм дисахаридов HS из хрящей ОА, что может быть связано с первым повышенным уровнем N-сульфатирования. Недавно Северманн и соавт. проанализировали роль уровней HS и паттернов сульфатирования в ОА, индуцированном у трансгенных мышей, несущих хондроцит-специфический аллель потери функции Ext1 и Ndst1 [29]. Линии мышей со сниженным уровнем HS и сульфатированным HS продемонстрировали снижение показателей ОА, что свидетельствует о том, что «высоко» сульфатированный HS может регулировать дегенерацию хряща посредством воздействия на активность протеазы. FGF2 связывается преимущественно с HS, содержащими идуронат-2-O-сульфат и глюкозамин-N-сульфаты, тогда как 6-O-сульфатирование необходимо для взаимодействия с рецептором в тримолекулярном сигнальном комплексе FGF2/FGFR/HS и его митогенной активности [30,31]. ,32]. Уровни 6-O-сульфатирования четко регулируют индуцированное FGF2 фосфорилирование рецепторов, интернализацию FGFR1 и нижестоящие FGF2-зависимые эндотелиальные фенотипы in vitro и in vivo [33].

Мы показали, что в то время как общее количество ГАГ из контрольных хрящей не связывалось с VEGF, общее количество ГАГ из хрящей ОА было способно связываться с ним, и это по-прежнему в основном связано с аффинностью связывания HS с этим HBP. Интересно, что экспрессия VEGF повышена в хрящах при ОА и коррелирует с тяжестью заболевания. Соответственно, VEGF является прокатаболическим и проангиогенным фактором при ОА, который индуцирует экспрессию MMP13, образование остеофитов и дифференцировку в сторону гипертрофического состояния [21]. В животных моделях ОА блокада VEGF моноклональными антителами или у нокаутированных мышей снижала тяжесть ОА, тогда как внутрисуставная инъекция VEGF усугубляла повреждение хряща [26, 27].Таким образом, наши данные свидетельствуют о том, что повышенная аффинность общего количества ГАГ из хрящей ОА к VEGF может играть роль в различных катаболических процессах.

Ключевые структурные особенности высокосульфатированных доменов ГС опосредуют специфическое связывание димера VEGF-165 с его рецепторами: карбоксилатные группы и 2-О-, 6-О- и N-сульфатирование ГС вносят вклад в силу VEGF -165 взаимодействий. Однако N-сульфаты и 6-O-сульфаты, по-видимому, особенно важны для связывания VEGF-165 [34].Хотя высокое содержание 2-О-сульфатных групп не требуется для специфического взаимодействия с VEGF-165, оно необходимо для его митогенной активности [35]. Более того, структуры ГС со сниженным 6-О-сульфатированием негативно влияют на VEGF-165-зависимые эндотелиальные фенотипы in vitro и in vivo, подтверждая важность паттерна 6-0-сульфатирования для биологической активности [33].

Как описано в литературе, количество N-сульфатированных ГС и/или сульфатированных 6-О-ГС увеличивается во время ОА, что приводит к повышенной аффинности связывания ГС с FGF2 и VEGF.Однако наш анализ связывания in vitro на HS, выделенном из хряща, показывает, что повышенное сульфатирование HS при ОА связано со сниженным связыванием HS с FGF2 и VEGF. Это свидетельствует о том, что здесь задействованы гораздо более сложные модели сульфатирования цепей ГВ, процесс, который, вероятно, своевременно регулируется. Более того, они могут оказывать различное модулирующее действие на клетки в зависимости от последовательных взаимодействий с их рецепторами при наличии CS и KS.

В этом контексте вновь продуцируемые сульфатированные ГС, как показано связанной с ОА генерацией дисульфатированных дисахаридов, могут потребовать изменений в характере экспрессии сложной сети ферментов, участвующих в биосинтезе ГС, таких как анаболические гликозилтрансферазы (EXTs и EXTLs) , эпимеразы и сульфотрансферазы (NDST и HSTS), а также катаболическую гепараназу и HS 6-O-эндосульфатазы (Sulfs) [36]. Повышенные уровни 6-O-сульфатирования при ОА недавно коррелировали с повышенной экспрессией HS6ST1, 6-O-сульфотрансферазы, и GLCE, эпимеразы, стимулирующей 6-O-сульфатирование, что позволяет предположить, что изменения в 6-O-сульфатировании могли воздействие на ключевой сигнальный путь в хряще [7]. Кроме того, эндосульфатазы, Sulf1 и Sulf2, сверхэкспрессированы в тканях ОА человека [37, 38], и было показано, что спонтанная дегенерация хряща и вызванный хирургическим вмешательством ОА значительно более выражены у Sulf1 -/- и Sulf2 -/- мышей по сравнению с мышами дикого типа [39].Соответственно, внутрисуставная инъекция Sulf1 в мышиной модели ОА предотвращала дегенерацию хряща [40]. Это говорит о том, что десульфатация 6-O-HS может оказывать защитное действие при ОА. Наши результаты согласуются с этими выводами, демонстрирующими функциональную значимость чрезмерно сульфатированного HS с нарушением связывания с FGF2 и VEGF и результирующим катаболическим фенотипом в хондроцитах при ОА.

В этой работе мы сосредоточились на разработке протокола выделения HS, обеспечивая при этом эффективное переваривание хондроитиназой и кератиназой.Стадия очистки дисахаридов не проводилась, поскольку предыдущие данные из литературы показали эффективность расщепления хондроитиназой ABC в снижении функциональной активности различных препаратов CS. Было показано, что переваренные CS-E и CS-H больше не способны связываться с гепарин-связывающими факторами роста (HBGF), такими как FGF2, FGF1, FGF18 или PTN; ингибировать связывание полноразмерных CS с HBGF; и индуцируют рост нейритов эмбриональных нейронов гиппокампа крысы [41]. Было показано, что это явление зависит от размера дисахаридов CS, которые теряют всю свою связывающую и биологическую активность [42].Это свидетельствует о том, что дисахариды ХС, хотя и являются значительно более концентрированными, чем ГВ, не будут оказывать никакого влияния на связывание ГВ с белковыми лигандами.

Наконец, наши эксперименты по связыванию подтверждают важную регулирующую роль видов CS/KS в связывающих свойствах GAG, экстрагированных из хрящей, что отражает их модулирующее действие на сродство HS к FGF2 и VEGF. В контрольных хрящах HS был способен связываться с FGF2, но с общими экстрактами GAG, содержащими смесь CS и KS, эта аффинность связывания была увеличена, возможно, чтобы обеспечить лучшее удержание FGF2 в матрице.Точно так же HS из контрольных хрящей связывался с VEGF с сильным сродством, но связывание смеси CS и KS в общих экстрактах GAG было полностью подавлено. Хотя различия, наблюдаемые в тесте биохимического связывания in vitro, менее биологически значимы, чем результаты in vivo, наши результаты показывают, что взаимодействия HS, CS и KS регулируются сложным взаимодействием, которое может зависеть от вовлеченного HBP и от протеогликанов, несущих GAG. цепи. Наши данные показали, что в образцах ОА наряду со сниженной аффинностью связывания HS с FGF2 и VEGF утрачивались или уменьшались модулирующие свойства CS/KS.Смесь CS и KS больше не была способна повышать связывание HS с FGF2 и снижать связывание HS с VEGF. Это также может быть связано со сложными структурными изменениями и/или измененным сульфатированием цепей CS и KS.

Такое предположение также должно учитывать реальное расположение цепей HS, CS и KS на PG в хряще. В то время как в хряще HS в основном расположены в перицеллюлярной области, большинство CS/KS на аггрекане расположены в межтерриториальной зоне и в значительной степени исключены из перицеллюлярной области.Однако это не исключает того факта, что некоторые перицеллюлярные HSPG, такие как перлекан или синдекан, могут быть замещены CS или KS цепями, связанными с HS цепями. Перлекан млекопитающих преимущественно замещен HS-цепями, но он также может замещать CS, дерматансульфат (DS), HS/CS-гибрид и CS/DS-цепи в основных сайтах связывания ГАГ на доменах I [43, 44] и V [43, 44] и V [43, 44]. 45]. Синдеканы были первыми PG гибридного типа, описанными как несущие как HS, так и CS цепи. Синдеканы из разных типов клеток обнаруживаются в виде дискретных изоформ с вариабельностью типа, количества и размера присоединенных цепей ГАГ, что приводит к различным потенциальным взаимодействиям [46].Роль цепей HS заключается в привлечении и представлении различных белков на клеточной поверхности, тогда как роль цепей CS (и родственных DS), которые связываются с матриксными белками [47] и растворимыми молекулами [48], должна заключаться в изменении взаимодействия между синдеканами, их HS-цепями и другими белками, как показано для мидкина и плейотрофина [49, 50]. Таким образом, мы могли бы предложить молекулярный механизм, в котором вязкость цепей CS/KS с цепями HS на одном и том же коровом белке и связанное расположение поливалентных цепей будут влиять и стабилизировать прямые взаимодействия между цепями HS и HBP, даже если здесь CS и KS цепи из хрящей не взаимодействовали напрямую с тестируемым НВР.Наши результаты предполагают новую роль CS и KS, которые могут регулировать доступность функциональных цепей HS для их целевых HBP. Сложные взаимодействия между различными моделями сульфатирования смеси HS, CS и KS еще предстоит выяснить.

Гепарансульфат протеогликанов

Аннотация

Гепарансульфатные протеогликаны обнаруживаются на поверхности клеток и во внеклеточном матриксе, где они взаимодействуют с множеством лигандов.За последнее десятилетие появилось новое понимание механизма и биологического значения этих взаимодействий. Здесь мы обсуждаем изменение взглядов на специфичность связывания белка с гепарансульфатом и активность HSPG как рецепторов. и корецепторы. Несмотря на небольшое количество протеогликанов гепарансульфата, они оказывают глубокое воздействие на клеточные, тканевые и организменном уровне.

Гепарансульфатные протеогликаны (HSPG) представляют собой гликопротеины, общей характеристикой которых является содержание одного или нескольких ковалентно присоединенные цепи гепарансульфата (HS), тип гликозаминогликанов (GAG) (Esko et al.2009). Клетки вырабатывают относительно небольшой набор HSPG (около 17), которые делятся на три группы в зависимости от их расположения: мембрана HSPG, такие как синдеканы и гликозилфосфатидилинозитол-заякоренные протеогликаны (глипиканы), секретируемый внеклеточный матрикс HSPG (агрин, перлекан, коллаген типа XVIII) и протеогликан секреторных пузырьков, серглицин (таблица 1). Большая часть ранних работ в этой области была сосредоточена на составе (размер, число цепей и структура цепей HS), биосинтезе, и связующие свойства цепей.В 1985 г. были идентифицированы первые мутанты соматических клеток с измененной экспрессией HSPG (Esko et al. 1985), что позволило провести функциональные исследования в контексте модели клеточной культуры (Zhang et al. 2006). Десять лет спустя были идентифицированы первые мутанты HSPG в модельном организме ( Drosophila melanogaster ) (Rogalski et al., 1993; Nakato et al., 1995; Häcker et al., 1997; Bellaiche et al., 1998; Lin et al., 1999). ), за которым последовала идентификация мутантов у нематод, древесных лягушек, рыбок данио и мышей (таблицы 2 и 3).HS является эволюционно древним, и его состав оставался относительно постоянным от Hydra до человека (Yamada et al. 2007; Lawrence et al. 2008).

Таблица 1.

Гепарансульфатные протеогликаны

Таблица 2.

Мутанты с измененными коровыми белками HSPG

Таблица 3.

Мутанты мыши с измененным биосинтезом HS

На рис. 1 в графическом виде показаны многие системы, в которых участвуют HSPG.

  1. HSPG присутствуют в базальных мембранах (перлекан, агрин и коллаген XVIII), где они взаимодействуют с другими компонентами матрикса. определить структуру базальной мембраны и обеспечить матрицу для миграции клеток.

  2. HSPG обнаружены в секреторных везикулах, в первую очередь серглицин, который играет роль в упаковке гранулированного содержимого, поддерживая протеазы в активном состоянии и регулируют различные биологические активности после секреции, такие как коагуляция, защита хозяина, и заживление ран.

  3. HSPG могут связывать цитокины, хемокины, факторы роста и морфогены, защищая их от протеолиза.Эти взаимодействия обеспечивают депо регуляторных факторов, которые могут высвобождаться при селективной деградации цепей HS. Они также облегчают формирование градиентов морфогенов, необходимых для спецификации клеток во время развития, и вовлеченных градиентов хемокинов рекрутинг и хоминг лейкоцитов.

  4. HSPG

    могут действовать как рецепторы для протеаз и ингибиторов протеаз, регулирующих их пространственное распределение и активность.

  5. Мембранные протеогликаны взаимодействуют с интегринами и другими рецепторами клеточной адгезии для облегчения прикрепления клеток к ВКМ, межклеточных взаимодействие и подвижность клеток.

  6. Мембранные HSPG действуют как корецепторы для различных тирозинкиназных рецепторов фактора роста, снижая порог их активации. или изменение продолжительности сигнальных реакций.

  7. Мембранные HSPG действуют как эндоцитарные рецепторы для клиренса связанных лигандов, что особенно важно для метаболизма липопротеинов. в печени и, возможно, в формировании градиентов морфогена во время развития.

Фигура 1.

HSPG обладают множественной активностью в клетках и тканях.(Адаптировано из Bishop et al. 2007; перепечатано с разрешения Nature Publishing Group © 2007.)

Эта статья разделена на 10 подразделов. Первые три написаны для исследователей вне поля, которым может понадобиться некоторую справочную информацию о разнообразии HSPG и взаимодействиях, происходящих с белковыми лигандами. Последующий разделы описывают семь систем, которые иллюстрируют общие принципы или идеи, которые претерпели значительные изменения за последнее время. последнее десятилетие.Из-за нехватки места не все предметы могут быть рассмотрены или рассмотрены с должной глубиной и, следовательно, читатель отсылается к превосходным недавним обзорным статьям (Ткаченко и др., 2005; Бюлов и Хоберт, 2006; Бишоп и др., 2007; Ламанна и др., 2007; Бикс и Иоццо, 2008; Filmus и др., 2008; Ори и др., 2008; Роджерс и др., 2008 г.; Сандерсон и Янг, 2008 г.; Иоззо и др., 2009 г.; Коучман, 2010 г.).

ВИД НА КОНСТРУКЦИЮ И СБОРКУ С ПТИЦЫ

Идеализированное изображение HSPG показано на рисунке 2. Каждый протеогликан состоит из белка и одной или нескольких ковалентно связанных цепей HS. Появились исчерпывающие обзоры о процессе сборки и структурных характеристиках цепей, поэтому эти темы обсуждаться не будут. далее здесь (Эско и Селлек, 2002; Сугахара и Китагава, 2002; Сасисекхаран и др., 2006; Ори и др., 2008; Ларемор и др., 2009). Однако в контексте их биологической активности важно учитывать несколько особенностей.(1) HSPG являются полианионными и имеют необычный гидродинамический объем из-за наличия длинных цепей HS (40–300 остатков сахара, ~ 20–150 нм), сульфат группы и уроновые кислоты. Таким образом, различные HSPG часто очищаются с помощью методов, основанных просто на анионных характеристиках. цепной или гель-фильтрации. HS и другие сульфатированные ГАГ являются одними из самых сильно отрицательно заряженных биополимеров в мире. Природа и вариации числа и длины цепей обусловливают огромную полидисперсность. (2) Некоторые протеогликаны содержат только одну цепь ГАГ (например, CD44v3 и бетагликан), тогда как другие имеют от трех до пяти цепей (например, синдекан). Более того, стехиометрия замещения цепи ГАГ может варьироваться в зависимости от источника и условий роста. Протеогликаны «неполного рабочего дня» может существовать с цепью ГАГ или без нее (таблица 1). (3) Некоторые протеогликаны содержат другие типы гликанов (например, связанные с аспарагином [ N -связанные] и связанные с серином/треонином [ O -связанные] цепи муцинового типа).Некоторые протеогликаны, такие как синдекан-1, содержат как HS, так и хондроитин/дерматансульфат. типа ГАГ. Могут происходить и другие типы посттрансляционных модификаций (например, фосфорилирование цитоплазматических доменов транс -мембранных протеогликанов). (4) Количество и состояние сульфатации цепей могут варьироваться в зависимости от условий роста и реакция на факторы роста. (5) Расположение отрицательно заряженных сульфатных групп и ориентация карбоксильных групп. указать расположение сайтов связывания лигандов.Кроме того, сульфатированные остатки сгруппированы в областях вдоль цепи. содержащие смеси идуроновой кислоты и глюкуроновой кислоты (NS-домены, рис. 2), и разделены несульфатированными доменами, богатыми глюкуроновой кислотой (NA-домены). (6) Характер сульфатации, степень уроновой Обычно считается, что кислотная эпимеризация и организация модифицированных остатков зависят от типа клеток, в которых HS экспрессируется, а не природой основного белка (Kato et al.1994). Таким образом, общий состав HS на разных коровых белках, экспрессируемых одной и той же клеткой, оказывается сходным, но большим. различия возникают между типами клеток. Эта концепция может быть чрезмерным упрощением, так как некоторые варианты были предложены для происходят по лиганд-связывающим свойствам и составу, зависящему от основного белка (Shworak et al. 1993; Tveit et al. 2005).

Фигура 2.

Структура гепарансульфата (HS). Биосинтез HS инициируется присоединением ксилозы к определенным остаткам серина в HSPG. коровые белки с последующим образованием связи тетрасахаридов глюкуроновая кислота-галактоза-галактоза-ксилоза (GlcA-Gal-Gal-Xyl). Extl3 присоединяет первый остаток N -ацетил-d-глюкозамина (GlcNAc), а ферментный комплекс, состоящий из Ext1 и Ext2, поочередно добавляет GlcA и GlcNAc к зарождающемуся остатку. цепь.Цепи одновременно подвергаются серии реакций обработки, которая начинается с удаления ацетильных групп. из кластеров остатков GlcNAc и замены свободных аминогрупп сульфатом, катализируемых одной или несколькими N -деацетилазами- N -сульфотрансферазами (Ndst). Эпимераза C5 (HsGlce) эпимеризует d-глюкуроновые кислоты, непосредственно примыкающие к N -сульфоглюкозаминовым единицам, в l-идуроновую кислоту (IdoA). Ряд O -сульфотрансфераз может затем присоединять сульфат: уронил 2- O -сульфотрансфераза (Hs2st) присоединяет сульфат к С2 идуроновых кислот (реже к глюкуроновым кислотам), 6- O -сульфотрансферазы (Hs6st1 -3) добавить сульфат по С6 звеньев N-сульфоглюкозамина и реже к N -ацетилглюкозамина, а 3- O -сульфотрансфераз (Hs3st1, 2, 3a, 3b, 4, 5, 6) добавить сульфат по С3 единиц глюкозамина (N-сульфатированных или N-незамещенных).Так как показаны в верхней части рисунка красной штриховкой, модификации происходят в кластерах переменной длины (N-сульфатированные или NS-домены), которые перемежаются немодифицированными доменами (N-ацетилированные или NA-домены). Области на стыке этих доменов иногда называемые доменами NA/NS (не показаны), потому что степень обработки меньше. Модифицированные домены составляют привязку сайты для белковых лигандов, как показано для антитромбина, FGF и рецептора FGF. Цепи HS могут быть дополнительно модифицированы после того, как они попадают на клеточную поверхность или в ВКМ двумя эндосульфатазами (Sulf1 и Sulf2), которые удаляют специфические сульфатные группы, расположенные на С6 единиц глюкозамина или под действием внеклеточной гепараназы или внеклеточных протеаз (не показано). (Рисунок адаптирован из Бишопа и др. 2007 г.; перепечатано с разрешения Nature Publishing Group © 2007.)

ОБОБЩЕНИЯ О ВЗАИМОДЕЙСТВИИ БЕЛКОВЫХ ЛИГАНДОВ С HS ПРОТЕОГЛИКАНАМИ

HSPG связываются со многими лигандами, обычно через цепи HS.На самом деле гепарин, сильно сульфатированная форма HS, часто используется в качестве «аффинная» матрица для очистки белков, и многие факторы роста, используемые сегодня, были очищены с помощью аффинной хроматографии с гепарином. Гепарин-связывающие лиганды включают факторы роста, цитокины, хемокины, ферменты, ингибиторы ферментов и внеклеточный матрикс. белки. В других областях гликобиологии белки, связывающие гликаны, называются «лектинами». наличие домена распознавания углеводов, определяемого характерными складками белка или мотивами последовательности, указывающими на их членство в эволюционно консервативном семействе генов (Varki et al.2009). Напротив, белки, которые связываются с HS, по-видимому, развились в результате конвергентной эволюции; то есть они не обладают специфическим кратность или узнаваемый паттерн аминокислотной последовательности (Esko and Linhardt 2009). Сайты связывания гепарина часто располагаются на внешней поверхности белков или в неглубоких бороздах, выстланных положительно заряженными аминокислоты. Были предприняты попытки определить «консенсусные» последовательности в гепарин-связывающих белках на основе содержания и интервалов между ними. положительно заряженных аминокислотных остатков в линейных последовательностях (Cardin and Weintraub 1989; Hileman et al.1998 год; Капила и Линхардт, 2002). Однако сайт связывания HS часто определяется положительными остатками, внесенными несмежными сегментами белка. Хотя электростатические взаимодействия вносят большой вклад в энергию связи, водородные связи, взаимодействия Ван-дер-Ваальса и также участвуют гидрофобные эффекты (Conrad 1998; Capila and Linhardt 2002).

Связывание лиганда с ГВ осуществляется по тем же принципам, которые лежат в основе взаимодействия других макромолекул, но со следующими соображения важны.

  • Константы диссоциации для HS-зависимых лигандов варьируются от миллимолярных до наномолярных значений. Многие факторы роста связываются с высоким аффинность (например, факторы роста фибробластов, FGF), в то время как многие белки матрикса связываются с низкой аффинностью (например, фибронектин). Однако сродство не диктует селективность; некоторые низкоаффинные лиганды достигают высокой авидности за счет димеризации (например,грамм., хемокины) или путем кластеризации (например, фибриллы фибронектина).

  • Цепи HS могут способствовать диффузии лигандов, позволяя им связываться и скользить или диссоциировать/воссоединяться через соседние сайты связывания (массовое действие).

  • Связывание

    может привести к изменению конформации белка.Наиболее изученным примером является аллостерический эффект гепарина на антитромбин.

  • HS может выступать в качестве матрицы для аппроксимации двух белков рядом друг с другом. Антитромбиновая инактивация тромбина служит парадигмы для этого типа взаимодействия, но другие примеры включают ассоциацию некоторых факторов роста с их рецептором. тирозинкиназы (т.g., FGF с рецепторами FGF).

Помимо цепей HS, белковое ядро ​​HSPG также может связывать лиганды. Например, ортолог глипикана Drosophila , Dally, может напрямую взаимодействовать с рядом морфогенов, таких как декапентаплегический (Dpp) и костный морфогенетический. фактор 4, при отсутствии цепей HS (Kirkpatrick et al. 2006). Экспрессия Dally с дефицитом HS может восстановить несколько мутантных фенотипов у мух с дефицитом Dally, что указывает на то, что ряд биологически значимых функций опосредованы ядром белка глипикана независимо от HS.У млекопитающих глипикан-3 белок core взаимодействует с hedgehog (Hh) независимо от HS, и эмбрионы Gpc3 -null демонстрируют повышенную передачу сигналов Hh, что может объяснить фенотип избыточного роста, наблюдаемый у пациентов с отсутствием глипикана-3. (синдром Симпсона-Голаби-Бемеля) (Capurro et al. 2008). Как обсуждается ниже, пептидная последовательность в коровом белке синдекана-1 взаимодействует с интегринами αVβ3 и αVβ5 и модулирует клеточная адгезия (Beauvais et al.2004 г.; Маккуэйд и др. 2006). Наконец, перлекан, коллаген XVIII и агрин представляют собой крупные белки, состоящие из множества функционально независимых доменов. которые могут связываться с другими компонентами матрикса и факторами роста (Iozzo et al. 2009).

О СПЕЦИФИКЕ СВЯЗКИ

Хотя некоторые лиганды связываются непосредственно с коровыми белками HSPG, подавляющее большинство взаимодействует с сульфатированными доменами внутри HS цепи.Ранние исследования гепарина и его взаимодействия с антитромбином во многом повлияли на наши размышления о специфике белок-HS, но недавние исследования значительно расширили наши взгляды. Гепарин обладает высокой антикоагулянтной активностью. общее сульфатирование выше среднего (гепарин содержит примерно 2,3 сульфатных группы на дисахарид, в то время как типичный HS содержит примерно 0,8 сульфатных групп на дисахарид). Однако антикоагулянтные свойства гепарина не зависят от общего заряда, но вместо этого зависят от уникального пентасахарида с определенным расположением сульфатных групп и уроновых кислых эпимеров и требует наличия сульфатной группы, расположенной в положении С3 центрального остатка глюкозамина, как показано на рисунке 2 (Lindahl et al.1980 г.; Атха и др. 1985). Это открытие позволяет предположить, что взаимодействие HS с другими белковыми лигандами может проявлять подобную селективность.

Интересно, что 3- O -сульфатированные остатки глюкозамина довольно редко встречаются в HS, встречаясь примерно на 1/20 дисахаридов в гепарине и менее чем на 1/100 дисахаридов. в ГС или вообще нет. Тем не менее, 3- O -сульфотрансферазы составляют самое большое семейство HS-сульфотрансфераз, состоящее из семи членов (рис.2). Два фермента могут продуцировать антитромбинсвязывающую последовательность, в то время как другие генерируют 3- O -сульфатированные последовательности, отличающиеся по структуре от антитромбинсвязывающего сайта. сайтов связывания других лигандов. Один класс этих сайтов взаимодействует с гликопротеином gD вируса простого герпеса-1 и по-видимому, необходим для инфекции (Shukla et al. 1999). Эндогенные лиганды включают циклофилин В (Vanpouille et al.2007), FGF7 (Ye et al. 2001) и, возможно, эктодомен FGFR1 (McKeehan et al. 1999), но, судя по большому размеру семейства 3- O -sulfotransferase, другие лиганды несомненно существуют.

Для большинства лигандов не требуется 3- O -сульфатирования, но изучение взаимодействия гепарин-антитромбин концептуально подготовило почву для поиска конкретных механизмов сульфатированных сахаров для селективного связывания. Первоначально эта технически сложная задача была решена с помощью фракционирования. HS в пулы, которые связывались с лигандом или не связывались с ним, с последующим композиционным анализом или частичным секвенированием. К сожалению, были отмечены небольшие различия в составе, скорее всего, потому, что сайты связывания для большинства белков представляют только от 5 до 12 сахаров. Чтобы обойти эту проблему, были использованы частично расщепленные препараты, что в конечном итоге привело к идентификации минимально олигосахариды определенного размера, которые связываются с разумной аффинностью и которые в некоторых случаях могут инициировать биологический ответ.Примеры включают, но не ограничиваются ими, FGF2 (Guimond et al., 1993; Maccarana et al., 1993), тромбоцитарный фактор роста (Feyzi et al., 1997), тромбоцитарный фактор 4 (Maccarana and Lindahl, 1993; Stringer and Gallagher, 1997). , MIP1α (Stringer et al. 2002, 2003), фактор роста гепатоцитов (фактор рассеяния) (Lyon et al. 1994; Ashikari et al. 1995), фактор роста эндотелия сосудов (Soker et al. 1994; Ono et al. 1999; Ashikari-Hada et al., 2005; Robinson et al., 2006), липопротеинлипаза (Parthasarathy et al.1994 год; Спиллманн и др. 2006), амилоид (Lindahl и Lindahl, 1997) и L-селектин (Norgard-Sumnicht and Varki, 1995; Wang et al., 2002). Когда FGF1 был подробно изучен, было отмечено, что ряд октасахаридов HS, которые различались по количеству, а также по положения отдельных сульфатных групп могут связываться с различной аффинностью (Kreuger et al. 2001). Кроме того, образованию комплексов между FGF1 и рецепторами FGF способствовало множество сахаридов с разной активностью. общее содержание сульфатов.Это очевидное отсутствие специфичности имеет следствие in vivo; у Drosophila делеция 2- O — или 6- O -sulfotransferases не влияет на передачу сигналов FGF и развитие трахеи, которое зависит от FGF (Kamimura et al. 2006). Инактивация любого фермента приводит к повышенному сульфатированию в других положениях, что указывает на форму молекулярной компенсации. Недостаток обоих ферментов ухудшает передачу сигналов FGF и вызывает множественные дефекты формирования паттерна, указывая на то, что HS необходим, но что комплекс рецептор-лиганд может вмещать различные сульфатированные олигосахариды.По-видимому, другой лиганд-рецептор пары могут вести себя сходным образом, поскольку многие органы и ткани мышей, несущие мутации этих сульфотрансфераз (или эпимераза, которая взаимопревращает глюкуроновую кислоту в идуроновую кислоту), развиваются нормально (таблица 3).

Тем не менее, специфичность существует. Например, у мышей, у которых отсутствует 2- O -сульфотрансфераза, наблюдается агенезия почек (Bullock et al.1998), но другие ткани развиваются нормально. В слезной железе снижение общего сульфатирования HS влияет на передачу сигналов Fgf10-Fgfr2b. необходим для морфогенеза ветвления (Pan et al. 2008). Аналогичное снижение общей сульфатации изменяет васкулогенез (Jakobsson et al. 2006), опухолевый ангиогенез (Fuster et al. 2007) и гиперпроницаемость сосудов (Xu et al. 2010a). На передачу сигналов Wnt специфически влияет удаление 6- O -сульфатных групп на HS парой эндолитических-6- O -сульфатаз клеточной поверхности (Sulfs), которые действуют в очень ограниченных участках цепи (Ai et al. .2003 г.; Ламанна и др. 2008). Хотя ряд биологических процессов, регулируемых сульфидами in vivo, еще предстоит выяснить, факторы роста, включая На FGF, Wnt и GDNF явно влияет их потеря, приводящая к дефектам развития и ранней постнатальной летальности (Ai et al. 2007; Holst et al. 2007). Таким образом, определение того, опосредуют ли специфические последовательности связывание и биологическое действие, остается активной областью исследований.

Хемокины представляют собой подмножество цитокинов, которые взаимодействуют с HS (Lortat-Jacob 2009).Эти небольшие (8–10 кДа) секретируемые белки передают сигнал через связанные с G-белком рецепторы на поверхности клеток, чтобы контролировать миграцию клеток. в развитии, самонаведение лимфоцитов, воспаление и заживление ран. Связывание хемокинов с HSPG обеспечивает их локальное удержание, защита от деградации (Sadir et al. 2004), активация путем олигомеризации (Proudfoot et al. 2003) и презентация лейкоцитам (Handel et al. 2005). Интересно, что хемокины обычно представляют собой димеры с положительно заряженными доменами, ориентированными в различных конфигурациях. (Рисунок.3). Хотя в настоящее время нет доступных сокристаллических структур, молекулярный докинг предполагает, что цепь HS может располагаться вдоль интерфейс димера или может охватывать гепарин-связывающие домены, ориентированные на противоположных сторонах димера. В последнем случае расстояние между двумя сайтами связывания в димере превышает длину типичного сульфатированного домена в HS (около четырех-восьми сахаров). Таким образом, предпочтительная организация биоактивного сегмента цепи может состоять из двух коротких сульфатированных доменов (NS-домены, Инжир.2), разделенные несульфатированным линкером определенной длины (домен NA) (Lortat-Jacob et al. 2002). Примеры других лигандов, сайты связывания которых требуют расширенных или прерывистых доменов, включают IFN-γ (Lortat-Jacob et al., 1995) и тромбоцитарный фактор 4 (Stringer and Gallagher, 1997), а также могут включать другие парные системы, такие как FGF/FGFR. Mulloy and Linhardt 2001) или VEGF/VEGFR/Nrp1 (Grunewald et al. 2010). Создание такого расположения, по-видимому, потребует пространственного контроля над процессом сборки, но как это достигается in vivo неизвестно (Lindahl and Li 2009).

Рисунок 3.

Стыковка ГС с хемокинами. Молекулярное моделирование было использовано для стыковки полностью сульфатированной гепариноподобной цепи с несколькими хемокинами. Белки представлены лентами, за исключением боковых цепей основных аминокислот, непосредственно входящих в состав полисахарида. переплет (зеленый). Молекула гепарина представлена ​​палочками.(Данные Лортата-Джейкоба и др., 2002 г.)

ПРОТЕОГЛИКАНЫ КАК КОРЕЦЕПТОРЫ

В 1991 г. Yayon et al. (1991) и Rapraeger et al. (1991) сообщили, что HSPG клеточной поверхности облегчают образование и передачу сигналов комплексов FGF2-рецептор FGF (рис. 4A).Как описано выше, экзогенный гепарин или ГС также могут усиливать образование комплексов ФРФ с рецепторами ФРФ. В этом контексте HSPG или гепарин считаются «корецепторами», поскольку их функция заключается в содействии образованию лиганд-рецепторных связей. комплексы либо за счет конформационного изменения лиганда и / или рецептора, либо за счет действия матрицы для аппроксимации лиганда и рецептор. В клетках активация обычно происходит в -цис- с помощью HSPG, экспрессируемых на той же клетке, что и сигнальный рецептор (рис.4А). Например, избирательное изменение сульфатации HS в эндотелиальных клетках с использованием системы Cre-lox снижает патологический ангиогенез. in vivo (Фустер и др., 2007). Точно так же изменение HS в эпителиальных клетках молочных желез оказывает поразительное влияние на лобулоальвеолярное развитие, несмотря на экспрессию HS в окружающих стромальных клетках (Crawford et al. 2010). Исследования развития хрусталика (Pan et al. 2006), морфогенеза ветвления в слезной железе (Pan et al. 2008; Qu et al.2011), наведение аксонов и развитие центральной нервной системы (Inatani et al. 2003; Yamaguchi et al. 2010) также предполагают, что HSPG действуют как корецепторы клеточно-автономным образом.

Рисунок 4.

Модель транс -активации рецептора VEGF протеогликанами гепарансульфата. ( A ) Резидентные HSPG плазматической мембраны могут опосредовать взаимодействие VEGF с его рецептором в цис , индуцируя передачу клеточных сигналов и последующую интернализацию комплекса.( B ) HSPG из соседней клетки также могут опосредовать взаимодействия VEGF с ее рецептором в транс , задерживая интернализацию сигнального комплекса и усиливая ответ VEGF. (Из Jakobsson et al. 2006; перепечатано с разрешения Elsevier © 2006.)

Тем не менее, наблюдение, что экзогенный гепарин, HS или HSPG могут активировать передачу сигналов FGF, повысило вероятность того, что HSPG на одном типе клеток может активировать передачу сигналов в транс на соседних клетках. Кремер и Йост предоставили первые доказательства in vivo транс--активации в своих исследованиях лево-правого развития у Xenopus . В этой системе эктодермальный синдекан-2 передает неклеточно-автономно информацию слева направо мигрирующей мезодерме. через сигнальный путь фактора роста (Kramer and Yost 2002). Совсем недавно Якобссон и соавт. проанализировали передачу сигналов VEGF в эмбриоидных телах, полученных из мутантных популяций стволовых клеток, которые были либо дефицитны в биосинтезе HS, либо в экспрессии рецептора VEGF (Jakobsson et al.2006). Хотя обе линии мутантных стволовых клеток не могли поддерживать передачу сигналов VEGF, создание химер восстанавливало передачу сигналов VEGF. и ответ. Модель того, как HSPG могут активировать рецепторы VEGF в транс , показана на рисунке 4B. Как обсуждается ниже, стволовые клетки зародышевой линии поддерживаются в нише стволовых клеток с помощью передачи сигналов ближнего действия trans , опосредованной glypicans, экспрессируемой в клетках ниши, действующей на стволовые клетки (Hayashi et al. 2009). Trans -активация рецепторов с помощью HSPG потенциально может вызывать более сильные ответные сигналы путем захвата рецептора в клетке поверхность в активированном состоянии.В целом, способность HSPG транс -активировать соседние клетки представляет собой новый тип клеточных перекрестных помех и может играть важную роль в регуляции клеточного обмена. дифференцировка и реакция в процессе развития.

Секретируемые HSPG также могут действовать не клеточно-автономно (например, напрямую вызывая сигнальные ответы в близлежащих клетках). Таким образом, HSPG agrin индуцирует постсинаптическую дифференцировку в нервно-мышечном соединении (Bezakova and Ruegg 2003).Для выполнения этой функции агрин секретируется моторными нейронами, где он активирует мышечно-специфический рецептор. тирозинкиназа (MuSK) на соседних мышечных клетках. Сигнальные каскады, индуцированные передачей сигналов MuSK, приводят к реорганизации цитоскелета. и последующую агрегацию рецепторов ацетилхолина на мышечных клетках, подготавливая нервно-мышечные соединения к активации. Недавние исследования показали, что протеолитическая обработка агрина в неврологических синапсах нейротрипсином высвобождает активный карбоксиконцевой фрагмент, который впоследствии индуцирует образование дендритных филоподий на нейронах гиппокампа (Matsumoto-Miyai et al.2009). Другие протеогликаны также могут подвергаться протеолитическому процессингу с высвобождением биоактивных доменов, которые могут действовать эндокринным образом. включая коллаген XVIII (Marneros and Olsen 2001) и перлекан (Bix and Iozzo 2008).

Корецепторная функция некоторых протеогликанов, таких как транс-мембранные синдеканы , может динамически регулироваться путем модуляции их ассоциации с клеточной поверхностью посредством процесса известное как линька (Bernfield et al. 1999 г.; Манон-Дженсен и др. 2010). Отщепление синдекана опосредуется матриксными металлопротеиназами (MMP1, MMP7, MMP9, ADAM17) (Fitzgerald et al. 2000; Li et al. 2002; Endo et al. 2003; Ding et al. 2005; Brule et al. 2006; Pruessmeyer et al. , 2010). Механически индуцированный отщепление синдекана-1, по-видимому, включает его цитоплазматический хвост, который связывается с Rab5, небольшой ГТФазой. который регулирует внутриклеточный транспорт и сигнальные события (Hayashida et al. 2008). Rab5 может регулировать шеддинг, индуцируя диссоциацию синдекана-1 от интегрина β1 (см. загадочный сайт расщепления.Шеддинг оказывает большое влияние на локализацию и сигнальную способность HS-связанных лигандов (Kato et al. 1998; Park et al. 2000b). Например, выделение синдекана-1 модулирует хемокинзависимые воспалительные процессы в моделях повреждения тканей, вызванных неинфекционными агентами (Li et al. 2002; Xu et al. 2005b; Hayashida et al. 2009b). Синдекан-1, выделяемый имплантированными опухолевыми клетками, может оказывать биологическое действие дистальнее первичной опухоли, вызывая образование остеокластов и разрушение костей за счет связанных термолабильных факторов (Kelly et al.2010). Некоторые микроорганизмы могут усиливать протеолитическое выделение синдекана-1 клетками-хозяевами, что приводит к усилению бактериальной колонизации. (Парк и др., 2000a, 2001). Во всех этих моделях активность сброшенных эктодоменов синдекана зависит от цепей HS, что позволяет предположить, что их активность зависит на лигандах, связанных с цепями.

ПРОТЕОГЛИКАНЫ КАК ЭНДОЦИТИЧЕСКИЕ РЕЦЕПТОРЫ

Хотя часто упускают из виду, мембранные HSPG также действуют как эндоцитарные рецепторы и подвергаются конститутивным, а также лиганд-индуцированным эндоцитоз (Williams and Fuki, 1997; Белтинг, 2003). Хотя точный механизм эндоцитоза неясен, он, по-видимому, происходит независимо от клатрина, кавеолина и dynamin, но зависимым от липидов способом с участием везикул необычного состава (Zimmermann et al. 2005; Wittrup et al. 2010). Лиганды, связанные с цепями HS, «попадают обратно» в клетку по этому пути. Эндоцитарная активность HSPG играет важную роль. физиологическую роль в липидном обмене. Недавние генетические данные показали, что у мышей, лишенных синдекана-1, накапливаются как производные печени, так и и пищевые триглицериды в виде остатков липопротеиновых частиц (Stanford et al.2009). Изменение структуры ГС путем селективной инактивации сульфотрансфераз в гепатоцитах приводило к тому же фенотипу и показали, что цепи HS на синдекане-1 представляют собой сайт связывания липопротеинов (MacArthur et al. 2007; Stanford et al. 2010).

Другие мембранные HSPG, такие как синдекан-2 и синдекан-4 и глипиканы, также могут опосредовать поглощение лигандов в культивируемых клетках. (Фуки и др.2000). Кроме того, поглощение может быть индуцировано FGF2 или кластеризацией, индуцированной антителами (Fuki et al., 1997; Tkachenko et al., 2004; Zimmermann et al., 2005). Хотя наблюдалась рециркуляция интернализованных HSPG (Fransson et al. 1995; Zimmermann et al. 2005), большинство HSPG попадают в лизосомы, где они подвергаются деградации лизосомными протеазами, экзолитическими гликозидазами и сульфатазами. Связанные лиганды также разрушаются, что обеспечивает механизм доставки питательных веществ к клеткам или удаления биоактивных веществ. факторы из окружающей среды.Формирование тканевых градиентов морфогенов (обсуждаемых ниже) может частично зависеть от непрерывного клиренс лигандов посредством эндоцитарного механизма (Lander et al., 2002; Marois et al., 2006; Ren et al., 2009).

Вирусы и другие патогены могут использовать HSPG для перехода из внеклеточной среды внутрь клеток. Мембранопроникающий пептид, HIV-tat, высвобождается из ВИЧ-инфицированных клеток и затем проникает в окружающие клетки с помощью HSPG (Green and Loewenstein 1988; Frankel and Pabo 1988).Частично на основе HIV-tat был создан ряд проникающих в клетку пептидов, обычно богатых аргинином или лизином. остатки, которые будут способствовать взаимодействию с HSPG (Poon and Gariepy 2007). Кроме того, были получены синтетические положительно заряженные переносчики, такие как гуанидинилированные аминогликозиды. Спряжение этих переносчиков лекарств, токсинов, ферментов, олигонуклеотидов, а также квантовых точек могут опосредовать доставку груза в клетки через HSPG (Elson-Schwab et al.2007 г.; Сарразин и др. 2010).

HSPG также могут обеспечивать трансцеллюлярный транспорт. Ван и др. показали HSPG-опосредованный транспорт хемокинов через эндотелиальные клетки и его зависимость от состояния сульфатации цепей HS (Wang et al. 2005). Как обсуждается ниже, HSPG клеточной поверхности также участвуют в клеточной адгезии, которая зависит от взаимодействия цепей HS. с белками ЕСМ, такими как фибронектин.Являются ли прикрепление клеток и эндоцитоз взаимоисключающими или, возможно, опосредованными через разные мембранные протеогликаны неясно.

ПРОТЕОГЛИКАНЫ КАК РЕЦЕПТОРЫ АДГЕЗИИ

HSPG играют несколько ролей в клеточной адгезии и в определении формы клеток. Эти процессы зависят от связывания клеток поверхностных HS к «гепаринсвязывающим» доменам, присутствующим в белках матрикса, таких как фибронектин, ламинины, витронектин, тромбоспондин, и некоторые фибриллярные коллагены (Bernfield et al.1999). Syndecan-4 обеспечивает интересный пример механической и функциональной связи между ECM и актиновым цитоскелетом. Синдекан-4 широко экспрессируется во время развития и в большинстве тканей взрослого организма и является центральным компонентом фокальных спаек. (О и Каучман, 2004). Фибробласты, лишенные синдекана-4, имеют измененный актиновый цитоскелет, и для кластеризации синдекана-4 требуется несколько цепей HS. на плазматической мембране (Gopal et al. 2010).В соответствии с этой идеей, избыточная экспрессия синдекана-4 в клетках СНО приводит к повышенному образованию фокальной адгезии, организации стрессовых волокон цитоскелета и снижение подвижности клеток (Longley et al., 1999). Активность синдекана-4 зависит от мультимеризации, которая происходит посредством рекрутирования PIP 2 , активации PKC-α и нижестоящей передачи сигналов через путь RhoA (Oh et al. 1997a,b,c). Интересно, что мультимеризация синдекана-4 предотвращается фосфорилированием его цитоплазматического хвоста с помощью PKC-δ в ответ на к передаче сигналов FGF2 (Murakami et al. 2002). FGF2 является митогеном, и во время пролиферации клетки должны отсоединиться, чтобы пройти цитокинез. Таким образом, синдекан-4 имеет центральное роль в координации изменений цитоскелета, происходящих во время адгезии и клеточной пролиферации.

Как описано в других статьях (например, Schwartz 2010; Campbell and Humphries 2011; Geiger and Yamada 2011; Watt and Fujiwara 2011), интегрины опосредуют различные взаимодействия между клетками и компонентами ВКМ.Интегрины могут распознавать короткие пептидные последовательности (например, RGD), присутствующий во многих белках ECM, и связывание приводит к активации, внутриклеточной передаче сигналов через киназы и другие ферменты, и образование очаговых спаек (Cox et al. 2006). Когда фибробласты прикрепляются и распространяются в ответ на фрагменты фибронектина, содержащие сайт RGD, происходит образование фокальных очагов. спайки и стрессовые волокна часто могут иметь место только в том случае, если присутствует гепарин-связывающий домен фибронектина (Saoncella et al.1999 г.; Вудс и др. 2000 г.; Морган и др. 2007). Цепи HS синдекана-4 связываются с фибронектином, который вместе с интегрином индуцирует образование фокальных спаек и стрессовые волокна (рис. 5).

Рисунок 5.

Роль синдекана-4 в фокальной адгезии. ( A ) Фибробласты прикрепляются и распространяются через интегрин α5β1 на покровных стеклах, покрытых интегрин-связывающим доменом фибронектина но они не образуют очаговых спаек.( B ) Очаговые спайки (стрелки) образуются только после вовлечения цепей синдекана-4 HS после добавления гепарин-связывающего домена (HepII) из фибронектина. (Данные для изображения из Okina et al. 2009.)

Синдекан-1 (и синдекан-4) также может регулировать активацию интегринов αvβ3 и αvβ5 посредством взаимодействия внеклеточных домен протеогликана с субъединицей β-интегрина (Beauvais et al.2004, 2009; Маккуэйд и др. 2006). Взаимодействие с этими рецепторами происходит вне клетки через определенный пептидный сегмент синдекана-1, но активация механизм является цитоплазматическим и происходит через talin-зависимый сигнальный путь изнутри наружу, который требует кластеризации синдекана-1. Цепи HS синдекана-1 необходимы, по-видимому, для облегчения кластеризации синдекана-1 вдоль агрегированных компонентов ECM.

HSPG также могут способствовать межклеточной адгезии.Во время воспалительной реакции эндотелиальный HS взаимодействует с L-селектином на прохождение лейкоцитов для помощи в начальной фиксации лейкоцитов на люменальной поверхности эндотелия (Wang et al. 2005; Celie et al. 2009). Это взаимодействие может зависеть от присутствия необычной N-незамещенной глюкозаминовой единицы в HS (Norgard-Sumnicht and Varki 1995), возможно, в сочетании с полностью сульфатированными доменами (Smits et al. 2010). Интересно, что гепариноиды, вводимые мышам внутривенно, резко снижают инфильтрацию лейкоцитов в ответ на воспаление (Wang et al.2002) путем нарушения взаимодействия эндогенного HS-селектина (Wang et al. 2005) или сиалил-Льюиса a/x -селектина (Koenig et al. 1998; Stevenson et al. 2007). Пройдя слой эндотелиальных клеток, лейкоциты сталкиваются с базальной мембраной сосудов. Миграция лейкоцитов через считается, что этот барьер связан с локальной деградацией матриксными металлопротеиназами и секретируемой гепараназой, что может необходим для растворения HSPG в базальной мембране (Vreys and David 2007; Li and Vlodavsky 2009).

ПРОТЕОГЛИКАНЫ РЕГУЛИРУЮТ СВЯЗЫВАНИЕ ФАКТОРА РОСТА С ВКМ И МИГРАЦИЮ КЛЕТОК

ECM обеспечивает структурную сеть для обеспечения и регуляции клеточного движения (например, во время развития и заживления ран). Одним из способов, которым ВКМ регулирует миграцию клеток, является прямое связывание факторов роста, таких как фактор роста тромбоцитов. (PDGF), обеспечивая направленные и стимулирующие сигналы для движущихся клеток (Smith et al.2009). Интересно, что ассоциация PDGF с ECM, по-видимому, зависит от HS, но не включает прямое связывание с HS. (Саймс и др., 2010). Сходным образом сообщалось о зависимых от HS взаимодействиях между фибронектином и VEGF (Mitsi et al. 2006). Механизм, с помощью которого HS регулирует связывание факторов роста с фибронектином, по-видимому, связан с его способностью индуцировать переход фибронектина из глобулярной формы в более стабильную вытянутую форму, выявляющую сайты связывания факторов роста (Mitsi et al.2008). Эта активность зависит от размера и состава цепей, как показали исследования, в которых длиннее только гепариновые цепи. чем 22 сахарида и с сульфатированием в 6-O- и N-положениях глюкозаминовых звеньев сохраняли способность модифицировать фибронектин структуру и позволяют связываться с VEGF (Mitsi et al. 2006).

Также было показано, что тканеспецифичная экспрессия различных протеогликанов во время эмбриогенеза рыбок данио играет роль в определение структуры и функции внеклеточного матрикса.Экспрессия синдекана-2 во внеэмбриональном синцитиальном желтке слой индуцирует сборку матрикса фибронектина и ламинина по всему эмбриону и направляет миграцию первичных клеток (Arrington and Yost 2009). Интересно, что сверхэкспрессия синдекана-2 в эмбрионе не устраняет эмбриональные дефекты, возникающие в результате желточно-синцитиального дефицит слоя, предполагая, что протеогликаны в определенных типах клеток могут действовать уникальным образом из-за либо позиционного или конструктивные различия.Другие исследования также показали, что потеря специфических протеогликанов, таких как syndecan-4, у Xenopus laevis может оказывать неблагоприятное воздействие на миграцию клеток нервного гребня (Matthews et al. 2008) и конвергентные движения растяжения (Munoz et al. 2006). Эти модельные системы обеспечивают мощный эмпирический подход для определения участия HSPG в отложении матрицы. и миграции клеток.

ПРОТЕОГЛИКАНЫ И БАРЬЕРНАЯ АКТИВНОСТЬ

HSPG долгое время считались фильтрующим барьером для заряженных макромолекул в почках, но недавние исследования поставили под сомнение на этой идее.Базальная мембрана почечной фильтрационной структуры, клубочка, содержит HSPG, такие как агрин, перлекан, и коллагена XVIII, и на HS приходится большая часть отрицательного заряда базальной мембраны клубочков (GBM) (Miner 1999; Raats et al. 2000). Ранние исследования, в которых HS удаляли путем перфузии почек крыс гепариназой, показали, что HS необходим для фильтрации. крупных заряженных белков, таких как ферритин и альбумин (Kanwar et al., 1980).Корреляции сниженного уровня ГС в ГБМ, повышенной экспрессии гепараназы и протеинурии также были установлены у пациентов. с различными заболеваниями почек, такими как диабетическая нефропатия, что также указывает на предполагаемую барьерную функцию для глиобластомы HS (Makino et al., 1992; Tamsma et al., 1994; van den Hoven et al., 2006; Wijnhoven et al., 2006). Однако возникла путаница, когда последующие исследования in vivo не смогли подтвердить, что удаление GBM HS с помощью гепариназы может привести к острой протеинурии, и фактически переваривание ферментов фактически предотвращало протеинурию, вызванную удалением сиаловых кислот. кислоты (Wijnhoven et al.2007а,б). Кроме того, тканеспецифическая делеция основных HSPG GBM у мышей не вызывает протеинурию (Rossi et al., 2003; Harvey et al., 2007; Goldberg et al., 2009), а также не приводит к полной абляции биосинтеза HS в подоцитах мыши до 8 месяцев. возраста, когда аномалии проксимальных канальцев стали преобладать (Chen et al. 2008). В совокупности представляется, что фактическая функция HS в клубочках связана с его контролем над подоцитами. поведение, а не как ультрафильтрационный барьер.

Хотя HSPG, по-видимому, не играют существенной роли в селективности проницаемости в почках, HSPG клеточной поверхности синдекана Было показано, что семейство играет важную роль в поддержании барьерной целостности кишечного эпителия (Bode et al. 2006, 2008). Было показано, что потеря синдекана-1 или его цепей ГАГ из кишечного эпителия коррелирует с оттоком плазмы. белки в просвет кишечника, вызывая потенциально летальное состояние, известное как энтеропатия с потерей белка (PLE) (Murch et al.1993, 1996; Вестфаль и др. 2000). Связь между потерей синдекана-1 и PLE, по-видимому, связана со способностью синдекана-1 подавлять воспалительные цитокины, такие как IFN-γ и TNF-α, которые совместно разрушают межэпителиальную целостность. Таким образом, считается что потеря синдекана-1 или его цепей HS в кишечнике подвергает эпителий воздействию цитокинов, что приводит к нарушению межклеточных взаимодействий и PLE (Bode et al.2008). Синдекан-1 может играть непосредственную роль в герметизации промежутков между эпителиальными клетками кишечника, действуя как физический барьер. для предотвращения утечки белка (Bode et al. 2008). Важно отметить, что введение неантикоагулянтного гепарина мышам с дефицитом синдекана-1, а также одному пациенту с PLE доказала свою эффективность в коррекции утечки белка (Bode et al. 2008; Liem et al. 2008), предполагая, что пациентов, страдающих заболеваниями барьерной дисфункции, связанными с дефицитом HSPG, можно лечить аналогичным образом.

ГРАДИЕНТЫ МОРФОГЕНА И ХЕМОКИНА

Морфогены представляют собой сигнальные молекулы, которые экспрессируются в ограниченных участках ткани и могут образовывать градиенты, определяющие клеточная дифференцировка и формирование паттерна в процессе развития. Исследования диффузии морфогенов в крыловом диске Drosophila показали, что некоторым морфогенам, таким как wingless (Wg), hedgehog (Hh) и Dpp, для эффективной диффузии требуется HS. и не будет пересекать клеточные области с дефицитом HS (Jackson et al.1997 год; и др. 1999 г.; Цуда и др. 1999 г.; Баэг и др. 2001 г.; Борнеманн и др. 2004). Сходные исследования крылового диска Drosophila показали, что глипиканы необходимы для диффузии морфогенов (Belenkaya et al. 2004; Han et al. 2005; Yan and Lin 2009). Эти результаты предполагают модель мобильности морфогенов, известную как ограниченная диффузия, когда морфогены переносятся из одного HSPG к другому на поверхности клетки, перемещаясь от областей с высокой концентрацией к областям с низкой концентрацией вдоль путь, определяемый взаимодействующим лигандом (Yan and Lin 2009).Хотя эта модель может описывать механизм, с помощью которого HSPGs регулируют градиенты морфогенов ближнего действия, другие способы считается, что существует передача морфогена. Например, в исследованиях диффузии морфогена в крыловом диске дрозофилы Итон и его коллеги описали экзоклеточные везикулы (аргосомы) и частицы липопротеинов (липофорин), которые может способствовать передаче морфогенов на большие расстояния (Greco et al. 2001; Eugster et al.2007). Интересно, что упаковка морфогенов, таких как Wg, в аргосомы зависит от HS и ассоциированных с мембраной глипиканов. могут рекрутировать липофорин, содержащий модифицированные липидами формы Hh и Wg, в ткань диска. Ландер подробно обсудил сложность факторов, которые могут влиять на форму градиентов морфогена и др. способы участия HSPG в этом процессе (Lander et al. 2002; Lander 2007).

Glypicans могут играть важную роль в формировании градиента морфогена из-за их способа прикрепления к клеточной поверхности.В отличие от других протеогликанов, глипиканы связаны с клеточной мембраной через якорь GPI, что позволяет диффузии происходить в внешний листок плазматической мембраны и принадлежность к специфическим мембранным структурам, таким как липидные рафты (Taylor et al. 2009; Gutierrez and Brandan 2010). Способность глипиканов локализоваться в липидных рафтах может позволить им более непосредственно связываться с рядом морфогенов, такие как Hh и Wg, которые сами по себе липидированы (Rietveld et al.1999 г.; Чжай и др. 2004). Также интересно отметить, что GPI-якорь глипиканов может быть отщеплен от клеточной поверхности гидролазой Notum. (Kirkpatrick et al. 2004; Kreuger et al. 2004), процесс, который может воздействовать на способность этих протеогликанов регулировать градиенты морфогена. В поддержку этой идеи, сверхэкспрессия секретируемой формы глипикана, в которой отсутствует якорь GPI, резко расширяет диапазон активности Hh в крыловой диск Drosophila (Takeo et al.2005). Причина этого расширения неясна, но может быть вызвана стабилизирующим действием этого секретируемого протеогликана на Hh. по мере того, как он рассеивается от своего источника. В качестве альтернативы, секретируемый глипикан может мешать событиям посттрансляционного процессинга Hh, например, модификация холестерина. HSPG могут модулировать подвижность морфогенов, способствуя их ассоциации с ферментами-модификаторами. такие как ADAM (дезинтегрин и металлопротеиназы) и трансглютаминазы (Dierker et al.2009а,б). Представляет ли способность HSPG опосредовать ограниченную диффузию и модификацию морфогена различные механизмы для контроля градиентов в настоящее время неясно.

Следует также иметь в виду, что многие другие факторы распространяются через ECM на пути к их конечным пунктам назначения и, следовательно, будут сталкиваться с HSPG на поверхности клеток, в интерстициальном матриксе или в базальной мембране.Например, липопротеин липаза экспрессируется адипоцитами, скелетными и сердечными миоцитами, но ее место действия находится на люменальной стороне капиллярный эндотелий в резидентных кровеносных сосудах. Недавнее исследование показало, что делеция коллагена XVIII приводит к хиломикронемии. вызвано снижением представленности липазы в сосудистой сети (Bishop et al. 2010). Поскольку дефицит коллагена XVIII вызывает утолщение базальных мембран (Utriainen et al.2004), снижение активности липазы может быть вызвано замедленной диффузией через базальную мембрану, капилляров в тканях, участвующих в липолизе. Липиды плазмы в норме у мутантов перлекана, у которых отсутствуют сайты прикрепления HS. (Tran-Lundmark et al. 2008; Bishop et al. 2010), указывая на то, что специфичность может существовать во взаимодействии липазы с HSPG в матрице.

НИША ДЛЯ СТВОЛОВЫХ КЛЕТОК

Генерация, поддержание и восстановление различных тканей во время развития регулируется популяциями стволовых клеток, которые находятся в определенных клеточных микроокружениях, известных как ниши стволовых клеток.Эти ниши необходимы для определения способности стволовых клеток для сохранения самовоспроизводящегося плюрипотентного состояния или для дифференцировки в коммитированные тканеспецифические предшественники (Нуркомб и Кул, 2007). Интересно, что многие сигнальные молекулы, участвующие в поддержании стволовых клеток, такие как Wnts и FGFs, регулируются с помощью HSPG (Sato et al. 2004; Xu et al. 2005a,c). Более того, эмбриональные стволовые клетки изменяют структуру своих ГС по мере того, как они дифференцируются в определенные клоны (Johnson et al.2007 г.; Болдуин и др. 2008).

Чтобы непосредственно определить роль HSPG в дифференцировке стволовых клеток, эмбриональные стволовые клетки мыши с мутациями в биосинтезе HS были изучены. Эмбриональные стволовые клетки, у которых отсутствует HS из-за дефицита гена Ext1 , неспособны к дифференцировке при удалении фактора ингибирования лейкемии, по-видимому, вызванного дефектом. ответ на FGF (Kraushaar et al.2010). Эти находки подтверждаются исследованиями эмбриональных стволовых клеток, лишенных Ndst1/2 , которые также не могут дифференцироваться в ответ на FGF из-за сниженного сульфатирования (Lanner et al. 2010). Кроме того, мышиные эмбриональные стволовые клетки, дефицитные по Ndst1/2 , оказались неспособными реагировать на VEGF, предотвращая их дифференцировку в капиллярные структуры крови (Jakobsson et al. 2006). В совокупности эти исследования подтверждают важность HS в дифференцировке стволовых клеток, по крайней мере, ex vivo.

Чтобы выяснить, как HSPG могут регулировать стволовые клетки в их естественной клеточной среде, Накато и его коллеги изучили, могут ли glypican участвовал в поддержании стволовых клеток в нише стволовых клеток зародышевой линии Drosophila . Интересно, что эта функция, по-видимому, связана со способностью глипиканов ограничивать локализация и активность морфогена Dpp к внешней границе ниши (Hayashi et al.2009). Было показано, что стволовые клетки, непосредственно примыкающие к этому богатому Dpp карману, активируются в транс этим морфогеном и остаются плюрипотентными. Остались дочерние клетки, не способные физически ассоциироваться с этим участком. устойчивы к передаче сигналов Dpp и впоследствии подверглись дифференцировке. Эти выводы, вероятно, будут иметь важные последствия для лечения заболеваний на основе стволовых клеток и для разработки синтетических матриц для тканевой инженерии на основе стволовых клеток.

ЗАКЛЮЧИТЕЛЬНЫЕ ЗАМЕЧАНИЯ

Цель этой статьи состояла в том, чтобы предоставить обзор HSPG и их биологической роли в ECM. Как описано выше, HSPG связывают многие лиганды, модулируют многочисленные клеточные активности и помогают в тканевой архитектуре и физиологии. Примеры выбранные для представления, представляют собой только подмножество действий, связанных с HSPG.Однако поразительно, что так много основная деятельность, по-видимому, регулируется таким небольшим семейством макромолекул. Понимание того, как клетки регулируют экспрессия и состав HSPG для скоординированного выполнения этих разнообразных действий является серьезной биологической проблемой. решать. Проблема может быть такой же сложной, как расшифровка генетического кода, учитывая огромную сложность гепарансульфата.

БЛАГОДАРНОСТИ

Авторы признательны за гранты GM33063 и HL57345 (J.DE) и F32DK085905 (до WCL) от Национального института здравоохранения. и грант от Fondation pour la Recherche Medicale (для С.С.).

Сноски

  • ↵1 Эти авторы внесли одинаковый вклад в эту работу.

  • Редакторы: Ричард Хайнс и Кеннет Ямада

  • Дополнительные перспективы биологии внеклеточного матрикса доступны на сайте www.cshperspectives.org

  • Copyright © 2011 Cold Spring Harbour Laboratory Press; все права защищены

Гепарансульфатные протеогликаны: код сахара для развития позвоночных? | Развитие

Развитие позвоночных — от оплодотворенной яйцеклетки до целого организма — сложный процесс, управляемый многими сигнальными путями. Генерация различных типов клеток и органов из одной клетки достигается посредством последовательных программ развития, которые требуют пространственной и временной координации сигнальных молекул развития, включая морфогены и факторы роста.Доказательства, накопленные за последние двадцать лет, показали, что большинство, если не все, эти факторы развития регулируются протеогликанами гепарансульфата (HSPG).

HSPG состоят из основного белка, с которым ковалентно связаны длинные линейные цепи гликозаминогликан-гепарансульфата (HS). Синдеканы (Sdc) и глипиканы (Gpc), которые относятся к основным классам сердцевинных белков, прикрепляются к клеточной поверхности трансмембранным доменом или гликозилфосфатидилинозитоловым якорем соответственно и могут высвобождаться во внеклеточное пространство после расщепления различными ферментами. (Рисунок.1). Другие HSPG, включая агрин, коллаген XVIII и перлекан, секретируются непосредственно во внеклеточный матрикс (ECM). Коровые белки имеют определенное количество сайтов добавления цепи HS, а некоторые также содержат хондроитинсульфат (CS) в качестве другого типа гликозаминогликанов (таблица S1). Цепи HS синтезируются в аппарате Гольджи в ходе многоступенчатого процесса, в котором участвуют несколько ферментов (рис. 2; таблица S2). Ферменты экзостозин (Ext) удлиняют цепи HS путем добавления чередующихся остатков глюкуроновой кислоты и N -ацетилглюкозамина, тогда как ферменты N-деацетилазы/N-сульфотрансферазы (Ndst), C5-эпимераза и 2-O-, 3-O- и 6- О-сульфотрансферазы модифицируют их, катализируя деацетилирование, эпимеризацию и сульфатирование в различных положениях (номенклатуру см. в Lawrence et al., 2008). Эти модификации не происходят равномерно вдоль цепей HS, а вместо этого концентрируются в разных субрегионах, создавая домены с вариабельно модифицированными дисахаридами, которые могут взаимодействовать с другими белками по-разному.

Учитывая их различные цепи HS и локализацию (т. е. на поверхности клетки или в ECM), было предложено, чтобы HSPG регулировали сигнальные пути многими различными способами (рис. 3). Они могут действовать клеточно-автономно как рецепторы или корецепторы [например, во время передачи сигналов Wnt или фактора роста фибробластов (FGF)], как «вербовщики» липидных рафтов (тем самым увеличивая концентрацию лиганда или рецептора на клеточной поверхности), регулируя перенос мембраны рецептора (во время эндоцитоза) или путем контроля секреции лиганда.Они также могут действовать не клеточно-автономно как прямые сигналы или контролируя распределение сигнальных градиентов, а также состав внеклеточного матрикса. В дополнение к сложности их сигнальных функций, HSPG могут взаимодействовать с белками посредством различных механизмов (обзоры см. Lindahl and Li, 2009; Xu and Esko, 2014). Связывание с белками обычно опосредуется цепями HS, но было показано, что некоторые факторы, такие как Hedgehog (Hh), непосредственно взаимодействуют с коровыми белками (Capurro et al., 2008).В то время как некоторые взаимодействия требуют определенных структурных мотивов вдоль цепей HS (Thunberg et al., 1982; de Paz et al., 2007), другие неселективны в отношении мотивов, но требуют определенного типа сульфатирования (например, 2- O-сульфатирование необходимо для связывания Fgf2; Ashikari-Hada et al., 2004) или определенной плотности отрицательного заряда. Интересно, что было продемонстрировано, что разные органы или ткани продуцируют уникальные композиции ГС и что экспрессия эпитопа ГС изменяется во время эмбрионального развития тканеспецифическим образом (Allen and Rapraeger, 2003; Ledin et al., 2004). Это наблюдение, наряду с большой изменчивостью цепей ГС, которые могут генерироваться ферментами, модифицирующими ГС, привело к гипотезе о сложном «сахарном коде» (Holt and Dickson, 2005), в котором специфические модификации ГС присутствуют в регион-специфический способ у эмбриона будет управлять программами развития, взаимодействуя с определенными сигнальными путями и модулируя их. Этот сахарный код, таким образом, будет зависеть от пространственной и временной регуляции HS-модифицирующих ферментов и, возможно, от разных членов одного и того же семейства HS-модифицирующих ферментов, обладающих немного отличающейся активностью или специфичностью действия.Например, некоторые члены семейства 3-O-сульфотрансфераз могут иметь большую или меньшую склонность к модификации рядом с другими метками сульфатирования, изменяя как конфигурацию меток сульфатации, так и плотность заряда в определенных областях цепи HS. Код сахара также должен быть динамическим, поскольку цепи HS могут разрушаться или модифицироваться на клеточной поверхности ферментами гепараназой и сульфатазой соответственно.

Хотя исследования Caenorhabditis elegans убедительно подтвердили гипотезу сахарного кода (Bülow et al., 2008; Текле и др., 2013; Díaz-Balzac et al., 2014), доказательства специфической роли модификаций HS и коровых белков у позвоночных только начинают появляться. Тем не менее, накопленные данные ясно указывают на то, что HSPGs играют отчетливую инструктивную роль во время развития позвоночных. Например, исследования показали, что многие органы, включая кроветворную и костно-мышечную системы, а также печень, легкие и почки, не формируются должным образом, когда HSPG отсутствуют или модифицированы (таблицы S1, S2; обзоры см. в Thompson et al., 2010; Хьюгель и др., 2013; Нигам и Буш, 2014 г.). В этих исследованиях использовались различные модельные организмы, включая мышей, рыбок данио и Xenopus , хотя следует отметить, что между результатами возникли некоторые расхождения, возможно, из-за технических проблем оценки функций HSPG in vivo (см. вставку 1). В этом обзоре мы обсуждаем специфические функции HSPG во время развития позвоночных, уделяя особое внимание ранним стадиям развития и формированию сердечно-сосудистой и нервной систем.Затем мы оцениваем концепцию гипотезы сахарного кода, обсуждаем доказательства за и против нее и выделяем будущие задачи в этой области.

Заражение и передача SARS-CoV-2 зависят от гепарансульфатов и блокируются низкомолекулярными гепаринами коронавирусная болезнь 2019 г. (COVID-19), гриппоподобное заболевание, варьирующееся от легких респираторных симптомов до тяжелого поражения легких, полиорганной недостаточности и смерти (1–3).SARS-CoV-2 быстро распространился и вызвал пандемию с серьезными последствиями для глобального здравоохранения и мировой экономики (4, 5). SARS-CoV-2 передается преимущественно через крупные капли, выделяемые из верхних дыхательных путей при чихании и кашле (6, 7), и впоследствии проникает через слизистые оболочки носа, рта и глаз (8). SARS-CoV-2 инфицирует эпителиальные клетки дыхательных путей, такие как эпителиальные клетки бронхов, секретирующие реснитчатую слизь, и пневмоциты типа 1 в легких, а также эпителиальные клетки желудочно-кишечного тракта (9, 10).На сегодняшний день не существует лечения для предотвращения заражения SARS-CoV-2. Стратегии изоляции и социальное дистанцирование уменьшают распространение вируса, но из-за негативных социально-экономических последствий они не являются осуществимыми долгосрочными решениями (11, 12). Недавние возобновленные вспышки подчеркивают острую необходимость в защитных стратегиях, специально нацеленных на SARS-CoV-2, чтобы предотвратить дальнейшее распространение.

SARS-CoV-2 принадлежит к семейству бета-коронавирусов, которое также включает SARS-CoV и MERS-CoV (13). Белок коронавируса Spike (S) представляет собой слитый белок класса I, который обеспечивает проникновение вируса (14, 15).Белок S состоит из двух субъединиц; S1 напрямую взаимодействует через свой рецептор-связывающий домен (RBD) с рецепторами на поверхности хозяина (16, 17), а S2 опосредует слияние между вирусом и клеточной мембраной (18, 19). SARS-CoV-2 использует ангиотензинпревращающий фермент 2 (ACE2) в качестве основного рецептора (13, 20). ACE2 представляет собой интегральный мембранный белок типа I, обильно экспрессируемый в эпителиальных клетках, выстилающих дыхательные пути (21), а также в подвздошной кишке, пищеводе и печени (22), а экспрессия ACE2 определяет тропизм SARS-CoV-2 (10).Однако остается неясным, нужны ли SARS-CoV2 другие рецепторы для проникновения вируса. Были идентифицированы нейтрализующие моноклональные антитела против SARS-CoV-2, которые направлены не только на RBD, но и за его пределы (23), что подтверждает наличие других рецепторов. Здесь мы показываем, что гепарансульфатные протеогликаны (HSPG) Syndecan 1 и 4 необходимы для инфекции пермиссивных клеток SARS-CoV-2, и что низкомолекулярные гепарины (LMWH) эффективно ингибируют инфекцию поляризованных эпителиальных клеток, а также альвеолярных макрофагов.Более того, мы показываем, что первичные подмножества DC используют HSPG в качестве рецепторов прикрепления для облегчения распространения SARS-CoV-2. Эти результаты важны для разработки профилактических средств против SARS-CoV-2 или предотвращения распространения на ранних стадиях после заражения.

Результаты

Гепарансульфатные протеогликаны имеют решающее значение для связывания и инфицирования SARS-CoV-2

Гепарансульфатные протеогликаны экспрессируются большинством клеток, включая эпителиальные клетки, в виде гепарансульфатных протеогликанов, и было показано, что они взаимодействуют с такими вирусами, как ВИЧ-1, ВГС, вирус Синдбис, а также SARS-CoV (24–28).Мы инкубировали клетки Huh 7.5, которые экспрессируют ACE2 (дополнительная рис. 1A), с псевдовирусом SARS-CoV-2 (23) и наблюдали сильное связывание псевдовируса SARS-CoV-2 с клетками (рис. 1A). Связывание SARS-CoV-2 ингибировалось блокирующим антителом против ACE2 (рис. 1А). Более того, связывание псевдовируса SARS-CoV-2 ингибировалось нейтрализующими антителами пациентов с COVID-19, направленными против RBD (COVA1-18, COVA2-15) и не-RBD (COVA1-21) эпитопов вируса SARS-CoV-2 S. белок (23). Примечательно, что нефракционированный (НФ) гепарин сильно ингибировал связывание псевдовируса SARS-CoV-2 с клетками, сравнимое с антителом против ACE2 (рис.1Б). Ферментативное удаление гепарансульфатов с поверхности клеток путем обработки гепариназой снижало связывание вируса SARS-CoV-2 (рис. 1C и дополнительная рис. 1B). Кроме того, мы наблюдали, что псевдовирус SARS-CoV-2 инфицировал клетки Huh 7.5, которые были заблокированы UF-гепарином (рис. 1D). Эти данные убедительно свидетельствуют о том, что SARS-CoV-2 требует гепарансульфатов для заражения ACE2-положительных клеток.

Рисунок 1. Гепарансульфаты имеют решающее значение для связывания и заражения SARS-CoV-2. Клетки

( A-B ) Huh 7.5 предварительно инкубировали с нейтрализующим антителом к ​​ACE2, а псевдовирус SARS-CoV-2 предварительно инкубировали с mAb COVA1-18, COVA1-21 и COVA2-15 или UF-гепарином (250 МЕ).Клетки инфицировали псевдовирусом SARS-CoV-2 и связывание определяли с помощью ELISA. ( C ) Гепарансульфаты удаляли из клеток Huh 7.5 обработкой гепариназой и определяли связывание псевдовируса SARS-CoV-2. Столбики погрешностей представляют собой среднее ± SEM из трех независимых экспериментов. ( D ) Клетки Huh 7.5 инфицировали псевдовирусом SARS-CoV-2, и инфекцию измеряли через 5 дней культивирования с помощью анализа люциферазы. Вирус предварительно обрабатывали гепарином (2501U). Данные показывают, что средние значения и планки погрешностей являются SEM.Статистический анализ проводили с использованием ( A ) обычного однофакторного ANOVA с тестом множественного сравнения Тьюки. ***p= 0,0006, ***p= 0,0005, **p= 0,0018, **p= 0,0036 (n = 3), ( B ) **p= 0,0010, *p= 0,0255 (n=4) ), ( C ) двусторонний непарный t-критерий Стьюдента с поправкой Уэлча **p = 0,0012 (n = 3), ( D ) обычный однофакторный ANOVA с критерием множественного сравнения Тьюки. **р=0,0085 (n=6 измерено в трех экземплярах). RLU: относительные световые единицы.

Низкомолекулярные гепарины ингибируют инфекцию SARS-CoV-2

Низкомолекулярные гепарины (НМГ) заменили НФ гепарин в клинике в качестве антикоагулянта из-за их меньшего размера и превосходных фармакологических свойств (29) Важно отметить, что терапия НМГ недавно было показано, что он снижает смертность у тяжелобольных пациентов с COVID-19 (30), и в настоящее время используется в качестве антикоагулянтной профилактики для пациентов с COVID-19.Несколько НМГ используются в клинической практике и различаются по размеру и способу приготовления (31). Поэтому мы провели скрининг различных НМГ на предмет их способности блокировать связывание и заражение SARS-CoV-2. Все протестированные НМГ блокировали связывание SARS-CoV-2 с клетками Huh 7.5, и ингибирование было сходным с ингибированием UF-гепарина (рис. 2А). Более того, разные НМГ ингибировали заражение клеток Huh 7.5 псевдовирусом SARS-CoV-2 дозозависимым образом (рис. 2В). Таким образом, мы идентифицировали НМГ как ингибиторы связывания и заражения SARS-CoV-2.

Рисунок 2. НМГ блокирует связывание и заражение SARS-CoV-2.

SARS-CoV-2 предварительно обрабатывали UF-гепарином и разными НМГ в разных концентрациях (50-100-250 МЕ) и определяли связывание ( A ) с клетками Huh 7.5 или ( B ) инфицирование измеряли через 5 дней с помощью ELISA или анализ люциферазы соответственно. Данные показывают, что средние значения и планки погрешностей являются SEM. Статистический анализ проводили с использованием ( A ) обычного однофакторного дисперсионного анализа с тестом множественного сравнения Тьюки.(n = 3), ( B ) обычный однофакторный дисперсионный анализ с критерием множественного сравнения Даннета. **p= 0,0018, ***p= 0,0003, ***p= 0,0004, ****p< 0,0001, **p= 0,0036, **p= 0,0012, **p= 0,0029 (n = 3 донора) измеряется в трех экземплярах). RLU: относительные световые единицы.

Инфекция эпителиальных клеток SARS-CoV-2 блокируется УФ-гепарином и НМГ (20, 32) и дополнительный рис.1С). Эктопическая экспрессия ACE2 на клетках 293T сделала эти клетки восприимчивыми к псевдовирусной инфекции SARS-CoV-2, но инфекция была нейтрализована как НМГ-эноксапарином, так и НФ-гепарином до уровня, аналогичного антителам против ACE2 (рис. 3А). Комбинация антител ACE2 и НМГ эноксапарина или UF гепарина полностью блокировала инфицирование клеток 293T-ACE2 (рис. 3А). Эти данные убедительно свидетельствуют о том, что гепарансульфаты играют решающую роль в инфекции SARS-CoV-2.

Рис. 3. Связывание SARS-CoV-2 и инфицирование эпителиальных клеток блокируется УФ-гепарином и НМГ

( A ) Клетки 293T, экспрессирующие ACE2, были инфицированы SARS-CoV-2 в присутствии или в отсутствие антител против ACE2.УФ гепарин (250 МЕ) или эноксапарин (250 МЕ). ( B ) Связывание SARS-CoV-2 с вирусом определяли в присутствии антител против ACE2, UF-гепарина (250 МЕ) или эноксапарина (250 МЕ). ( C-D ) Инфекцию SARS-CoV-2 измеряли в недифференцированных или поляризованных клетках Caco2 в присутствии антител против ACE2 и UF-гепарина (250 МЕ) или эноксапарина (2501 МЕ). Данные показывают, что средние значения и планки погрешностей являются SEM. Статистический анализ проводили с использованием ( A ) обычного однофакторного ANOVA с критерием множественного сравнения Уннетта.*p= 0,0380, *p= 0,0136, *p= 0,0189, **p= 0,0080, **p= 0,0074 (n = 3, измерено в трех повторностях), ( B ) обычный однофакторный дисперсионный анализ с множественным сравнением Оуннетта тестовое задание. *p=0,0466, **p=0,0069, *p=0,0181, **p=0,0046, (n = 3 донора), ( C ) непарный критерий Манна-Уитни. * p = 0,0331, * p = 0,0258 (n = 3, измерено в трех экземплярах). ( D ) обычный однофакторный дисперсионный анализ с критерием множественного сравнения Тьюки. **р= 0,0013, **р= 0,0018. **p = 0,0021 (n = 3 донора, измерено в трех экземплярах). RLU: относительные световые единицы

Считается, что эпителиальные клетки, экспрессирующие ACE2, являются первичными клетками-мишенями для инфекции SARS-CoV-2 в легких и кишечном тракте (21, 33).Клетки неполяризованной карциномы толстой кишки человека Caco-2 эффективно связывали псевдовирус SARS-CoV-2 (рис. 3B). Лечение антителами против ACE2, УФ-гепарином и НМГ-эноксапарином блокировало связывание вируса с линией эпителиальных клеток. Неполяризованные эпителиальные клетки экспрессируют низкие уровни ACE2 ((34) и дополнительная рис. 1C), а клетки Caco2 были инфицированы псевдовирусом SARS-CoV-2, хотя и на низком уровне. НМГ эноксапарин блокировал инфекцию клеток Caco2 подобно антителам против ACE2 (рис. 3C). Сочетание антител ACE2 с гепарином UF или эноксапарином LMWH не приводило к дальнейшему увеличению блока в неполяризованном Caco2 (рис.3В и С). Затем мы культивировали клетки Caco-2 на микропористом фильтре и инфицировали клетки псевдовирусом SARS-CoV-2 после того, как они сформировали высокополяризованный эпителиальный монослой. Поляризованные клетки Caco-2 допускали инфекцию, которая значительно блокировалась обработкой НМГ до уровня, аналогичного уровню антител против ACE2 (рис. 3D). Комбинация антитела против ACE2 вместе с НМГ эноксапарином показала ту же картину, что и каждое отдельное лечение (рис. 3D). Эти данные свидетельствуют о том, что гепарансульфаты необходимы для заражения (не)поляризованных эпителиальных клеток SARS-CoV-2.

Гепарансульфаты необходимы для передачи первичными дендритными клетками

SARS-CoV-2 поражает клетки слизистой оболочки носа, легких и желудочно-кишечного тракта, но механизмы распространения вируса из дыхательных путей и кишечного тракта до сих пор неясны. Было высказано предположение, что макрофаги инфицируются SARS-CoV-2 (35), что может способствовать распространению. Примечательно, что альвеолярные макрофаги, выделенные с помощью бронхоальвеолярного лаважа, были инфицированы SARS-CoV-2 (рис. 4А). Важно отметить, что НМГ эноксапарин ингибировал инфицирование первичных альвеолярных макрофагов SARS-CoV-2 (рис.4A). Было показано, что различные подмножества дендритных клеток (ДК) участвуют в распространении различных вирусов, включая SARS-CoV (36–38). Мы дифференцировали моноциты в DC, которые являются моделью подслизистых DC, а также выделили первичные человеческие клетки Лангерганса (LCs) из кожи (39, 40), поскольку это подмножество DC находится в эпидермисе кожи и плоскоклеточной слизистой оболочке различных тканей (41). И DC, и LC эффективно связывали псевдовирус SARS-CoV-2, и связывание ингибировалось UF-гепарином, а также LMWH-эноксапарином (рис.4В и С). Ни DC, ни LC не экспрессировали ACE2 (дополнительная рис. 1A), а псевдовирус SARS-CoV-2 не инфицировал DC и LC (рис. 4D и E). Однако субпопуляции ДК способны передавать ВИЧ-1 в клетки-мишени независимо от продуктивной инфекции (40, 42). Поэтому мы обрабатывали DC и LC псевдовирусом SARS-CoV-2 и после промывки совместно культивировали клетки с чувствительными клетками Huh 7.5. Примечательно, что как DC, так и LC эффективно передавали захваченный SARS-CoV-2 в клетки Huh 7.5, и передача блокировалась UF-гепарином, а также предварительной обработкой НМГ эноксапарином (рис.4F и G). Таким образом, наши данные убедительно свидетельствуют о том, что подмножества DC участвуют в распространении вируса SARS-CoV-2 независимо от прямого заражения и зависимым от гепарансульфата образом.

Рисунок 4. Гепарансульфаты необходимы для передачи первичными дендритными клетками.

( A ) Альвеолярные макрофаги (БАЛ), инфицированные SARS-CoV-2, и инфекция была измерена через 5 дней. Изображен один репрезентативный донор из 3 ( BC ) SARS-CoV-2 связывается с ДК, происходящими из моноцитов ( B ) и первичные LC ( C ) в присутствии УФ гепарина (250 МЕ) или эноксапарина (250 МЕ).( D-E ) DC ( D ) и LC ( E ) были инфицированы SARS-CoV-2, и инфекция была измерена через 5 дней. В качестве положительного контроля инфицировали клетки Huh 7.5. ( FG ) DC ( F ) и LC ( G ) предварительно инкубировали с псевдовирусом SARS-CoV-2 в течение 4 ч в присутствии или в отсутствие ультрафиолетового гепарина (250 МЕ) или эноксапарина (250 МЕ), тщательно промывали и совместно культивировали с клетками Huh 7,5. Передачу DCs или LC клеткам Huh 7.5 определяли с помощью анализа люциферазы.Данные показывают, что средние значения и планки погрешностей являются SEM. Статистический анализ проводили с использованием ( A ) обычного однофакторного дисперсионного анализа с критерием множественного сравнения Тьюки. ***p = 0,0004 (n = 1), ( B-C ) обычный однофакторный дисперсионный анализ с критерием множественного сравнения Тьюки. ( B )****p<0,0001, ( C ) ***p= 0,0002, ****p<0,0001 (n = 4), ( DE ) обычный однофакторный дисперсионный анализ с Тьюки тест множественного сравнения. ****p<0,0001 ( D ) n = 4 измерено в трех повторах и ( E ) n = 3 донора измерено в двух повторах, ( F ) обычный однофакторный ANOVA с критерием множественного сравнения Даннета.**p = 0,0042, **p = 0,0016 (n = 4, измерено в трех повторностях), ( G ) обычный однофакторный ANOVA с тестом множественного сравнения Тьюки.) ****p<0,0001 (n = 3, измерено в три экземпляра). DCs: дендритные клетки LCs: клетки Лангерганса RLU: относительные световые единицы.

Протеогликаны гепарансульфата Syndecan 1 и 4 важны для связывания и инфицирования SARS-CoV-2

Семейство протеогликанов гепарансульфата Syndecans особенно важно для облегчения клеточной адгезии некоторых вирусов (28, 43).Поэтому мы исследовали связывание SARS-CoV-2 с клетками Namalwa, экспрессирующими синдекан 1 и 4 (дополнительная рис. 2A), поскольку эти синдеканы экспрессируются эпителиальными клетками (44, 45). Клетки Namalwa не экспрессировали ACE2 (дополнительная рис. 1A). Псевдовирус SARS-CoV-2, связанный с синдеканом 1 и 4, трансдуцировал клеточные линии с более высокой эффективностью, чем исходная клеточная линия (рис. 5А и (дополнительная рис. 2А). МФ-гепарин и НМГ эноксапарин блокировали взаимодействие синдекана 1 и 4). с псевдовирусом SARS-CoV-2 (рис.5А).

Рисунок 5. Протеогликаны гепарансульфата Синдекан 1 и 4 важны для связывания и инфицирования SARS-C0V-2 UF гепарина (250 МЕ) или эноксапарина (250 МЕ, связывание измеряли через 4 часа. ( B ) Синдекан 1 и 4 подавляли с помощью РНК-интерференции в клетках Huh7.5, а заражение псевдовирусом SARS-CoV-2 измеряли через 5 дней. , Репрезентативные данные для эксперимента, повторенного более трех раз с аналогичными результатами.Данные показывают, что средние значения и планки погрешностей являются SEM. Статистический анализ был выполнен с использованием ( A ) 2way-ANOVA с критерием множественного сравнения Даннетта. *p= 0,0408, *p= 0,0189, **p= 0,0032, **p= 0,0035 (n = 7), ( B ) 2way-ANOVA с тестом множественного сравнения Тьюки. ***р= 0,0002, *р= 0,0124. (n = 1, измерено в трех повторностях). siRNA: РНК-интерференция, RLU: относительные световые единицы.

Эпителиальные клетки (44, 45) и клетки Huh 7.5 экспрессируют синдекан 1 и 4, и мы заглушили синдекан 1 и 4 с помощью РНК-интерференции (дополнительная рис.2Б). Примечательно, что подавление синдекана 1 или синдекана 4 уменьшало инфицирование SARS-CoV-2 клеток Huh 7.5 (рис. 5B), подтверждая роль синдекана 1 и 4 в инфекции SARS-CoV-2. Эти данные показывают, что синдекан 1 и 4 являются основными гепарансульфатными протеогликанами, участвующими в связывании и заражении SARS-CoV-2.

Мощные нейтрализующие антитела против S-белка SARS-CoV-2 нацелены на взаимодействия гепарансульфата и SARS-CoV-2

Недавно у пациентов с COVID-19 было выделено несколько сильнодействующих нейтрализующих антител против SARS-CoV-2, которые нацелены на RBD (COVA1 -15, COVA1-18), а также не-RBD (COVA1-21) белка S (23).Чтобы выяснить, могут ли эти антитела предотвращать связывание SARS-CoV-2 с гепарансульфатами, мы исследовали их способность ингибировать связывание вируса с ACE2-негативными клетками Namalwa, экспрессирующими Syndecan 1. В частности, два RBD и не RBD-связывающие антитела блокировал взаимодействие псевдовируса SARS-CoV-2 с Syndecan 1 в той же степени, что и LMWH (рис. 6A). Напротив, изотипические антитела не ингибировали связывание вируса.

Рисунок 6. Нейтрализующие антитела против SARS-CoV-2 блокируют связывание гепарансульфата.

( A ) Псевдовирус SARS-CoV-2 обрабатывали нейтрализующими антителами против SARS-CoV-2 (COVA1-18, COVA1-21 и COVA2-15) и изотипическим контролем (VRC01 серого цвета) в концентрациях 0,05, 0,1, 0,5, 1 и 5 мкг/мл, тогда как клетки Namalwa, экспрессирующие Syndecan 1, предварительно инкубировали с антителом против ACE2 и его соответствующим изотипом (оба отмечены белым цветом). Связывание определяли с помощью ELISA ( B ). Способность нейтрализующих антител предотвращать связывание S-белка SARS-CoV-2 с гепарансульфатами измеряли в анализе связывания S-белка гепарин-SARS-CoV-2.Белок S предварительно инкубировали с различными нейтрализующими антителами (COVA 1-18, COVA 1-21 и COVA2-15) и изотипическим контролем (VRC01) и определяли связывание. Данные показывают, что средние значения и планки погрешностей являются SEM. Статистический анализ проводили с использованием ( A ) обычного однофакторного ANOVA с тестом множественного сравнения Тьюки. (n = 3), ( B ) 2way-ANOVA с тестом множественного сравнения Тьюки. **р= 0,0019, ***р= 0,0010, ***р= 0,0002. (n = 2, измерено в повторах).

Чтобы выяснить, блокируют ли эти антитела специфически взаимодействие SARS-CoV-2 с гепарансульфатами, мы покрыли МФ гепарином и измерили связывание S-белка SARS-CoV-2.S-белок SARS-CoV-2 эффективно связывается с гепарином с покрытием (рис. 6B). Все три антитела против белка S блокировали взаимодействие гепарина с SARS-CoV-2, что убедительно свидетельствует о том, что нейтрализующие антитела против SARS-CoV-2 препятствуют связыванию вирусом гепарансульфата. Таким образом, наши данные убедительно свидетельствуют о том, что нейтрализация антителами против SARS-CoV-2 может происходить за счет ингибирования ACE2, а также за счет предотвращения связывания SARS-CoV-2 с протеогликанами сульфата гепарана, и подчеркивает важность протеогликанов сульфата гепарана при инфекции.

Обсуждение

Здесь мы показали, что инфекция SARS-CoV-2 не только зависит от ACE2, но также требует наличия гепарансульфатных протеогликанов и, в частности, синдеканов 1 и 4. Наши данные свидетельствуют о том, что SARS-CoV-2 прикрепляется к клеткам через HSPG. , что облегчает тем самым взаимодействие с ACE2 и последующее заражение. Более того, мы также идентифицировали HSPG как важные рецепторы, облегчающие ACE2-независимую передачу первичными DCs. Инфицирование, а также передача SARS-CoV-2 эффективно ингибировались клинически адаптированным УФ-гепарином и НМГ.Это также предполагает, что нейтрализующие антитела, выделенные от пациентов с COVID-19, могут, по крайней мере, частично ингибировать связывание SARS-CoV-2 с протеогликанами гепарансульфата и тем самым препятствовать инфекции. Эти результаты имеют важное значение для нашего понимания проникновения SARS-CoV-2 в клетки-хозяева и указывают на подходящую мишень для нового профилактического вмешательства.

Недавно было высказано предположение, что S-белок SARS-CoV-2 взаимодействует с молекулами гепарансульфата и гепарина (46–48).Здесь мы идентифицировали гепарансульфаты и, в частности, синдекан 1 и 4 как важные рецепторы для SARS-CoV-2. Наши данные убедительно свидетельствуют о том, что протеогликаны сульфата гепарана необходимы для связывания вируса и инфицирования эпителиальных клеток. НМГ или НФ гепарин эффективно устраняли вирусную инфекцию в той же степени, что и антитела ACE2 и комбинации антител ACE2, предполагая, что оба рецептора необходимы для вирусной инфекции. Чтобы исследовать роль инфекции SARS-CoV-2 в первичных клетках, мы выделили альвеолярные макрофаги и эпидермальные LC, а также культивировали DC, происходящие из моноцитов.Интересно, что альвеолярные макрофаги были инфицированы SARS-CoV-2 зависимым от HSPG образом, тогда как ни LC, ни DC не были инфицированы. Роль альвеолярных макрофагов в инфекции SARS-CoV-2 до сих пор неясна, но было высказано предположение, что они могут инфильтрировать другие ткани или индуцировать провоспалительные цитокины и хемокины при инфицировании (49), что указывает на потенциальную пагубную роль в прогрессировании заболевания. Интересно, что инфекция первичных альвеолярных макрофагов, выделенных из легкого, также ингибировалась НМГ, что указывает на важную роль защиты НМГ в легочной ткани не как антикоагулянта, а как противовирусного средства.

ДК мигрируют из тканей слизистых оболочек и эпидермиса в лимфоидные ткани (50), поэтому считается, что ДК участвуют в распространении вирусов после инфицирования (51). Наши данные убедительно свидетельствуют о том, что DCs аналогичным образом участвуют в распространении SARS-CoV-2 через HSPG, поскольку первичные подмножества DC, выделенные из кожи или полученные из моноцитов крови, прочно связывают SARS-CoV-2 через HSPG и эффективно передают вирус эпителиальным клеткам-мишеням. Рецептор клеточной поверхности HSPG, в первую очередь экспрессируемый эпителиальными клетками, представляет собой Syndecan 1 (44, 52) и участвует в рекрутировании, пролиферации и воспалении клеток (45), но также может связывать вирусы, такие как вирус простого герпеса (HSV-1) (43) и вирусы гепатита. Вирус С (53).Синдекан 4 дополнительно экспрессируется повсеместно, хотя и на более низких уровнях (45). Недавно мы смогли показать, что Syndecan 4 участвует в передаче HCV LCs (28), тогда как Syndecan 3 способствует связыванию и передаче HIV-1 (54). В этом исследовании мы демонстрируем взаимодействие конкретных синдеканов с SARS-CoV-2 и подчеркиваем их важность для прикрепления и распространения вируса.

Нейтрализующие антитела против SARS-CoV-2 являются потенциальной терапией для пациентов с COVID-19, и было идентифицировано несколько сильнодействующих моноклональных нейтрализующих антител, которые нацелены на участки RBD и не-RBD белка S белка SARS-CoV-2 (23) .Однако, хотя предполагается, что большинство антител ингибируют сайты связывания ACE2, не-RBD-антитела COVA1-21, по-видимому, не мешают ACE2, а вместо этого мешают другим антителам COVA и еще не идентифицированным рецепторам. Примечательно, что два антитела RBD COVA1-18 и COVA2-15 блокировали связывание вируса, а также белка S с гепарансульфатами, что указывает на то, что RBD также участвует во взаимодействиях с гепарансульфатами (23). Более того, наши данные свидетельствуют о том, что COVA1-21 нацелен на сайт связывания гепарана белка S.Недавние исследования показывают, что сайт связывания гепарансульфата белка S находится за пределами RBD SARS-CoV-2 (47, 48). Тот факт, что нейтрализующие антитела против SARS-CoV-2 блокируют взаимодействие гепарансульфата, предполагает, что это важная мишень для нейтрализации вируса, и подчеркивает важность взаимодействия для инфекции SARS-CoV-2. Таким образом, это открытие показывает, что необычайно мощные антитела COVA1-18 и 2-15 могут нейтрализовать SARS-CoV-2 посредством двух механизмов: предотвращения связывания SARS-CoV-2 с ACE2 (23) и с протеогликанами гепарансульфата.

НМГ уже используются для подкожного лечения пациентов с COVID-19 для предотвращения системного свертывания крови (55, 56). Интересно, что здесь мы выявили важную способность НМГ напрямую блокировать связывание SARS-CoV-2 и заражение эпителиальных клеток, а также предотвращать передачу вируса. Наши данные подтверждают использование НМГ в качестве профилактического средства для лечения SARS-CoV-2, а также в качестве варианта лечения на ранних стадиях инфекции для предотвращения дальнейшего заражения и распространения. Ингаляции НМГ были изучены для ослабления воспалительных реакций у пациентов с ХОБЛ и астмой и считаются безопасными для использования в качестве профилактического средства.Клиническое использование НМГ для лечения COVID-19 и наш вывод о том, что НМГ блокируют вирусную инфекцию и распространение, настоятельно рекомендуют профилактическое использование НМГ у лиц с риском заражения, вскоре после заражения или даже у населения в целом во время вспышек, которые мы все еще наблюдаем. ежедневно, чтобы быстро ограничить события передачи.

Таким образом, это исследование дало новое представление о том, как SARS-CoV-2 инициирует прикрепление, заражение и передачу в различных типах клеток, и показало, что НМГ являются возможными кандидатами для профилактического вмешательства и противовирусного лечения.

Материалы и методы

Получение вируса

Для получения вирусов однократной инфекции клетки эмбриональной почки человека 293T/17 (ATCC, CRL-11268) котрансфицировали скорректированной основной плазмидой ВИЧ (pNL4-3.Luc .RS-), содержащий описанные ранее стабилизирующие мутации в капсидном белке (PMID: 12547912) и люциферазу светлячка в открытой рамке считывания nef (1,35 мкг), и pSARS-CoV-2, экспрессирующий S-белок SARS-CoV-2 (0,6 мкг ) (GenBank; MN

7.3) (23). Трансфекцию проводили в клетках 293Т/17 с использованием набора для трансфекции Genejuice (Novagen, США) в соответствии с протоколом производителя. На 3-й или 4-й день собирали частицы псевдотипированного вируса SARS-CoV-2 и фильтровали через нитроцеллюлозную мембрану 0,45 мкм (SartoriusStedim, Геттинген, Германия).

Продукция псевдовируса SARS-CoV-2 была количественно определена с помощью ИФА p24 (Perkin Elmer Life Sciences).

Реагенты и антитела

Использовали следующие антитела (все античеловеческие): ACE-2 (R&D), (гепарансульфат (клон F58-10E4) (Amsbio), расщепленный гепаран (клон F69-3G10) (Amsbio) , CD1a-APC мышиный IgG1 (BD Biosciences, Сан-Хосе, Калифорния, США), CD207-PE (лангерин) мышиный IgG1 (#IM3577) FITC-конъюгированный козий анти-мышиный IgM (#31992) (Invitrogen), AF488-конъюгированный ослиный анти-мышиный IgG2b (Invitrogen), проточный цитометрический анализ выполняли на BD FACS Canto II (BD Biosciences).Данные анализировали с использованием программного обеспечения FlowJo vX.0.7 (TreeStar).

Использовали следующие реагенты: Нефракционированный (UF) гепарин, 5000 МЕ/мл (LEO). Низкомолекулярные гепарины (НМГ): дальтепарин, 10 000 МЕ анти-Ха/мл (Pfizer), тинзапарин, 10 000 МЕ анти-Х1/0,5 мл (LEO), эноксапарин, 6000 МЕ (60 мг)/0,6 мл (Санофи), надропарин , 9,500 IE анти-ХА/мл (Aspen). Гепариназа III из Flavobacterium heparium , EC 4.2.2.8, партия 010 (Amsbio). Биотинилированный S-белок SARS-CoV-2, а также нейтрализующие антитела COVA1-18, COVA-1-21 и COVA-2-15 были получены, как описано ранее (23).

Линии клеток

Линия В-клеток человека Namalwa (ATCC, CRL-1432) и клетки Namalwa, стабильно экспрессирующие синдекан 1 и синдекан 4 человека (57), были подарены доктором Гвидо Давидом и доктором Филиппом Галлеем. Клетки поддерживали в среде RPMI 1640 (Gibco Life Technologies, Gaithersburg, MD), содержащей 10% фетальной телячьей сыворотки (FCS), пенициллин/стрептомицин (10 мкг/мл) и 1 мМ пируват натрия (Thermo Fisher). Экспрессию различных синдеканов подтверждали анализом ПЦР с использованием специфических праймеров, направленных против синдеканов.Клетки Huh7.5 (гепатоцеллюлярная карцинома человека), полученные от dr. Charles M. Rice (58) содержали в среде Игла, модифицированной Дульбекко (Gibco Life Technologies, Gaithersburg, MD), содержащей 10% фетальной телячьей сыворотки (FCS), L-глутамин и пенициллин/стрептомицин (10 мкг/мл). Среду дополняли 1 мМ буфером Hepes (Gibco Life Technologies, Gaithersburg, MD). Клетки эмбриональной почки человека 293T/17 (ATCC, CRL-11268) поддерживали в среде Игла, модифицированной Дульбекко (Gibco Life Technologies, Gaithersburg, Md.), содержащие 10% фетальной телячьей сыворотки (FCS), L-глутамин и пенициллин/стрептомицин (10 мкг/мл). Эпителиальные клетки Caco2 человека (ATCC, HTB-37™) поддерживали в среде Игла, модифицированной Дульбекко (Gibco Life Technologies, Gaithersburg, MD), содержащей 10% фетальной телячьей сыворотки (FCS), L-глутамин и пенициллин/стрептомицин (10 мкг). /мл) и дополнен раствором незаменимых аминокислот MEM (NEAA) (Gibco Life Technologies, Gaithersburg, MD). Для создания монослоя поляризованных клеток клетки Caco2 поддерживали в 6.Трансвеллы 5 мм со вставкой из поликарбонатной мембраны с порами 5 мкм (Corning). Клетки первоначально высевали с плотностью 25000 клеток на фильтрующую вставку 6,5 мм, а полная поляризация достигалась через 4 недели в культуре.

ELISA, связывающий S-белок SARS-CoV-2

UF Гепарин (разведенный в PBS) покрывали с помощью планшетов ELISA с высоким связыванием в течение 2 часов при 37°C. Неспецифическое связывание блокировали путем инкубации планшета с 1% BSA в TSM (20 мМ Трис-HCl, pH 7,4, содержащий 150 мМ NaCl, 2 мМ CaCl2 и 2 мМ MgCl2) в течение 30 мин при 37 °C.Биотинилированный шиповидный белок предварительно инкубировали с различными антителами (20 мкг/мл) в течение 30 мин при комнатной температуре. Биотинилированный S-белок SARS-CoV-2 добавляли на 2 часа при комнатной температуре. Несвязавшийся шиповидный белок отмывали и добавляли стрептавидин-HRP (1/10000) (Thermofisher). После промывки для проявления окраски добавляли субстрат ТМБ/перекись водорода. Эту реакцию останавливали добавлением 0,8 М h3SO4 и измеряли оптическую плотность при 450 нм. Отрицательный контроль включал антитело к ВИЧ-1, соответствующее изотипу, VRC01 (59).

293T Трансфекция ACE2

Для получения клеток, экспрессирующих ACE2 человека, клетки эмбриональной почки человека 293T/17 трансфицировали pcDNA3.1(-)hACE2 (плазмида Addgene #1786). Трансфекцию проводили в клетках 293Т/17 с использованием набора для трансфекции Genejuice (Novagen, США) в соответствии с протоколом производителя. Через 24 часа после трансфекции клетки промывали фосфатно-солевым буфером (PBS) и культивировали для восстановления при 37°C в течение 24 часов в MEM Дульбекко с добавлением 10% термоинактивированной фетальной телячьей сыворотки (FCS), L-глютамина и пенициллина/стрептомицина ( 10 ед/мл) Через 24 часа восстановления клетки культивировали в среде с добавлением G418 (5 мг/мл) (Thermo Fisher) и пассировали в течение 3 недель при 37°С.Выжившие клоны анализировали на экспрессию ACE2 с помощью проточной цитометрии и ПЦР.

Связывание вируса и чувствительный p24 ELISA

Для определения связывания SARS-CoV-2 клетки-мишени подвергались воздействию 95 нг псевдотипированного вируса SARS-CoV-2 в течение 4 часов при 4°C. Клетки промывали для удаления несвязавшегося вируса и лизировали лизирующим буфером. Связывание и интернализацию количественно определяли с помощью ELISA RETRO-TEK HIV-1 p24 в соответствии с инструкциями производителя (ZeptoMetrix Corporation).

Анализы на инфекции

HuH7.5, 293T(+hACE2) и недифференцированный Caco2 подвергались воздействию 95 нг псевдотипированного SARS-CoV-2, а поляризованные клетки Caco2 подвергались воздействию 477,62 нг псевдотипированного SARS-CoV-2. Перед добавлением клеток вирус предварительно инкубировали с 250 ЕД НМГ или МФ гепарина. Инфекцию измеряли через 5 дней при 37°С с помощью системы анализа люциферазы (Promega, США) в соответствии с инструкциями производителя.

Первичные клетки человека

CD14+ моноциты были выделены из крови здоровых доноров-добровольцев (банк крови Sanquin) и впоследствии дифференцированы в DC, полученные из моноцитов, как описано ранее (60).Эпидермальные листы готовили, как описано ранее (39, 40). Вкратце, кожные трансплантаты были получены с использованием дерматома (Zimmer Biomet, Индиана, США). После инкубации с Dispase II (1 ЕД/мл, Roche Diagnostics) листы эпидермиса отделяли от дермы, промывали и культивировали в среде IMDM (Thermo Fischer Scientific, США) с добавлением 10% FCS, гентамицина (20 мкг/мл, Centrafarm, Нидерланды). ), карандашина/стрептомицина (10 ЕД/мл и 10 мкг/мл соответственно; Invitrogen) в течение 3 дней, после чего собирали LC.Чистоту LC рутинно проверяли с помощью проточной цитометрии с использованием антител, направленных против CD207 (ланжерин) и CD1a.

Альвеолярные макрофаги были приготовлены из жидкости бронхоальвеолярного лаважа (БАЛ), которая была получена в качестве запасного материала в ходе продолжающегося исследования DIVA (Регистр испытаний Нидерландов: NL6318; номер утверждения Комитета по медицинской этике AMC: 2014_294). В исследовании DIVA приняли участие здоровые добровольцы мужского пола в возрасте от 18 до 35 лет. В этом исследовании испытуемым давали первую дозу липополисахарида (ЛПС), а через два часа вторую дозу концентрата свежих или состаренных тромбоцитов или NaCl 0 .9%. Через шесть часов после второго удара квалифицированный пульмонолог проводит БАЛ в соответствии с национальными рекомендациями. Фракции 2-8 объединяют и делят на две, одну половину центрифугируют (4°С, 1750 G, 10 мин), клеточный осадок которой использовали в данном исследовании. После пандемии COVID-19 субъекты также проходят скрининг на SARS-CoV-2 (путем ПЦР мазка из зева) за 2 дня до BAL. Все участники исследования DIVA подписали форму информированного согласия. Клетки промывали и высевали. Через два часа лунки промывали для удаления неприлипших клеток и инфицировали прикрепившиеся макрофаги.

Анализы передачи и совместное культивирование

Альвеолярные макрофаги, DC или LC подвергались воздействию 191,05 нг псевдотипированного SARS-CoV-2 или псевдотипированного SARS-CoV-2, предварительно инкубированного с 250 UF гепарина или LMWH в течение 4 часов, собранные, тщательно промывали для удаления несвязавшегося вируса и совместно культивировали с Huh7.5 в течение 5 дней при 37°C, после чего их анализировали с помощью системы анализа люциферазы (Promega, США) в соответствии с инструкциями производителя.

Выделение РНК и количественная ПЦР в реальном времени

мРНК выделяли с помощью набора для захвата мРНК (Roche), кДНК синтезировали с помощью набора для обратной транскриптазы (Promega), а ПЦР-амплификацию проводили в присутствии SYBR green в 7500 Система быстрой ПЦР в реальном времени (ABI).Конкретные праймеры были разработаны с помощью Primer Express 2.0 (Applied Biosystems). Для экспрессии мРНК использовались последовательности праймеров для продукта гена: GAPDH, прямой праймер (CCATGTTCGTCATGGGTGTG), обратный праймер (GGTGCTAA GCAGTTGGTGGTG). Для продукта гена: ACE2, прямой праймер (GGACCCAGGAAATGTTCAGA), обратный праймер (GGCTGCAGAAAGTGACATGA). Для продукта гена: Syndecan 1, прямой праймер (ATCACCTTGTCACAGGCAGACCC), обратный праймер (CTCCACTTCTGGCAGGACTACA). Синдекан 4, прямой праймер (AGGTGTCAATGTCCAGCACTGTG), обратный праймер (AGCAGTAGGATCAGGAAGACGGC).Нормализованное количество мРНК-мишени рассчитывали по значениям Ct, полученным как для мРНК-мишени, так и для мРНК домохозяйства, по уравнению Nt = 2Ct(GAPDH) — Ct(мишень). Для относительной экспрессии мРНК контрольный образец siRNA был установлен равным 1 для каждого донора.

РНК-интерференция

Клетки Huh7.5 подавляли электропорацией с помощью системы трансфекции Neon (Thermo Fischer Scientific) в соответствии с протоколом производителя. -0005, SMARTpool; Dharmacon), Syndecan 4 (10 мкМ миРНК, M-003706-01-0005, SMARTpool; Dharmacon), тогда как нецелевая siRNA (D-001206-13, SMARTpool; Dharmacon) служила контролем.Клетки использовали для экспериментов через 48 часов после замалчивания, и эффективность замалчивания конкретных мишеней подтверждали с помощью ПЦР в реальном времени и проточной цитометрии.

Ингибирование биосинтеза и ферментативная обработка

Клетки HuH7.5 обрабатывали в D-PBS/0,25% BSA с 46 миллиединицами гепариназы III (Amsbio) в течение 1 часа при 37°C, промывали и использовали в последующих экспериментах. Ферментативное расщепление подтверждали с помощью проточной цитометрии с использованием антител, направленных против гепарансульфатов и расщепленных гепарансульфатов.

Статистика

Был проведен двусторонний параметрический критерий Стьюдента t для парных наблюдений (различия внутри одного и того же донора) или непарного наблюдения (различия между разными донорами). Для непарных непараметрических наблюдений был проведен однофакторный или двухфакторный дисперсионный анализ. Статистический анализ был выполнен с использованием программного обеспечения GraphPad Prism 8, а значимость была установлена ​​​​на *P<0,05, **P<0,01***P<0,001****P<0,0001.

Разрешение на исследование

Это исследование было проведено в соответствии с рекомендациями Медицинского центра Амстердамского университета, руководящими принципами Комитета по медицинской этике AMC, и все доноры крови, кожи и БАЛ дали письменное информированное согласие в соответствии с Хельсинкской декларацией.

Низкий гспг у мужчин: Глобулин, связывающий половые гормоны (ГСПГ)

Добавить комментарий

Ваш адрес email не будет опубликован.