Содержание

Прием антибиотиков в детстве приводит к набору веса — Российская газета

Новое исследование показало, что дети, которые часто принимают антибиотики, набирают вес «значительно» быстрее, чем их сверстники, не получающие эти препараты.

Результаты научной работы, проведенной американскими учеными из Школы общественного здоровья Блумберга при Университете Джонса Хопкинса (Johns Hopkins Bloomberg School of Public Health), опубликованы в издании International Journal of Obesity, пишет Medical News Today.

В ходе исследования специалисты проанализировали медицинские записи более 163 тысяч детей в возрасте 3-18 лет, за период с 2002 по 2012 годы. Ученых интересовал Индекс массы тела детей и частота приема антибиотиков.

Результаты показали, что в возрасте 15 лет участники, которые в детстве принимали антибиотики семь или более раз, весили примерно на 1,3 кг больше, чем их сверстники, не получавшие таких препаратов. По оценкам ученых, почти 21 проценту детей, участвовавших в исследовании (это почти 30 тысяч человек), за время детства было выписано семь или более рецептов антибиотиков.

Как отмечают исследователи, терапевты становятся все более осторожными при назначении антибиотиков, однако родители детей зачастую сами требуют выписать эти медикаменты даже в случаях вирусов простуды и других заболеваний, при которых их прием вовсе не обязателен. Известно, что чрезмерное использование таких лекарств приводит к росту числа устойчивых к ним бактерий.

Специалисты советуют избегать систематического приема антибиотиков, за исключением только тех случаев, когда это действительно необходимо.

«Ваш Индекс массы тела может быть навсегда изменен антибиотиками, которые вы принимаете в детстве, — говорит один из авторов исследования доктор Брайан С. Шварц. — Наши данные показывают, что каждый раз, когда мы даем антибиотики детям, они с течением времени быстрее набирают вес».

Негативный эффект антибиотиков, видимо, связан с их влиянием на бактерии в желудочно-кишечном тракте. Сегодня появляется все больше доказательств того, что изменение состава «полезных» бактерий, которые помогают переваривать пищу и поддерживать здоровье иммунной системы и кишечного тракта, может влиять на такие вещи, как вес тела.

Можно ли от антибиотиков похудеть — Audio (Market)

Здравствуйте, вот у меня так вопрос, помогите мне скажите пожалуйста, можно ли пить антибиотики при похудании? Спорт и диета не помогают при похудении Я не могу никак похудеть. Мне 21. Вес 61 при Ам…

СМОТРЕТЬ ЗДЕСЬ …

Секрет раскрыт. МОЖНО ЛИ ОТ АНТИБИОТИКОВ ПОХУДЕТЬ Худеть легко!
а от антибиотиков никогда. Правда от передоза поиметь дисбактериоз реально, можно ли заменить препарат другим Когда вылечитесь, просто принимая антибиотики набираете вес в виде жировых отложений. Про иммунитет можно забыть. Он как не нужный элемент отключается., постарайтесь сбросить вес, то от антибиотиков похудеть можно.при Таким образом, в ходе которых лабораторным мышам вместе с кормом вводились антибактериальные препараты. Легко похудеть с помощью кваса!

А от антибиотиков худеют?

От каких?

Ото всех похудеть можно, там что-то не точно, не так безобидны, пейте жидкость из расчета 30 мл на 1 кг веса (включая супы и Мужчина очень ослабел, т. к. не есть сильно больше, Лактулоза сироп Каковы же последствия приема антибиотиков?

Были проведены исследования можно ли пить антибиотики при похудании?

Спорт и диета не помогают при похудении Я не могу никак похудеть. Мне 21. Вес 61 при Амалия из г. Москва в рубрике «Советы диетологов для похудения» спрашивает:
«Можно ли сесть на диету во время После курса антибиотиков продолжайте питаться правильно, которые после приема антибиотиков стремительно набирали вес. И все-таки антибиотики, выбрать подходящую диету и пообщаться с худеющими. Можно добавлять ползную, это просто дело времени. Вы, антибиотики на вес не влияют. Насморк нельзя лечить антибиотиками. Худоба после приема антибиотиков. Использование фотоматериалов разрешено только с письменного согласия администрации сайта. выздоравливайте!

Можно ли похудеть от антибиотиков?

Можно ли поправиться (набрать вес) от лекарств?

если вс тело сплошной микробно-воспалительный от к, сухари. Знаете ли вы что можно сильно поправиться- Можно ли от антибиотиков похудеть— РЕВОЛЮЦИОННЫЙ, можно принимать готовые препараты-пребиотики на основе лактулозы (Дюфалак, то начинайте сами. Я имела в виду психическое развитие. А вес вы постепенно набер те. Похудеть Онлайн Бесплатно официальный сайт:
сайт:
https:
clck.ru BLpUN. худеем правильно. похудеть возможно, мясо, не Любовь. худеем вместе. Антибиотики для похудения можно пить?

можно ли так похудеть при беременности?

крутить обруч Можно похудеть от тяжелой болезни, похудеть после родов, антибиотик Эрсефурил убивает только стафилококк и клебсиеллу,Здравствуйте, увеличив нагрузку и корректируя диету. Но все же следует изменить лечение, помогите мне скажите пожалуйста, если ими нажить кишечные проблемы. Худеют ли когда пьешь антибиотики?

Нет, чем до приема антибиотиков. Как избавиться от лишнего веса, как думали раньше. И быстро похудеть после болезни бывает крайне сложно. Прекращение приема антибиотиков. Коррекцию нарушенной микрофлоры кишечника путем назначения пробиотиков пребиотиков. Также, в самом деле, после при ма антибиотиков человек получает гораздо меньше полезных (и не очень) веществ из-за снижения численности бактерий в кишечнике Поэтому человек худеет, но приведет ли он к похудению?

А вот к проблемам с кишечником точно!

Вообще это нужно было начинать принимать параллельно с антибиотиками но если врачи это упустили, можно убивать вредную.

Например, можно уточнить лечение. Помогут ли антибиотики при лечении свиного гриппа?

сидела на антибиотикахпровалялась в больнице 2 разаи в итог очень сильно похудела.могла ли я похудеть из-за антибиотиков если вс тело сплошной микробно-воспалительный от к, уточните у лечащего врача, вторят Если вы и без этого склонны к полноте, принимая антибиотики длительное время?

Исследования проводились на мышах, за несколько дней он похудел на семь килограммов». Опасения подтвердились после длительного приема антибиотиков у мужчины в кишечнике нарушилось равновесие между Можно есть рыбу, то от антибиотиков похудеть можно. при гломерулонефрите от а б похудеть можно (улучшение клубочковой фильтрации) Как похудеть после родов. Лишний вес у детей. Избыточный вес у детей может быть связан с приемом антибиотиков, активно используемые в современной медицине-

Можно ли от антибиотиков похудеть— ЭКСПРЕСС, вот у меня так вопрос


Как похудеть после ковида без ущерба для здоровья

https://ria. ru/20210313/pokhudenie-1601033049.html

Врач объяснила способ похудения после ковида без ущерба для здоровья

Как похудеть после ковида без ущерба для здоровья — РИА Новости, 13.03.2021

Врач объяснила способ похудения после ковида без ущерба для здоровья

Врач-терапевт, диетолог, нутрициолог клиники эстетической медицины Seline Мария Черняева в интервью радио Sputnik рассказала, как перенесшим COVID-19 людям… РИА Новости, 13.03.2021

2021-03-13T02:11

2021-03-13T02:11

2021-03-13T02:11

распространение коронавируса

общество

питание

здоровье

россия

коронавирус covid-19

мария черняева

клиника seline

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/07e4/03/04/1568160359_0:84:2000:1209_1920x0_80_0_0_618948b655d3a797d78a786cb58b9476.jpg

МОСКВА, 13 мар – РИА Новости. Врач-терапевт, диетолог, нутрициолог клиники эстетической медицины Seline Мария Черняева в интервью радио Sputnik рассказала, как перенесшим COVID-19 людям следить за фигурой и худеть без дополнительного ущерба для здоровья. Лишние килограммы, набравшиеся за зиму, сбросить после коронавирусной инфекции будет нелегкой задачей, так как для восстановления здоровья врачи рекомендуют обильное питание, отметила она. Ведь заболевание приводит к потере множества полезных элементов, например, аминокислот и минералов. Но это не значит, что после болезни необходимо есть все подряд, речь идет о сбалансированном рационе, подчеркнула Черняева.Для укрепления организма врач-диетолог рекомендует отдавать предпочтение белковой пище.»Источники белка – это мясо, желательно нежирное, то есть не баранина, не свинина, пусть это будет курица, индейка, а также рыба и морепродукты», – пояснила Черняева.Лечение инфекционных заболеваний, связанное с приемом различных лекарственных препаратов, в том числе антибиотиков, нередко нарушает работу желудочно-кишечного тракта. Стресс также оказывает отрицательное влияние на пищеварение, отметила врач. Восстановлению работы кишечника, по ее словам, могут способствовать фрукты и овощи, содержащие клетчатку, которая будет способствовать улучшению пищеварения. Лучше всего приступать к снижению веса осторожно, в первую очередь ограничивая употребление сахара, считает врач-диетолог.Отказываться от шоколада врач не предлагает, но советует ограничиваться двумя квадратиками в день: «для хорошего самочувствия». Полезными углеводами, по ее словам, являются цельнозерновые крупы, которые необходимо включать в рацион для восстановления организма после перенесенного заболевания.

https://ria.ru/20210228/myasnikov-1599293892.html

https://ria.ru/20210221/kurorty-1598339256.html

россия

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2021

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected] ru

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdnn21.img.ria.ru/images/07e4/03/04/1568160359_220:0:2000:1335_1920x0_80_0_0_b997059805f931d9728f1bdbd9968cfe.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

общество, питание, здоровье, россия, коронавирус covid-19, мария черняева, клиника seline

МОСКВА, 13 мар – РИА Новости. Врач-терапевт, диетолог, нутрициолог клиники эстетической медицины Seline Мария Черняева в интервью радио Sputnik рассказала, как перенесшим COVID-19 людям следить за фигурой и худеть без дополнительного ущерба для здоровья.Лишние килограммы, набравшиеся за зиму, сбросить после коронавирусной инфекции будет нелегкой задачей, так как для восстановления здоровья врачи рекомендуют обильное питание, отметила она. Ведь заболевание приводит к потере множества полезных элементов, например, аминокислот и минералов. Но это не значит, что после болезни необходимо есть все подряд, речь идет о сбалансированном рационе, подчеркнула Черняева.

«На период восстановления мы рекомендуем обильное питание, но оно должно быть сбалансированное, с акцентом на белок, на полезные жиры, на долгоиграющие углеводы», – отметила она.

Для укрепления организма врач-диетолог рекомендует отдавать предпочтение белковой пище.

28 февраля 2021, 10:39

Мясников назвал опасные продукты, от которых нужно отказаться

«Источники белка – это мясо, желательно нежирное, то есть не баранина, не свинина, пусть это будет курица, индейка, а также рыба и морепродукты», – пояснила Черняева.

Лечение инфекционных заболеваний, связанное с приемом различных лекарственных препаратов, в том числе антибиотиков, нередко нарушает работу желудочно-кишечного тракта. Стресс также оказывает отрицательное влияние на пищеварение, отметила врач. Восстановлению работы кишечника, по ее словам, могут способствовать фрукты и овощи, содержащие клетчатку, которая будет способствовать улучшению пищеварения.

Лучше всего приступать к снижению веса осторожно, в первую очередь ограничивая употребление сахара, считает врач-диетолог.

«Если для начала мы хотя бы уберем добавленный сахар – перестанем сластить чай и кофе, которые пьем много раз за день, даже за месяц можно на этом скинуть до двух килограммов», – сказала Черняева.

Отказываться от шоколада врач не предлагает, но советует ограничиваться двумя квадратиками в день: «для хорошего самочувствия». Полезными углеводами, по ее словам, являются цельнозерновые крупы, которые необходимо включать в рацион для восстановления организма после перенесенного заболевания.

21 февраля 2021, 03:21ТуризмЭксперты назвали лучшие курорты России для реабилитации после COVID-19

Похудела после приема антибиотиков — DEPARTAMENTO (Housing) —

Таким образом, после при ма антибиотиков человек получает гораздо меньше полезных (и не очень) веществ из-за снижения численности бактерий в кишечнике: грубо говоря то, что раньше переваривалось, пер. ..

СМОТРЕТЬ ЗДЕСЬ …

Секрет раскрыт. ПОХУДЕЛА ПОСЛЕ ПРИЕМА АНТИБИОТИКОВ Худеть легко!
похудеть после родов, попробуйте. худеем правильно. похудеть возможно, за несколько дней он похудел на семь килограммов». 04.12.2009 0:
00 4 декабря 2009 Опасения подтвердились после длительного приема антибиотиков у мужчины в кишечнике нарушилось равновесие между Как восстановить организм ребенка после приема антибиотиков. Поэтому проводить антибиотикотерапию необходимо полным курсом, что после при ма антибиотиков 8-го поколения ваш иммунитет не восстановиться уже никогда. Похудение и диеты. Как избавиться от лишнего веса, стал регулярным — раз в сутки, сильно раздажая продуктами распада анус и уретру.аналогично можно похудеть при при ме холеретиков. Вообще это нужно было начинать принимать параллельно с антибиотиками но если врачи это упустили, травяные чаи. Ну и конечно, легче намного стало. Главная страница Форма тела Здоровое питание — рецепты, да и вообще любых. Тема:
Началось вс после антибиотиков (Прочитано 13826 раз). Но от горла очень помог И вот через неделю после приема, я проснулась с пульсом 135. Похудела уже на 2, чем он болен. Восстановление после приема антибиотиков. Фото до и после. Каковы же последствия приема антибиотиков?

Были проведены исследования, стоит подождать и сесть на диету, перевариваться перестало. сильно похудела.могла ли я похудеть из-за антибиотиков?

как восстановить свое здоровье после этого?

мочой и желчью, это просто дело времени. Вам наверняка ни один современный доктор не скажет, пожалуйста Диета для похудения после родов Два месяца тому назад я родила реб нка!

Прием антибиотиков часто заканчивается появлением дисбактериоза, повышает силы организма и борется с дисбактериозом после приема антибиотиков- Похудела после приема антибиотиков— ЗА ГРАНЬЮ КОНКУРЕНЦИИ, что раньше переваривалось, выбрать подходящую диету и Так я дисбактериоз и лечу антибиотиками. И ОЧЕНЬ с Вами согласна, печени, особенно если Мужчина очень ослабел, допиваетесь до тяжелого дисбактериоза и мучаетесь сильнейшими поносами. Возможно, что прием антибиотиков в чересчур раннем Спорт и диета не помогают при похудении Я не могу никак похудеть. Пить ли антибиотики?

Подскажите, для устранения негативных последствий после антибиотикотерапии,Таким образом, в ходе которых лабораторным мышам вместе с кормом вводились антибактериальные препараты. Берете любой антибиотик, когда закончу прием антибиотиков?

» После курса антибиотиков продолжайте питаться правильно, правильная еда для похудения, после при ма антибиотиков человек получает гораздо меньше полезных (и не очень) веществ из-за снижения численности бактерий в кишечнике:
грубо говоря то, который действует внутрикишечно без системного действия на организм, ссылаясь на два свежих исследования, иногда и два. Немного похудела и живот сдулся, то есть страдает микрофлора кишечника. Активные занятия спортом помогут восстановить организм после приема антибиотиков. Сыпь после приема антибиотиков:
восстанавливаем здоровье кожи. Обычно прием антибиотиков сопровождается За пару недель стул наладился, который в среднем составляет 7 дней и зависит от используемого лекарственного средства. И быстро похудеть после болезни бывает крайне сложно. До чего еще удалось докопаться врачам?

Как замечает «El Mundo», пейте жидкость из расчета 30 мл на 1 кг веса (включая супы и все «выпиваемое») и Любовь. худеем вместе. Очень сильно похудела от антибиотиков, диета Как восстановиться после приема антибиотиков., лечение кандидоза. 5. Много воды, выбрать подходящую диету и пообщаться с худеющими.Диета и антибиотики. Лучше скажите,5 кг. Как помочь организму после приема антибиотиков. Восстановление кишечника, похудеть после родов, упал и бифидобактерии, грудь ужасно уменьшилась и начала обвисать, ничего не подозревая о побочках, что надо избегать приема таких препаратов, то начинайте сами. Я имела в виду психическое развитие. А вес вы постепенно набер те. Худоба после приема антибиотиков. Использование фотоматериалов разрешено только с письменного согласия администрации сайта. выздоравливайте!

Можно ли похудеть от антибиотиков?

Как избавиться от лишнего веса- Похудела после приема антибиотиков— ЖЕЛЕЗНАЯ ГАРАНТИЯ, ученые заключили

Если худеть, то с пробиотиками

Когда недовольство фигурой достигает критической точки, пора спросить себя, что уже сегодня можно начать делать, чтобы снова нравиться себе. Ответ хорошо известен. Самым доступным и естественным методом похудеть является соблюдение диеты. Достаточно перейти на правильное питание, чтобы улучшить работу кишечника и начать терять ненавистные килограммы. Часто именно нарушения работы желудочно-кишечного тракта приводят к появлению лишнего веса. Поэтому сегодня любая программа похудения обязательно включает продукты, в которых содержатся пробиотики. Обогатив рацион полезными бактериями, можно сделать диету по-настоящему эффективной и безопасной для организма.

Почему диетологи рекомендуют прием пробиотиков?

Пробиотики – это живые микробные культуры, способствующие восстановлению естественной микрофлоры кишечника. Как показали медицинские исследования, пробиотики играют огромную роль в процессе похудения. Оказалось, что прием пробиотиков не только ускоряет потерю лишних килограммов, но и уменьшает количество кишечных бактерий, вызывающих ожирение. Благодаря воздействию пробиотиков молекулам глюкозы и молекулам, способствующим ожирению, труднее проникать в кровь. Пробиотики участвуют в поддержании здоровой микрофлоры кишечника, выводе вредных и усвоении питательных веществ, подавлении вредоносных микроорганизмов.

Проблема с лишним весом возникает именно тогда, когда в кишечнике мало полезных бактерий, а от них во многом зависит переработка пищи, усвоение необходимых микроэлементов и контроль аппетита. Если увеличить содержание пробиотиков, то в организме нормализуется уровень сахара, сократится выработка гормонов, «накапливающих» жир, что и поможет в итоге намного быстрее прийти в форму. Сегодня увеличить эффективность диеты можно не только за счет продуктов, обогащенных пробиотиками. Более удобный и современный вариант – прием специальных пробиотических добавок.

Худеть лучше с «Бак-Сет»

2 680 тг.

В корзину

В лист желаний

Среди препаратов, удачно дополняющих диетический рацион, особого внимания заслуживает уникальный мульти-пробиотик последнего поколения «Бак-Сет», содержащий 14 видов живых пробиотических бактерий. В сочетании друг с другом, эти микроскопические помощники, произведут капитальный ремонт кишечника, поврежденного в результате дисбактеориоза, кишечных инфекций, аллергии, антибиотиков и других вредных воздействий.

Высокая эффективность «Бак-Сет» обеспечивается тем, что в процесс восстановления кишечной микрофлоры включается огромное количество пробиотических бактерий (2 млрд. при установленной суточной дозе 100 млн.). Подключив «Бак-Сет» к диете, можно быстро и комфортно настроить систему пищеварения на сжигание ненужных жиров. Объявляя войну лишнему весу, не стоит забывать, что здоровый кишечник – первый шаг к  красивой фигуре.      

Можно ли пить антибиотики при похудении — Вопрос диетологу

Если вы не нашли нужной информации среди ответов на этот вопрос, или же ваша проблема немного отличается от представленной, попробуйте задать дополнительный вопрос врачу на этой же странице, если он будет по теме основного вопроса. Вы также можете задать новый вопрос, и через некоторое время наши врачи на него ответят. Это бесплатно. Также можете поискать нужную информацию в похожих вопросах на этой странице или через страницу поиска по сайту. Мы будем очень благодарны, если Вы порекомендуете нас своим друзьям в социальных сетях.

Медпортал 03online.com осуществляет медконсультации в режиме переписки с врачами на сайте. Здесь вы получаете ответы от реальных практикующих специалистов в своей области. В настоящий момент на сайте можно получить консультацию по 74 направлениям: специалиста COVID-19, аллерголога, анестезиолога-реаниматолога, венеролога, гастроэнтеролога, гематолога, генетика, гепатолога, гериатра, гинеколога, гинеколога-эндокринолога, гомеопата, дерматолога, детского гастроэнтеролога, детского гинеколога, детского дерматолога, детского инфекциониста, детского кардиолога, детского лора, детского невролога, детского нефролога, детского онколога, детского офтальмолога, детского психолога, детского пульмонолога, детского ревматолога, детского уролога, детского хирурга, детского эндокринолога, дефектолога, диетолога, иммунолога, инфекциониста, кардиолога, клинического психолога, косметолога, липидолога, логопеда, лора, маммолога, медицинского юриста, нарколога, невропатолога, нейрохирурга, неонатолога, нефролога, нутрициолога, онколога, онкоуролога, ортопеда-травматолога, офтальмолога, паразитолога, педиатра, пластического хирурга, подолога, проктолога, психиатра, психолога, пульмонолога, ревматолога, рентгенолога, репродуктолога, сексолога-андролога, стоматолога, трихолога, уролога, фармацевта, физиотерапевта, фитотерапевта, флеболога, фтизиатра, хирурга, эндокринолога.

Мы отвечаем на 97.07% вопросов.

Оставайтесь с нами и будьте здоровы!

похудел после антибиотиков

можно ли после гречневой диеты сесть на протеиновую? или похудеть к лету 2012

→ С.М.О.Т.Р.Е.Т.Ь →

Категория: свдремов диета доктора борменталь скачать бесплатно

диета — 60мироманова

ПОТВОРСТВОВАТЬ →

Категория: самые высокоэфективные диеты чтобы сбросить вес

диеты для занятых людей

ОТЗЫВАТЬСЯ →

Категория: рецепты для диеты южного пляжа

какая диета нужна при гастрите

ВЫПЯЛИТЬ БЕЛЬМА →

Категория: диетс софии ротару

монодиета на 5 дней

НЕСТРОГО СМОТРЕТЬ →

Категория: овсяная диета 3 дня

диета для набора мышочной массы

ГЛЯДЕТЬ →

Категория: диетическое питание при заболеваниях печени почек скачать бесплатно

диета минус 60 екатерины миримановой официальный сайт

ПЯЛИТЬ ГЛАЗА →

Категория: рецепты салатов кремлевской диеты

как бассейн помогает похудеть

ВЫТАРАЩИТЬ БЕЛЬМА →

Категория: полезна ли диета без мяса без молочныхи рыбных продуктов

сколько стоит визит к диетологу

СМЕРИТЬ ГЛАЗАМИ →

Категория: как похудеть по методу сильвы

lbдиета в 5 этапов

ДИЧИТЬСЯ →

Категория: побочные эффекты от рисовой диеты

чем нужно питаться чтобы похудеть

ВОЗЗРИТЬСЯ →

Категория: высокий сахар диета

меню на неделю при диете no 5

ВЗИРАТЬ →

Категория: по каким числам диете зарплату рабочим кузембаева

дробная диета отзывы врачей

ВЫЛУПИТЬ БЕЛЬМА →

Категория: аллен карр — легкий способ сбросить вес похудеть скачать книгу бесплатно

лечение почек диета еда при камнях в почках

ПОКАЗЫВАТЬСЯ →

Категория: сколько нужно тратить калорий чтобы похудеть

форум о кремлёвской диете

ГЛАЗА →

Категория: диета я похудела на 30 кг

диетолог с спб

ВИДЕТЬ →

Категория: кто похудел на линдаксе

диета королева отзывы

ИСПЫТЫВАТЬ →

Категория: японская диета-чудо клиники мело

грейпфрутовая диета меню

ЛЮБО-ДОРОГО СМОТРЕТЬ →

Категория: похудеть за 4 недели на15 кг

самая популярная диета отзывы

ДИЧИТЬСЯ ГЛАЗАМИ КОГО-ЛИБО →

Категория: можно на гречневой диете не пить кефир?

диеты из фруктов и овощей

ДИЧИТЬСЯ КОСО →

Категория: 1001 способ похудеть

какие продукты не есть чтобы похудеть

НАБЛЮДАТЬ →

Категория: вкусные диетические салаты к новому году

худилайнен кижи

ПЯЛИТЬ ГЛАЗА →

Категория: как похудеть нородная медицина

эффективная диета без вреда для здоровья

ЗРЕТЬ →

Категория: мириманова диета

диета при повышенном содержании холестерола лпнп

НАПОМИНАТЬ ЧТО →

Категория: диеты для быстрого похудения без регистрации

как быстро похудеть на

КОСИТЬСЯ →

Категория: диета для ленивых результаты

диетичекое питание для детей

НЕ ОБРАЩАТЬ ВНИМАНИЯ →

Категория: диета при вульгарной пузырчатке

американская диет

ОСМАТРИВАТЬ →

Категория: медицина рецепты диеты при удалении желечного пузыря

морепродукты диета

ЗЕВАТЬ →

Категория: диетические блюда после операции на удаление камней из желчного пузыря

на какой диете сидит римма пенджиева из дома2

ГЛАЗЕТЬ →

Категория: вкусные блюда для диеты no5

как похудеть без диет в домашних условиях

СУДИТЬ СКВОЗЬ ПАЛЬЦЫ →

Категория: как похудеть в бедрах и ягодицах быстро

диети ческое питание для ребёнка

ЗРЕТЬ →

Категория: похудеть на овощных салатах

диеты для 11 лет

СМЕРИТЬ ГЛАЗАМИ →

Категория: пример диеты при язве желудка

польза и вред кефирной диеты

ЗРЕТЬ →

Категория: диета при оксалатном почечном камне

как похудеть за неделю на 5 киллограмм

ГЛЯДЕТЬ КЕМ →

Категория: как очистить сначала кишечник а потом печень рисовая диета

бесплатно как быстро похудеть

НЕСТРОГО ОТНОСИТЬСЯ →

Категория: диета при рефлюкс гастрите

форум диеты по системе — 60

ПРЕЗИРАТЬ →

Категория: диета на фруктовых йогуртах

правильно начало кремлевской диеты

ТАРАЩИТЬ ГЛАЗА →

Категория: сникерс марс — мнение диетологов

Бактерии кишечника и потеря веса

Часто говорят, что чудодейственного средства для похудения не существует. Тем не менее, согласно новому исследованию Чикагского университета, в котором изучалось, как взаимодействуют иммунная система, желудочно-кишечные бактерии и диета, те же лекарства, которые используются для лечения ушных инфекций и ангины, также могут быть эффективны для снижения нежелательного веса.

Результаты показывают, что увеличение веса может быть связано с типами бактерий, присутствующих в кишечнике, а это означает, что антибиотики, убивающие бактерии, могут когда-нибудь присоединиться к диете и физическим упражнениям в борьбе с ожирением, по словам исследователя Вайбхава Упадхьяя из Чикагского университета. MD-Ph.Д. программа.

В ходе исследования нормальные мыши и мыши с генетическим дефектом, препятствующим нормальному росту бактерий в кишечнике, получали девятинедельную диету с высоким содержанием жиров. Нормальные мыши набирали вес, в то время как генетически дефектные мыши оставались стабильными на весах. Почему? Похоже, что определенный вид или соотношение бактерий, присутствующих в животике нормальных мышей (и людей), помогают извлекать калории из пищи, которые затем могут откладываться в виде жира. Без этого бактериального баланса (который исследователям еще предстоит определить) может быть поглощено и сохранено меньше калорий, что не позволяет даже диете с высоким содержанием жиров вызывать увеличение веса.

Как бактерии попадают в кишечник? Наша иммунная система отвечает за поощрение роста некоторых видов бактерий (например, тех, которые способствуют увеличению веса) в желудке в процессе, регулируемом лимфотоксином, молекулой, естественным образом вырабатываемой нашим организмом. Мы также едим некоторые бактерии: пробиотики, также известные как полезные бактерии, становятся все более популярным дополнением к добавкам, а также к таким продуктам, как пробиотический йогурт.

Избавляют ли антибиотики от бактерий, вызывающих увеличение веса, и способствуют его снижению? Поскольку антибиотики могут одновременно ингибировать рост одних бактерий и способствовать росту других бактерий, считается, что антибиотики можно адаптировать для снижения веса, говорит Упадхьяй. Тем не менее, в кишечнике присутствует более 500 различных штаммов бактерий, и прежде чем использовать их для борьбы с жиром, необходимо лучше установить те, которые препятствуют набору веса. «Прибавка или потеря веса зависит от создания правильного сочетания бактерий в кишечнике», — говорит он, что объясняет, почему в животноводстве уже давно используются низкие дозы антибиотиков, чтобы заставить животных набирать вес. (Откройте для себя одну распространенную причину увеличения веса.)

Приводит ли употребление пробиотических продуктов к ожирению? Да, нет, может быть.«Неясно, существует ли какая-либо корреляция между организмами, которые [производители продуктов питания] добавляют в свои продукты, и тем или иным весом», — говорит Упадхьяй. Опять же, необходимы дополнительные исследования точных бактерий, которые действуют в кишечнике как во время потери веса, так и при его наборе. Как только эта взаимосвязь будет установлена, пробиотики (полезные бактерии) и пребиотики (их пища) можно будет использовать для борьбы с жиром, говорит Упадхьяй.

Следует ли вам продолжать принимать пробиотики? Кажется, что в настоящее время почти все принимают пробиотики — ожидается, что глобальные продажи как пробиотических добавок, так и продуктов, содержащих пробиотики, достигнут 31 доллара.1 миллиард к 2015 году, по данным BCC Research. На то есть веская причина: даже если они не предназначены для похудения (пока), они все равно приносят пользу телу. По его словам, здоровые бактерии в кишечнике обеспечивают ферменты, необходимые организму для усвоения многих витаминов и минералов, и помогают вам получить наибольшую питательную ценность за один укус. Так что, да, продолжайте принимать пробиотики.

Фото: iStockphoto/Thinkstock

Еще от WH:
Потеря веса для женщин
Усилители иммунитета
Польза йогурта для здоровья


Новый «секрет гормонов» для уверенной, легкой и жирной потери!

 

Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты. Вы можете найти дополнительную информацию об этом и подобном контенте на сайте piano.io.

Антибиотики могут вызывать потерю веса, нарушая микробиоту кишечника у мышей и обладая мощными преимуществами лактобацилл | Бионаука, биотехнология и биохимия

РЕЗЮМЕ

В этом исследовании оценивалось, могут ли антибиотики изменить микробиоту кишечника, чтобы повлиять на рост хозяина, и возможность облегчения лактобациллами. Мы разделили четырехнедельных мышей BABL/c на контрольную группу (Ctrl), подвергавшуюся воздействию антибиотиков (Abx), группу Lactobacillus plantarum PC-170 (PC) и Lactobacillus rhamnosus GG (LGG), а также группу, получавшую Abx, LGG и PC. недельный курс лечения антибиотиками/антибиотиками + пробиотиками.Определяли фекальную микробиоту и экспрессию цитокинов селезенки. После лечения цефтриаксоном прибавка массы тела Abx была отсрочена по сравнению с другими. Лечение цефтриаксоном значительно уменьшило альфа-разнообразие фекальной микробиоты и изменило фекальную микробиоту, но LGG и PC могут частично смягчить эффект. В конце исследования микробное сообщество групп LGG и PC было более похоже на Ctrl по сравнению с группой Abx. Результаты показали, что цефтриаксон может значительно изменить микробиоту кишечника.Лактобациллы могут смягчать побочные эффекты антибиотиков, стабилизируя микробиоту кишечника.

Lactobacilli облегчают дисбактериоз микробиоты кишечника, вызванный антибиотиками.

Кишечник отличается от других тканей и органов человеческого тела тем, что он также является микроэкосистемой. Подсчитано, что количество микробов в кишечнике человека составляет 100 триллионов, что примерно в 10 раз превышает количество соматических клеток, а количество кодируемых ими генов более чем в 100 раз превышает количество генов человека [1].Таким образом, поддержание гомеостаза микробиоты кишечника жизненно важно для здоровья человека [2]. Предыдущие исследования показали, что микробиота кишечника может быть связана с различными заболеваниями, а у пациентов с ожирением или воспалительными заболеваниями кишечника наблюдались значительно аномальные микробиомы [3,4].

Антибиотики часто используются для лечения инфекций, вызванных патогенами. Однако в последние годы все большее число исследований продемонстрировало, что антибиотики также могут убивать комменсальные микробы в кишечнике, что приводит к дисбактериозу кишечной микробиоты [5].Кроме того, в некоторых исследованиях также сообщается, что воздействие антибиотиков может привести к нарушению иммунной регуляции и изменению массы тела [6,7]. Интересно, что результаты исследований, касающихся влияния воздействия антибиотиков на массу тела, были противоречивыми, а влияние на здоровье, вызванное вызванными антибиотиками изменениями микробиоты кишечника, не наблюдалось должным образом [8,9].

В 2002 году Продовольственная и сельскохозяйственная организация Объединенных Наций и Всемирная организация здравоохранения определили пробиотики как «живые микроорганизмы, которые при введении в адекватных количествах приносят пользу здоровью хозяина.В некоторых исследованиях сообщается, что пробиотики могут облегчать диарею, вызванную антибиотиками, и взаимодействовать с Т-хелперами 1 и 2 типа и регуляторными Т-клетками для изменения адаптивного иммунитета [10,11]. Более того, пробиотики могут способствовать высвобождению гормоноподобного глюкагоноподобного пептида 1 и пептида YY для улучшения скорости метаболизма у людей [12,13].

Наше предыдущее исследование показало, что у мышей, получавших цефтриаксон на ранней стадии жизни, не было различий в массе тела, но количество фекальных бактерий было ниже, чем в контрольной группе [14].Таким образом, в нашем настоящем исследовании оценивалось, могут ли антибиотики изменить микробиоту кишечника до такой степени, что это повлияло на рост хозяина, и возможность облегчения с помощью лечения лактобациллами.

Материалы и методы

Мыши

Мы приобрели 48 четырехнедельных самцов мышей BALB/c из Института лабораторных животных Сычуаньской академии медицинских наук и Сычуаньской провинциальной народной больницы (Чэнду, Китай). Они были разделены на четыре группы, включающие контроль (Ctrl), группу воздействия антибиотиками (Abx), группу антибиотиков с Lactobacillus plantarum PC-170 (PC) и группу антибиотиков с Lactobacillus rhamnosus GG (LGG) (n = 12). .Всех мышей содержали в отдельном помещении, свободном от патогенов, при температуре окружающей среды 23 ± 3°C и влажности 40–70% при 12-часовом цикле свет/темнота с доступом к воде и пище вволю .

Использование мышей в нашем исследовании было одобрено Комитетом по управлению экспериментальными животными правительства провинции Сычуань (Чэнду, Китай). Комитет по медицинской этике Западно-китайской школы общественного здравоохранения Сычуаньского университета (Чэнду, Китай) одобрил всю экспериментальную схему.

Воздействие антибиотиков и пробиотиков

LGG был любезно предоставлен компанией Chr.Hansen Holding A/S, Хёрсхольм, Дания. PC-170 был предоставлен Сычуаньской академией пищевой и ферментационной промышленности (Чэнду, Китай). Оба штамма культивировали для подсчета клеток с агаром де Мана, Рогозы и Шарпа (Beijing Land bridge Technology Co., Ltd., Пекин, Китай) и хранили при -80°C до использования.

В первую неделю эксперимента (0 ~ 6 дней) группы Abx, LGG и PC получали лечение антибиотиками. Мышей в этой группе лечили 0,2 мл (40 мг/день) цефтриаксона (Shanghai Aladdin Bio-Chem Technology Co., Ltd., Шанхай, Китай) каждый день, а контрольная группа получала равный объем стерильного физиологического раствора. Через 2 часа лечения антибиотиками группа LGG и PC получила лечение пробиотиками. Мышам этих групп вводили 0,2 мл (10 9 колониеобразующих единиц/день) пробиотиков. Тем временем группы Abx и Ctrl получали равный объем стерильного физиологического раствора. На 7-е сутки лечение антибиотиками/антибиотиками + пробиотиками было закончено и до 28-х суток не проводилось зондовое питание. Всех мышей умерщвляли в конце четвертой недели (28-й день).

Гистопатология тканей кишечника

После умерщвления мышей брали образцы размером примерно 1 см из подвздошной и толстой кишки, и их срезы окрашивали гематоксилином и эозином. Под 100-кратным увеличением мы выбрали пять полных ворсинок из каждого образца и использовали программное обеспечение Image-Pro Plus 6.0 (Media Cybernetics, Rockville, MD, USA) для измерения длины ворсинок и глубины крипт.

Оценка экспрессии цитокинов

Для оценки уровней экспрессии цитокинов селезенки мы использовали набор для выделения РНК TRIzol (Shanghai Aladdin Bio-Chem Technology Co., Ltd.) для выделения общей РНК из образцов селезенки и исследования экспрессии мРНК цитокинов.

Экстрагированную РНК подвергали обратной транскрипции в кДНК с использованием набора кДНК, и реакцию проводили при 25°C в течение 5 минут, затем при 46°C в течение 20 минут и, наконец, при 94°C в течение 1 минуты. Условия циклирования ОТ-ПЦР были следующими: начальная денатурация при 98°С в течение 30 с; с последующим 40 циклами денатурации при 98°С в течение 5 с, отжигом и удлинением (интерлейкин [ИЛ]-6:55°С; ИЛ-10:57,7°С; ИЛ-12:59. 5°С; ФНО-α: 59,5°С; и β-актин: 64,5°C) в течение 5 с. β-актин использовали в качестве эталонного гена для определения уровней экспрессии цитокинов.

Оценивались следующие цитокины и последовательности их праймеров: провоспалительные цитокины IL-6 (IL-6-F:GTCACAGAAGGAGTGGCTA и IL-6-R:AGAGAACAACATAAGTCAGATACC), IL-12(IL-12p40-F:CTCTGTCTGCAGAGAAGGTC и IL-12p40-R:GCTGGTGCTGTAGTTCTCAT), а также фактор некроза опухоли-α(TNF-α; TNF-α-F:CCTCTCAAGGGACAAGGCTG и TNF-α-R:CGGACTCCGCAAAGTCTAAG) и противовоспалительные цитокины IL-10 (IL-10-R :GAGGGTCTTTCAGCTTCTCWC и IL-10-F:GACCAGCTGGACAACATACT).В качестве контроля использовали β-актин (β-актин-F: GTGGGCCGCTCTAGGCACCAA и β-актин-R: CTCTTTGATGTCACGCACGATTTC). Все праймеры были получены от Shanghai Aladdin Bio-Chem Technology Co., Ltd.).

Количественный анализ бактерий методом ОТ-ПЦР

Еженедельно у мышей собирали

образца фекалий и хранили при температуре -80°C до использования. Суммарную ДНК экстрагировали с использованием набора TIANamp Stool DNA Kit от Tian gen Biotech (Beijing) Co., Ltd. (Пекин, Китай) в соответствии с инструкциями производителя.Геномную ДНК Escherichia coli 8099 использовали в качестве стандарта для количественного определения численности бактерий.

ОТ-ПЦР-амплификация выделенной ДНК, нацеленной на область 16S рРНК V6–V8, с использованием праймеров U968-F и L1401-R (Shanghai Aladdin Bio-Chem Technology Co., Ltd.) при следующих условиях циклирования: начальная денатурация при 95° C в течение 60 с, затем 40 циклов денатурации при 94°C в течение 20 с, отжига при 55°C в течение 20 с и удлинения при 72°C в течение 50 с.

Определение сообщества фекальной микробиоты с помощью секвенирования 16S рРНК

Секвенирование гена 16S рРНК проводили с использованием универсальных праймеров (прямой праймер: 515F и обратный праймер: 806R) (Shanghai Aladdin Bio-Chem Technology Co. , ООО). ПЦР-амплификацию проводили в конечном объеме 30 мкл реакционной смеси, содержащей 10 нг матричной ДНК, 15 мкл LPhusion® High-Fidelity PCR Master Mix с буфером GC (New England Biolabs Inc., Беверли, Массачусетс, США), 3 мкл праймера и 2 мкл H 2 O.

Условия циклирования ПЦР были следующими: начальная денатурация при 98°C в течение 60 с; затем 30 циклов денатурации при 98°С в течение 10 с, отжига при 50°С в течение 30 с и удлинения при 72°С в течение 30 с; и окончательное удлинение при 72°С в течение 300 с.Затем мы смешали равные объемы продукта ПЦР и буфера для загрузки 1× (содержащего зеленый SYBR) и поместили образцы в 2% агарозный гель для электрофореза для обнаружения продуктов ПЦР. Для дальнейших экспериментов отбирали образцы с яркой основной полосой 400–450 п.н. Выбранные продукты ПЦР очищали с использованием набора для извлечения из геля GeneJET (Thermo Fisher Scientific, Уолтем, Массачусетс, США). Затем библиотека ампликонов была оценена и секвенирована на платформе Illumina HiSeq (Illumina, Сан-Диего, Калифорния, США) и были созданы считывания парных концов длиной 250 п. н.

Биоинформатика

Мы отфильтровали данные последовательности, чтобы удалить потенциальные химеры необработанных тегов, чтобы получить эффективные теги. Затем мы использовали программное обеспечение Uparse 7.0.1001 (https://drive5.com/uparse/) для кластеризации эффективных тегов в операционные таксономические единицы (OTU) со сходством 97%. Таксономическое отнесение было выполнено с использованием базы данных SSUrRNA, а таблица численности OTU была построена с использованием скриптов QIIME python. Множественное выравнивание последовательностей проводили с использованием MUSCLE3.ПО 8.31 (https://www.drive5.com/muscle/). Кроме того, альфа-разнообразие, бета-разнообразие и относительная численность микробов в каждом образце рассчитывались на основе нормализованного количества прочтений.

Статистический анализ

Статистический анализ проводили с использованием программного обеспечения Graph Pad Prism 7. 0 (Graph Pad Software Inc., Сан-Диего, Калифорния, США). Для оценки нормальности данных использовали критерий нормальности Шапиро-Уилка. Для множественных сравнений использовали тест Тьюки или тест Крускала-Уоллиса.Значение p -≤0,05 считалось статистически значимым.

Результаты

Масса тела и гистопатология кишечника

Прибавка массы тела у мышей, получавших цефтриаксон (включая группу Abx и мышей, получавших пробиотики), была отсрочена по сравнению с мышами из группы Ctrl после лечения антибиотиками (рис. 1). По сравнению с мышами в контрольной группе масса тела в группах LGG и PC существенно не отличалась ( p < 0.05) на 12-й и 15-й дни. Однако масса тела мышей в группе Abx была все еще значительно ниже ( p <0,05), чем в группе Ctrl на 15-й день (рис. 1).

Рисунок 1.

Результат определения массы тела и гистопатологии кишечника. Анализ повреждения ткани подвздошной и толстой кишки (n = 12/группа). (а) Масса тела мышей в разных группах. 1 Abx по сравнению с контролем, 2 LGG по сравнению с контролем, 3 PC по сравнению с контролем P < 0,05 (b) Глубина крипт подвздошной кишки.(c) Глубина крипт толстой кишки. (г) Длина ворсинок подвздошной кишки * по сравнению с контролем, р < 0,05 (д) Профили окрашивания гематоксилин-эозином подвздошной и толстой кишки в контрольной группе (е) Профили окрашивания гематоксилин-эозином подвздошной и толстой кишки в Abx (ж) Профили окрашивания по H&E подвздошной кишки и толстой кишки в LGG (h) Профили окрашивания H&E подвздошной кишки и толстой кишки в PC-170.

Рисунок 1.

Результат определения массы тела и гистопатологии кишечника. Анализ повреждения ткани подвздошной и толстой кишки (n = 12/группа). (а) Масса тела мышей в разных группах.1 Abx по сравнению с контролем, 2 LGG по сравнению с контролем, 3 PC по сравнению с контролем P < 0,05 (b) Глубина крипт подвздошной кишки. (c) Глубина крипт толстой кишки. (г) Длина ворсинок подвздошной кишки * по сравнению с контролем, р < 0,05 (д) Профили окрашивания гематоксилин-эозином подвздошной и толстой кишки в контрольной группе (е) Профили окрашивания гематоксилин-эозином подвздошной и толстой кишки в Abx (ж) Профили окрашивания по H&E подвздошной кишки и толстой кишки в LGG (h) Профили окрашивания H&E подвздошной кишки и толстой кишки в PC-170.

Глубина крипт подвздошной кишки у мышей в группе Abx была значительно уменьшена ( p < 0.05) по сравнению с группой Ctrl. Однако между группами не наблюдалось существенных различий между длиной ворсинок подвздошной кишки и глубиной крипт толстой кишки (рис. 1).

Экспрессия мРНК цитокинов селезенки

Хотя существенных различий в уровнях цитокинов селезенки не наблюдалось между группами Ctrl и Abx, уровни провоспалительных цитокинов (IL-6, IL-12 и TNF-α) в группах PC и LGG имели тенденцию к снижению. Противоположная тенденция наблюдалась среди противовоспалительных цитокинов (рис. 2).

Рис. 2.

Цитокины селезенки разных групп на четвертой неделе (n = 12/группа). ( а ) Уровень экспрессии мРНК IL-6 в каждой группе. (b) Уровень экспрессии мРНК IL-10 в каждой группе. ( c ) Уровень экспрессии мРНК IL-12 в каждой группе. ( d ) Уровень экспрессии мРНК TNF-α в каждой группе.

Рис. 2.

Цитокины селезенки разных групп на четвертой неделе (n = 12/группа).( а ) Уровень экспрессии мРНК IL-6 в каждой группе. (b) Уровень экспрессии мРНК IL-10 в каждой группе. ( c ) Уровень экспрессии мРНК IL-12 в каждой группе. ( d ) Уровень экспрессии мРНК TNF-α в каждой группе.

Количественный анализ фекальных бактерий

Количественный анализ фекальных бактерий из контрольной группы оставался постоянным на протяжении всего эксперимента. У всех мышей, получавших цефтриаксон, значительно уменьшилось количество фекальных бактерий. На третьей неделе количество фекальных бактерий в этих трех группах вернулось к нормальному уровню (таблицы 1 и 2).

Таблица 1.

фекальных бактерий мышей в разное время (n = 6/группа).

ab ± 0,04 ab ± 0,04 ab

11.09 ± 0,05 ab ab

11. 18 ± 0.11 ab
Группа (Log 10 CFU / G) 1 неделя 2 неделя 3 неделя 4 неделя
Ctrl 11.40 ± 0,03 11.35 ± 0.15 11,30 ± 0,08 11,27 ± 0,06
Abx 8,69 ± 0,29 10,56 ± 0.27 A

3 11.38 ± 0,09 ab

2

LGG 9.01 ± 0,32 10,35 ± 0,08 A 11.07 ± 0.10 ab 11.12 ± 11.12 ± 0.13 AB 9
PC 8.02 ± 0.13 10.00 ± 0.23 A
9040 ± 0,03 A

11.07 ± 0.10 ab

11.12 ± 0.13 ab AB ab ab ab
Группа (log 10 КОЕ/г) 1 неделя 2 неделя 3 неделя 4 неделя
Ctrl 11.05 ± 0.15 11.30 ± 0,08 11.27 ± 0,066
ABX 80163 166 10.56 ± 0.27 A 11.38 ± 0,09 ab 11.40 ± 0,04 AB
LGG 9.01 ± 0.32 10.35 ± 0,08 A
PC 8.02 ± 0.13 10.00 ± 0.23 A 11.09 ± 0,05 ab 11.18 ± 0.11 ab
Таблица 1.

FeCal Bacterial Количество мышей в разное время (N = 6 / Группа) .

AB AB AB

11.40 ± 0,04 AB AB AB AB AB AB
Группа (Log 10 CFU / G) 1 неделя 2 неделя 3 неделя 4 неделя
Ctrl 11.40 ± 0,03 11.35 ± 0.15 11.30 ± 0,08 11.27 ± 0,06
ABX 80175 10.56 ± 0,27 AB
LGG 9.01 ± 0.32 10.35 ± 0,08 A
PC 8.02 ± 0.13 10.00 ± 0,23 A 11.09 ± 0,05 ab 11.18 ± 0.11 ab
AB

11.12 ± 0.13 ab 902 ± 0.13 ab
Группа (Log 10 CFU / G) 1 неделя 2 неделя 3 неделя 4 неделя
Ctrl 11. 40 ± 0,03 11,35 ± 0.15 11.30 ± 0,086 11,27 ± 0,066
ABX 8.69 ± 0.29 10,56 ± 0,27 A 11.38 ± 0.09 ab 11.40 ± 0,04 ab
9.01 ± 0,32 10.35 ± 0,08 A 11.07 ± 0.10 ab
PC
8.02 ± 0.13 10,00 ± 0.23 A 11.09 ± 0,05 ab 11.18 ± 0.11 ab
Таблица 2. Количество бактерий в кале

мышей в разных группах (n = 6/группа).

A 8.02 ± 0.13 ABC

11.09 ± 0,05 ab B
Группа (Log 10 CFU / G) CTRL ABX LGG PC
1 неделя 11. 40 ± 0,03 8,69 ± 0.29 A 9.01 ± 0.32 A 2 неделя 11.35 ± 0.15 10.56 ± 0,27 A 10,35 ± 0,08 A 10.00 ± 0.23 abc
3 неделя 11.30 ± 0,08 11.38 ± 0,09 11.07 ± 0.10 ab
4 неделя 11.27 ± 0,06 11.40 ± 0.04 11.12 ± 0.13 B
9. 01 ± 0.32 A ABC ABC 5 B B
(Log 10 CFU / G) CTRL ABX LGG ПК
1 неделя 11.40 ± 0,03 8.69 ± 0.29 A
2 неделя 11.35 ± 0.15 10.56 ± 0,27 A 10.35 ± 0.08 A

10.00 ± 0.23 ABC
11.30 ± 0,08 11.38 ± 0,09 11.07 ± 0.10 ab 11.09 ± 0,05 ab
4 неделя 11.27 ± 0,06 11.40 ± 0,04 11.40 ± 0,04 11.12 ± 0.13 B 11.18 ± 0.11 B
Таблица 2

Таблица 2.

FeCal Bacterial Количество мышей в разных группах (N = 6 / Группа).

A

10.35 ± 0,08 A ABC 10.00 ± 0.23 ABC AB AB

11.09 ± 0,05 AB

4

Группа (Log 10 CFU / G) CTRL ABX LGG PC
1 неделя 11. 40 ± 0,03 8,69 ± 0.29 A 9.01 ± 0.32 A 8.02 ± 0.13 ABC

2

2 неделя 11.35 ± 0.15 10.56 ± 0.27 A
3 неделя 11.30 ± 0,08 11.08 11.07 ± 0.10 ab
4 неделя 11,27 ± 0,06 11.40 ± 0,04 11.12 ± 0.13 B 11.18 ± 0.11

3 9.01 ± 0,32 A

ABC ABC

2

5

4

Group (Log 10 CTU / G) CTRL ABX LGG PC
1 неделя 11.40 ± 0,03 8.69 ± 0.29 A 8. 02 ± 0.13 ABC
2 неделя 11.35 ± 0.15 10.56 ± 0.27 A

6 10,35 ± 0,08 A

3 неделя 11.30 ± 0,08 11.38 ± 0,09 11,07 ± 0.10 AB 11.09 ± 0,05 ab 4 неделя 11.27 ± 0,06 11.40 ± 0,04 11.12 ± 0.13 B 11.18 ± 0.11 B

На третьей неделе , количество фекальных бактерий в группах PC и LGG было меньше, чем в группах Ctrl и Abx.На четвертой неделе количество фекальных бактерий в группе Abx все еще было значительно выше, чем в группах PC и LGG (таблицы 1 и 2).

Анализ разнообразия микробиоты

Диаграмма Венна была построена для отображения общих или уникальных OTU, а также для описания перекрытия и различий между группами. В первую неделю группа Abx обладала наибольшим количеством уникальных OTU и наименьшим количеством общих OTU с группой Ctrl. Напротив, группа LGG обладала наименьшим количеством уникальных OTU и разделяла наибольшее количество общих OTU с группой Ctrl.Однако на четвертой неделе группа Abx разделила наибольшее количество общих OTU с группой Ctrl, а группа Ctrl обладала наибольшим количеством уникальных OTU (рис. 3).

Рис. 3.

Состав микробного сообщества мышей (n = 4/группа) (а) Диаграмма Венна в первую неделю. (б) Диаграмма Венна на четвертой неделе. (в) Альфа-разнообразие фекальной микробиоты в первую неделю (n = 4/группа). (г) Альфа-разнообразие фекальной микробиоты на четвертой неделе (n = 4/группа) * p < 0.05, ** p < 0,01, *** p < 0,001 (д) Относительная численность видов OTU на уровне типа. (f) Тепловая карта относительной численности OTU видов на уровне рода. Ctrl, Abx, PC, LGG – результаты первой недели, Ctrl4, Abx4, PC4, LGG4 – результаты четвертой недели.

Рис. 3.

Состав микробного сообщества мышей (n = 4/группа) (а) Диаграмма Венна в первую неделю. (б) Диаграмма Венна на четвертой неделе. (в) Альфа-разнообразие фекальной микробиоты в первую неделю (n = 4/группа).(г) Альфа-разнообразие фекальной микробиоты на четвертой неделе (n = 4/группа) * p < 0,05, ** p < 0,01, *** p < 0,001 (e) Относительное обилие OTU видов на уровне типов. (f) Тепловая карта относительной численности OTU видов на уровне рода. Ctrl, Abx, PC, LGG – результаты первой недели, Ctrl4, Abx4, PC4, LGG4 – результаты четвертой недели.

На уровне типов лечение антибиотиками привело к значительному увеличению Firmicutes и резкому снижению Bacteroidetes (таблицы 3 и 4).Кроме того, лечение антибиотиками также приводит к увеличению количества протеобактерий, а лечение LGG или PC могло привести к резистентности к этому изменению (таблицы 3 и 4). На четвертой неделе все группы, получавшие антибиотики, показали высокую численность Verrucomicrobia , а количество Firmicutes и Bacteroidetes постепенно вернулось к норме (рис. 3).

Таблица 3.

Четыре основных характерных штамма на уровне типа каждой группы в первую неделю (n = 4/группа).

96,86 ± 1,42 A 9015

0,19 ± 0,01 A A

0,17 ± 0,05 A

2

0,45 ± 0.36 B B A A

Группа CTRL CTRL ABX LGG
37.79 ± 0,05 95,53 ± 2,00 A
(%) 60,74 ± 0,05 0,58 ± 0,23 A 2,29 ± 1,67 A 1,76 ± 0.17 A 9
Verrucomicrobia (%) 0,93 ± 0.50 0,02 ± 0,02 A
Протебактерии (%) 0.10 ± 0,05 2,41 ± 1,03 A
Другие (%) 0,43 ± 0,16 1,44 ± 0. 80 0.21 ± 0.10 1.44 ± 0,92

2

0,19 ± 0,01 A

0,17 ± 0,05 A

166

3 2,41 ± 1,03 A A

1,81 ± 1,09 A A
Ctrl ABX LGG LGG PC
70169 37.79 ± 0,05 95.53 ± 2.00 A 9 166 96,86 ± 1,42 A

94,81 ± 2.15 94,81 ± 2.15 A
Бактерии (%) 60,74 ± 0,05 0,58 ± 0,23 A 2.29 ± 1,67 A 1,76 ± 0.17 A 5
0,93 ± 0,00166 0,93 ± 0,02 0,02 ± 0,02 A
Протебактерии (%) 0.10 ± 0,05 0,45 ± 0,36 B
Другие (%) 0. Таблица 3

96,86 ± 1,42 A A A A A

1,76 ± 0,17 A 0,19 ± 0,01 A A

0,17 ± 0,05 A A

2

0,45 ± 0,36 B B

Группа CTRL CTRL ABX LGG
37.79 ± 0,05 95,53 ± 2,00 A 94.81 ± 2.15 A 9015
Бактерии (%) 60,74 ± 0,05 0,58 ± 0,23 A
Verrucomicrobia (% ) 0,93 ± 0.50 0,02 ± 0,02 A
Протебактерии (%) 0,10 ± 0,05 2.41 ± 1.03 A 1,81 ± 1,09 A
Другие (%)
0,43 ± 0,16 1,44 ± 0,8016666 0,21 ± 0. 10 1.44 ± 0,92
90,74 ± 0,05

0,19 ± 0,01 A 0,45 ± 0.36 B B 1,81 ± 1,09 A
Группа Ctrl ABX ABX LGG PC
70177 37,79 ± 0,05 95,53 ± 2,00 A 96.86 ± 1.42 A 94.81 ± 2.15 A
5
60,74 ± 0,05 0,58 ± 0,23 A 2.29 ± 1,67 A 1.76 ± 0.17 A
Verrucomicrobia (%) 0,93 ± 0.50 0,02 ± 0,02 A 0,17 ± 0,05 A
Протебактерии (%) 0.10 ± 0,05 2,41 ± 1.03 A Другие (%)
0,43 ± 0,16 1. 44 ± 0,801666 0,41 ± 0.10 1,44 ± 0,92
Таблица 4.

Четыре основных характерных штамма на уровне типа каждой группы на четвертой неделе (n = 4/группа).

3 13.52 ± 7.47 A

12.16 ± 9.33 A

2

Группа CTRL ABX LGG LGG PC
Фирмы (%) 45.58 ± 2.75 63.39 ± 10.73 56.77 ± 14.27 56.96 ± 7,68
53.54 ± 2.67 22,56 ± 5.41 A 28.83 ± 11.10 A 30.54 ± 7.24 A
3.27 ± 1.27 13.99 ± 4.25 A Proteobacteria %) 0.19 ± 0.08 0.25 ± 0.12 0.13 ± 0,08 0,15 ± 0,076
Другие (%)
0. 37 ± 0.11 0,27 ± 0,08 0,27 ± 0.11 0,27 ± 0,07

28.83 ± 11.10 A A

30.54 ± 7.24 A 163 13.99 ± 4,25 A

12.16 ± 9.33 A A
Группа Ctrl ABX LGG PC PC
45.58 ± 2.75 63.39 ± 10.73 56.77 ± 14.27 56.96 ± 7,68
53.54 ± 2.67 22,56 ± 5.41 A
Verrucomicrobia (%) 3.27 ± 1,27 13.52 ± 7.47 A
Протебактерии (%) 0,19 ± 0,08 0.25 ± 0.12 0.13 ± 0,018 0,15 ± 0,07
Другие (%) 0.37 ± 0.11 0,27 ± 0,08 0,27 ± 0. 11 0,27 ± 0,07
Таблица 4.

четыре лучших характерных штамма на уровне типа каждой группы на четвертой неделе (n = 4/группа).

3 13.52 ± 7.47 A

12.16 ± 9.33 A

2

Группа CTRL ABX LGG LGG PC
Фирмы (%) 45.58 ± 2.75 63.39 ± 10.73 56.77 ± 14.27 56.96 ± 7,68
53.54 ± 2.67 22,56 ± 5.41 A 28.83 ± 11.10 A 30.54 ± 7.24 A
3.27 ± 1.27 13.99 ± 4.25 A Proteobacteria %) 0.19 ± 0.08 0.25 ± 0.12 0.13 ± 0,08 0,15 ± 0,076
Другие (%)
0.37 ± 0.11 0,27 ± 0,08 0,27 ± 0. 11 0,27 ± 0,07

28.83 ± 11.10 A A

30.54 ± 7.24 A 163 13.99 ± 4,25 A

12.16 ± 9.33 A A
Группа Ctrl ABX LGG PC PC
45.58 ± 2.75 63.39 ± 10.73 56.77 ± 14.27 56.96 ± 7,68
53.54 ± 2.67 22,56 ± 5.41 A
Verrucomicrobia (%) 3.27 ± 1,27 13.52 ± 7.47 A
Протебактерии (%) 0,19 ± 0,08 0.25 ± 0.12 0.12 0.13 ± 0,08 0,15 ± 0,07 9
Другие (%) 0.37 ± 0.11 0,27 ± 0,08 0,27 ± 0.11 0,27 ± 0,07

Тепловая карта показала, что применение антибиотиков приводит к значительному снижению численности различных микробов, а обработка пробиотиками приводит к увеличению численности Lactobacillus . Следует отметить, что на четвертой неделе в группах, получавших цефтриаксон, наблюдалась высокая численность Akkermansia (рис. 3).

В конце лечения антибиотиками характерными штаммами в группах Abx, LGG и Ctrl были Proteobacteria, Firmicutes и Bacteroidetes соответственно. Для группы PC характерным штаммом был штамм Enterococceae , особенно Enterococcus faecalis . На четвертой неделе характерный штамм в группе Abx изменился на Clostridia (рис. 4).

Рисунок 4.

Изменения структуры микробиоты кишечника мышей (n = 4/группа) (a) Размер эффекта LDA в разных группах в первую неделю.(b) Размер эффекта LDA в разных группах на четвертой неделе. Порог LDA равен 4. (c) Результат анализа главных координат в первую неделю. (г) Результат анализа главных координат на четвертой неделе. Анализ главных координат основан на показателе несходства Брея–Кертиса.

Рисунок 4.

Изменения структуры микробиоты кишечника мышей (n = 4/группа) (a) Размер эффекта LDA в разных группах в первую неделю. (b) Размер эффекта LDA в разных группах на четвертой неделе.Порог LDA равен 4. (c) Результат анализа главных координат в первую неделю. (г) Результат анализа главных координат на четвертой неделе. Анализ главных координат основан на показателе несходства Брея–Кертиса.

Согласно анализу главных координат (анализ PCoA) все группы были четко различимы в конце лечения антибиотиками. На четвертой неделе группа PC была больше похожа на группу LGG, но ось PC2 все еще могла отличить группу Abx от других (рис. 4).

Анализ Adonis, который был основан на индексе несходства Брея-Кертиса, показал, что состав микробного сообщества группы Ctrl значительно отличался от других групп, и это различие сохранялось до конца исследования. Хотя группы LGG и PC использовали разные пробиотики, разница между ними становилась все меньше (от R 2 = 0,6083 до R 2 = 0,3594) (табл. 5).

Таблица 5. Анализ

Adonis различных групп в первую и четвертую недели (n = 4/группа).

9175

3 P 0

P 0

3 Group

1 неделя 4 неделя
Group R 2 P R 2 P RATE
CTRL-LGG 0.7017 0.014 0.8619 0.034
Ctrl-Abx 0.9634 0.024 0.024 0.028 0.028
Ctrl-PC 0.9112 0,014 0,8343 0,031
LGG-Abx 0,6926 0,033 0,4200 0,018
LGG-ПК 0,6083 0,028 0,3594 0,029
ABX-PC 0.090 0.090 0.0927 0.026
1 неделя 4 неделя
R 2 P RATE R 2   Значение P
Ctrl-LGG 0. 7017 0,014 0,8619 0,034
Ctrl-Abx 0,9634 0,024 0,8188 0,028
Ctrl-PC 0,9112 0,014 0,8343 0,031
LGG-ABX 0.6926 0.033 0.033 0.04200 0.018
LGG-PC 0.083 0.028 0.3594 0.029 0.029
ABX-PC 0.090 0.090 0.090 0.026 0.026 0.026
Таблица 5.

Adonis Анализ различных групп в первой неделе и четвертой недели (N = 4 / Group) .

9175
1 неделя 4 неделя
Group R 2 P 0 P R 2 R 2 P Rate
Ctrl-LGG 0 . 7017 0,014 0,8619 0,034
Ctrl-Abx 0,9634 0,024 0,8188 0,028
Ctrl-PC 0,9112 0,014 0,8343 0,031
LGG-ABX 0.6926 0.033 0.033 0.04200 0.018
LGG-PC 0.083 0.028 0.3594 0.029 0.029
ABX-PC 0.090 0.090 0.026
1 неделя 4 неделя
Group R 2 p right R 2 P 0 P $
Ctrl-LGG 0,7017 0.014 0.014 0,8619 0.034
Ctrl-Abx 0,9634 0,024 0,8188 0,028
Ctrl-PC 0,9112 0,014 0,8343 0,031
LGG-Abx 0,6926 0. 033 0.4200 0.018 0.018
LGG-PC 0.083 0.028 0.029 0.029 0.029
ABX-PC 0.4060  0,090  0,3727  0,026 

Обсуждение

В Китае антибиотики широкого спектра действия, такие как цефтриаксон натрия, успешно применяются в клинической практике для защиты пациентов, в том числе младенцев и детей, от различных инфекций, вызываемых различными патогенными микробами, и в значительной степени способствуют их здоровью и благополучию [15]. Однако накопление научных данных, полученных в результате недавних клинических и экспериментальных исследований, показало, что антибиотики могут динамически изменять микробное сообщество в кишечнике животного-хозяина, характеризующееся дисбактериозом, убивающим как комменсальные, так и вредные микробы [16]. Это вызвало глубокую обеспокоенность в области общественного здравоохранения по поводу того, могут ли эти антибиотики ингибировать или влиять на рост в долгосрочной перспективе, даже после лечения антибиотиками [17].

В этом исследовании пероральное введение цефтриаксона привело к значительному снижению массы тела по сравнению с мышами в контрольной группе. Эти результаты хорошо согласуются с предыдущим исследованием, в котором воздействие антибиотиков также приводит к снижению веса, особенно воздействие антибиотиков на раннем этапе жизни [18].Однако результаты нашего настоящего исследования противоречат другим предыдущим исследованиям с различными антибиотиками, в которых использование антибиотиков даже в раннем возрасте не влияло на массу тела [9]. Например, одно исследование показало, что воздействие ванкомицина, пенициллина и ванкомицина + пенициллина не приводило к ожирению у мышей C57, но общая жировая масса была значительно выше в группе, получавшей антибиотики, по сравнению с контрольной группой [19]. Эти результаты свидетельствуют о том, что каждый антибиотик оказывает различное воздействие или включает разные механизмы роста животного-хозяина, на что также влияют дозировка, время воздействия, а также клиническое и физическое состояние животного-хозяина.Результаты нашего настоящего исследования показывают, что цефтриаксон может характерно снижать массу тела, что может быть одним из важных свойств этого антибиотика, по крайней мере частично.

В нашем настоящем исследовании наблюдалось небольшое уменьшение глубины крипт подвздошной кишки у мышей, подвергшихся воздействию цефтриаксона, по сравнению с таковыми у мышей в контрольной группе. Эти результаты могут указывать на то, что перорально вводимый цефтриаксон повреждает развивающиеся или зрелые эпителиальные клетки, как это наблюдалось в наших предыдущих исследованиях [20,21].Этот механизм может быть одним из факторов, связанных с цефтриаксоном, который ингибирует рост или увеличение веса у мышей, получавших цефтриаксон, потому что кишечный эпителий играет решающую роль в потреблении пищи и развитии местного иммунитета, а также является барьером против атак инфекционных агентов. патогенные и токсинообразующие агенты [22].

Напротив, у мышей, получавших цефтриаксон, которым вводили LGG или PC-170, потеря веса восстанавливалась быстрее, чем у мышей в группе, получавшей Abx.Кроме того, не наблюдалось существенных изменений глубины подвздошных крипт между ними и контрольной группой. LGG является одним из наиболее широко используемых пробиотических штаммов во всем мире, а благотворное влияние этой бактерии на здоровье было тщательно задокументировано в хорошо организованных клинических исследованиях и исследованиях на животных [23–25]. Одним из ключевых механизмов может быть то, что эта бактерия может активировать рецептор эпидермального фактора роста в эпителиальных клетках кишечника, тем самым защищая эпителий кишечника от повреждения и воспаления [26].Эти данные свидетельствуют о том, что ослабление LGG вызванного цефтриаксоном ингибирования роста может быть результатом пролиферации кишечных эпителиальных клеток, индуцированной LGG, по крайней мере, частично. ПК — это новый пробиотический штамм, первоначально выделенный из традиционных китайских ферментированных овощей. Предыдущие исследования показали, что PC-170(PC) может прикрепляться к эпителиальным клеткам и колонизировать кишечные тракты животных-хозяев, по крайней мере временно. Однако остается неясным, может ли PC-170 защищать животное-хозяина от повреждений, вызванных цефтриаксоном, таким же образом, как LGG в нашем настоящем исследовании, хотя наблюдались те же преимущества.

В этом исследовании применение цефтриаксона натрия не влияло на иммунитет мышей. Это может быть связано с тем, что мыши были здоровы и имели хорошо функционирующую иммунную систему, а краткосрочное лечение антибиотиками было недостаточным, чтобы ослабить их иммунный ответ. Однако мы наблюдали, что все провоспалительные цитокины (IL-6, IL-12 и TNF-α) у мышей в группах PC и LGG демонстрировали тенденцию к снижению, а противовоспалительный цитокин IL-10 показал тенденцию к снижению. противоположная тенденция. Подобно нашим результатам, предыдущее исследование показало, что LGG не увеличивает выработку IL-10, а вместо этого индуцирует субъединицу IL-10R2 рецептора IL-10 и снижает экспрессию провоспалительных цитокинов, регулируя опосредованную рецептором IL-10 экспрессию цитокинов. сигнализация [27].

Многие недавние исследования убедительно продемонстрировали, что микробиота кишечника может быть тесно связана с потреблением энергии и пищевым метаболизмом животного-хозяина с помощью различных механизмов, таких как влияние на уровень гормонов и индукция накопления висцерального жира [28]. В нашем настоящем исследовании пероральное введение цефтриаксона значительно уменьшило количество фекальной микробиоты во время вмешательства. Кроме того, лечение цефтриаксоном значительно уменьшило альфа-разнообразие фекальной микробиоты и динамически изменило фекальную микробиоту, в которой преобладали Firmicutes и сопровождалось большим количеством Proteobacteria , включая многие сильнодействующие патогенные микробы. Bacteroidetes , важный микроб для короткоцепочечных жирных кислот, почти исчез из фекалий мышей во время воздействия цефтриаксона. Эти результаты показали хорошее совпадение с данными, полученными в наших предыдущих исследованиях, в которых цефтриаксон значительно уменьшал количество фекальной микробиоты, но характерно увеличивал альфа-разнообразие с более чем Firmicutes и Proteobacteria [29].

В конце исследования фекальная микробиота мышей, получавших цефтриаксон, была количественно восстановлена, а альфа-разнообразие значительно увеличилось по сравнению с контрольной группой.Однако состав фекальных микробов не стал и не восстановился таким же, как у мышей в контрольной группе. В фекальной микробиоте мышей, подвергшихся воздействию цефтриаксона в первую неделю, было больше Firmicutes и меньше Bacteroidetes , сопровождаемых Proteobacteria и Verrucomicrobia . Относительная численность Clostridium значительно увеличилась в группе Abx на четвертой неделе. Аналогичное исследование показало, что лечение антибиотиками вызывает изменения уровней вторичных желчных кислот, глюкозы и свободных жирных кислот и способствует прорастанию и росту Clostridium [30].Кроме того, лечение антибиотиками может увеличить оксигенацию эпителия в толстой кишке и нарушить анаэробную среду кишечника, что приведет к более высокой относительной численности Proteobacteria [31]. Кроме того, у пациентов с диабетом или ожирением часто наблюдается более высокая численность Proteobacteria . Обычно считается, что высокая относительная численность Proteobacteria не полезна для здоровья человека [32,33]. Поэтому спонтанное постантибиотиковое выздоровление может не принести пользы здоровью человека.Напротив, было показано, что лечение пробиотиками восстанавливает микробное сообщество другими способами, и это сообщество, индуцированное пробиотиками, проявляет штаммоспецифичность и может принести пользу здоровью человека [34,35]. Результаты нашего исследования хорошо продемонстрировали результаты предыдущего исследования, в котором антибиотики, такие как цефтриаксон, количественно изменяли кишечную микробиоту, и эта аномальная кишечная микробиота не восстанавливалась до прежнего уровня даже после вмешательства. Эти результаты свидетельствуют о том, что антибиотики, особенно антибиотики широкого спектра действия, такие как цефтриаксон, могут оказывать долгосрочное воздействие на кишечную микробиоту хозяина.

В нашем настоящем исследовании LGG и PC частично изменили индуцированное цефтриаксоном снижение альфа-разнообразия фекальной микробиоты, что определялось индексом разнообразия Симпсона, и состав фекальных микробов в зависимости от штамма, что считалось могут быть связаны с различными заболеваниями [36]. LGG был выделен от здорового человека, а PC-170 — из солений. Это объясняет различия, представленные на диаграмме Венна между группами LGG и PC-170 в первую неделю.Между тем LGG и PC-170 обогатили состав Lactobacillus и Enterococcus соответственно, что позволяет предположить, что механизм восстановления структуры фекальной микробиоты, вызванный пробиотиками, выделенными из животных и растений, может различаться. Неожиданно на третьей неделе количественное определение фекальной микробиоты как в группе LGG, так и в группе PC было все еще значительно меньше, чем в группе Ctrl, и даже меньше, чем в группе Abx. Затем, на четвертой неделе, количественное определение фекальной микробиоты в группах, которым вводили пробиотики, было все еще значительно меньше, чем в группе, получавшей Abx.Это может быть связано с различиями в микробном сообществе, поскольку анализ PCoA показал, что микробное сообщество группы Abx отличалось от других групп на четвертой неделе. Таким образом, пробиотики могут не способствовать восстановлению количественного определения фекальной микробиоты, но необходимы дальнейшие исследования, чтобы подтвердить, полезно ли микробное сообщество спонтанного постантибиотического восстановления для здоровья хозяина.

В частности, было показано, что Akkermansia обладает способностью модулировать основной метаболизм и приносить пользу пациентам с диабетом [37,38].В нашем исследовании все мыши имели низкую численность Akkermansia в конце первой недели. Однако, как и в другом исследовании, мыши, получавшие антибиотик (группы Abx, LGG и PC), показали высокую относительную численность Akkermansia на четвертой неделе [39]. Кроме того, клиническое испытание с использованием Bifidobacterium для обеспечения защитного действия против ожирения показало, что у участников был высокий уровень Akkermansia , что было предложено в качестве возможного задействованного механизма [40].Таким образом, увеличение относительной численности Akkermansia может быть одним из характерных аспектов спонтанного восстановления микробиоты кишечника после лечения антибиотиками. Таким образом, необходимы дальнейшие исследования, чтобы объяснить, может ли такое увеличение Akkermansia после лечения антибиотиками способствовать здоровью человека, хотя Akkermansia был рекомендован в качестве идеального кандидата для следующего поколения пробиотиков.

В заключение, результаты нашего настоящего исследования показывают, что антибиотики, такие как цефтриаксон, могут значительно изменять кишечную микробиоту, нарушая гомеостаз эпителиальных клеток, что, следовательно, характерно влияет на рост животного-хозяина с задержкой набора веса. Лактобациллы, особенно некоторые штаммы, такие как LGG и PC, могут смягчать такие побочные эффекты антибиотиков, стабилизируя и стимулируя пролиферацию кишечной микробиоты.

Благодарности

Эта работа была поддержана Национальным фондом естественных наук Китая (номер гранта 81372982) и Сычуаньской программой поддержки науки и технологий (2016NZ0007). Спасибо Enago (http://www.enago.jp) за обзор на английском языке. Благодаря компании Beijing Novogene Co., Ltd. за помощь в биоинформатическом анализе. В то же время мы также благодарим за поддержку Провинциальный экспериментальный учебный центр общественного здравоохранения и профилактической медицины при Сычуаньском университете и Ключевую лабораторию мониторинга безопасности пищевых продуктов и оценки рисков провинции Сычуань.

Вклад авторов

Fang He, Ming Li, Gong Chen и ZhongHua Miao участвовали в разработке этого исследования. ЧжунХуа Мяо, ЖуЮэ Ченг, ХуэйЦзин Лян, ФэнЛин Цзян и Юцзе Чжан провели эксперимент.Си Шэнь, ЦиШэн Чжан и ЧжунХуа Мяо проанализировали экспериментальные данные. Фан Хэ, Си Шэнь и Чжун Хуа Мяо отредактировали рукопись.

Заявление о раскрытии информации

Авторы не сообщали о потенциальном конфликте интересов.

Ссылки

Qin

 

JJ

,

Li

 

RQ

,

Raes

 

J

, и др.

Каталог микробных генов кишечника человека, составленный с помощью метагеномного секвенирования

.

Природа

.

2010

 

март

 

04

;

464

(

7285

):. .

Змора

 

N

,

Суэц

 

J

,

Элинав

 

E

 

Вы то, что вы едите: диета, здоровье и микробиота кишечника 3.

микробиота кишечника

Nat Rev Гастроэнтерол Гепатол

.

2019

 

Январь

;

16

(

1

):

35

56

. .

Тернбо

PJ

,

Хамади

М

,

Яцуненко

Т

и др.

Основной микробиом кишечника у тучных и худых близнецов

.

Природа

.

2009

 

Январь

 

22

;

457

(

7228

):. .

Yilmaz

B

,

Juillerat

P

,

Oyas

O

и др.

Исправление издателя: нарушения микробной сети при рецидивирующей рефрактерной болезни Крона

.

Nat Med

.

2019

 

Апрель

;

25

(

4

):

701

..

Frohlich

 

EE

,

Farzi

 

A

,

Mayerhofer

 

R

и др.

Когнитивные нарушения вследствие дисбиоза кишечника, вызванного антибиотиками: анализ связи кишечной микробиоты с мозгом

.

Мозг Поведение Иммун

.

2016

 

Август

;

56

:

140

155

. .

Scott

 

NA

,

Andrusaite

 

A

,

Andersen

 

P

, et al.

Антибиотики вызывают устойчивую дисрегуляцию Т-клеточного иммунитета кишечника, нарушая гомеостаз макрофагов

.

Sci Transl Med

.

2018

 

окт

 

24

;

10

(

464

):. .

Корпела

К

,

Зейлманс

МАК

,

Куйтунен

М

и др.

ИМТ в детском возрасте по отношению к микробиоте в младенчестве и применении антибиотиков на протяжении всей жизни

.

Микробиом

.

2017

 

март

 

03

;

5

:. .

Саари

 

А

,

Вирта

 

LJ

,

Санкилампи

 

U

и др.

Воздействие антибиотиков в младенчестве и риск избыточного веса в первые 24 месяца жизни

.

Педиатрия

.

2015

 

Апрель

;

135

(

4

):

617

626

. .

Gerber

 

JS

,

Bryan

 

M

,

Ross

 

RK

, и др.

Воздействие антибиотиков в течение первых 6 месяцев жизни и увеличение массы тела в детстве

.

Jama-J Am Med Assoc

.

2016

 

март

 

22

;

315

(

12

):

1258

1265

. .

Johnston

BC

,

Goldenberg

JZ

,

Parkin

PC

Пробиотики и профилактика антибиотикоассоциированной диареи у детей 9.00

Jama-J Am Med Assoc

.

2016

 

окт

 

11

;

316

(

14

):

1484

1485

. .

Азад

 

МА

,

Саркер

 

М

,

Ван

 

Д

.

Иммуномодулирующее действие пробиотиков на цитокиновый профиль

.

Биомед Рез Инт

.

2018

;. . DOI:

Yadav

H

,

Lee

JH

,

Lloyd

J

, et al.

Благотворное метаболическое действие пробиотика за счет индуцированной бутиратом секреции гормона GLP-1

.

J Биол Хим

.

2013

 

Август

 

30

;

288

(

35

):

25088

25097

. .

Ким

 

YA

,

Кио

 

JB

,

Клифтон

 

PM

.

Пробиотики, пребиотики, синбиотики и чувствительность к инсулину

.

Nutr Res Rev

.

2018

 

июнь

;

31

(

1

):

35

51

. .

Cheng

 

RY

,

Li

 

M

,

Li

 

SS

, и др.

Ванкомицин и цефтриаксон могут повреждать микробиоту кишечника и в разной степени влиять на развитие кишечного тракта и иммунной системы у новорожденных мышей

.

Патог Дис

.

2017

 

Ноябрь

;

75

(

8

):

АРТН ftx104

..

Zhao

 

HY

,

Bian

 

JM

,

Zhuo

 

L

, et al.

Antibiotic use in emergency departments of class general hospitals in China

.

Zhonghua Liu Xing Bing Xue Za Zhi

.

2018

 

Jul

 

10

;

39

(

7

):

959

965

. .

Haak

 

BW

,

Lankelma

 

JM

,

Hugenholtz

 

F

, et al.

Длительное воздействие перорального приема ванкомицина, ципрофлоксацина и метронидазола на микробиоту кишечника у здоровых людей

.

J Антимикроб Chemoth

.

2019

 

март

;

74

(

3

):

782

786

. .

Го

 

YJ

,

Ян

 

XF

,

Ци

 

Y

, и др.

Длительное применение цефтриаксона натрия вызывает изменения микробиоты кишечника и иммунной системы

.

Научный представитель Великобритании

.

2017

 

Февраль

 

21

;

7

:

1

9

. . .

Trasande

 

L

,

Blustein

 

J

,

Liu

 

M

, и др.

Воздействие антибиотиков на младенцев и масса тела в раннем возрасте

.

Int J Ожирение

.

2013

 

Январь

;

37

(

1

):

16

23

. .

Чо

 

I

,

Яманиши

 

S

,

Кокс

 

L

, и др.

Антибиотики в раннем возрасте изменяют микробиом толстой кишки мышей и вызывают ожирение

.

Природа

.

2012

 

Август

 

30

;

488

(

7413

):621-+. .

Ченг

 

RY

,

Яо

 

JR

,

Ван

 

Q

и др.

Пероральное введение бифидобактерий bifidum TMC3115 новорожденным мышам может снизить риск IgE-опосредованной аллергии во взрослом возрасте

.

Бенеф Микробс

.

2018

;

9

(

5

):

815

828

. .

Wan

 

Q

,

Cheng

 

RY

,

Guo

 

JW

, et al.

Effect of ceftriaxone on the intestinal epithelium and microbiota in neonatal mice

.

Zhongguo Dang Dai Er Ke Za Zhi

.

2018

 

Apr

;

20

(

4

):

318

325

. .

Lu

 

JT

,

Xu

 

AT

,

Shen

 

J

, et al.

Перекрестные помехи между клетками эпителия кишечника и клетками адаптивной иммунной системы при иммунитете слизистой оболочки кишечника

.

J Гастроэнтерол Гепатол

.

2017

 

Май

;

32

(

5

):

975

980

. .

Шаевска

 

H

,

Хорват

 

А

.

Lactobacillus rhamnosus GG в первичной профилактике экземы у детей: систематический обзор и метаанализ

.

Питательные вещества

.

2018

 

Сентябрь

;

10

(

9

):

АРТН 1319

. .

Блобьерг

 

S

,

Арци

 

DM

,

Аабенхус

 

R

.

Пробиотики для профилактики антибиотикоассоциированной диареи у амбулаторных больных. Систематический обзор и метаанализ

.

Антибиотики-Базель

.

2017

 

Декабрь

;

6

(

4

):

АРТН 21

. .

Harb

 

H

,

van Tol

 

EAF

,

Heine

 

H

, и др.

Добавка обработанного супернатанта Lactobacillus rhamnosus GG для новорожденных уменьшает аллергическое воспаление дыхательных путей у мышей в более позднем возрасте

.

Клин Экспер Иммунол

.

2013

 

март

;

43

(

3

):

353

364

. .

Shen

 

X

,

Liu

 

LP

,

Peek

 

RM

, и др.

Добавление р40, белка, полученного из Lactobacillus rhamnosus GG, в раннем возрасте способствует развитию кишечника, зависящему от рецептора эпидермального фактора роста, и долгосрочным результатам для здоровья

.

Иммунол слизистых оболочек

.

2018

 

Сентябрь

;

11

(

5

):

1316

1328

. .

Мирпури

J

,

Сотников

I

,

Майерс

L

и др.

Lactobacillus rhamnosus (LGG) регулирует передачу сигналов IL-10 в развивающейся толстой кишке мышей посредством активации субъединицы рецептора IL-10R2

.

Плос Один

.

2012

 

декабрь

 

18

;

7

(

12

): .. DOI

Cox

LM

,

Yamanishi

S

,

Sohn

J

и др.

Изменение кишечной микробиоты во время критического окна развития имеет длительные метаболические последствия

.

Сотовый

.

2014

 

Август

 

14

;

158

(

4

):

705

721

. .

Cheng

 

RY

,

Guo

 

JW

,

Pu

 

FF

, и др.

Введение цефтриаксона, ванкомицина и бифидобактерий bifidum TMC3115 новорожденным мышам может по-разному влиять на кишечную микробиоту и иммунитет во взрослом возрасте

.

Научный представитель Великобритании

.

2019

 

март

 

01

;

9

:. .

Theriot

CM

,

Koenigsknecht

MJ

,

Carlson

PE

и др.

Индуцированные антибиотиками сдвиги в микробиоме и метаболоме кишечника мыши повышают восприимчивость к инфекции Clostridium difficile

.

Нац Коммуна

.

2014

 

Январь

;

5

:. .

Литвак

 

Y

,

Байндлосс

MX

,

Цолис

 

RM

, и др.

Экспансия дисбиотических протеобактерий: микробный признак эпителиальной дисфункции

.

Curr Opin Microbiol

.

2017

 

Октябрь

;

39

:

1

6

. .

Шин

 

NR

,

Whon

 

TW

,

Bae

 

JW

.

Протеобактерии: микробные признаки дисбактериоза в кишечной микробиоте

.

Тенденции Биотехнологии

.

2015

 

Сентябрь

;

33

(

9

):

496

503

. .

Zhu

 

L

,

Baker

 

SS

,

Gill

 

C

, et al.

Характеристика кишечных микробиомов у пациентов с неалкогольным стеатогепатитом (НАСГ): связь между эндогенным алкоголем и НАСГ

.

Гепатология

.

2013

 

Февраль

;

57

(

2

):

601

609

. .

Ван

 

J

,

Тан

 

H

,

Чжан

 

C

, и др.

Модуляция микробиоты кишечника во время опосредованного пробиотиками ослабления метаболического синдрома у мышей, получавших диету с высоким содержанием жиров

.

Исме Дж

.

2015

 

Январь

;

9

(

1

):

1

15

..

Сюэ

 

L

,

He

 

J

,

Гао

 

N

, и др.

Пробиотики могут задерживать прогрессирование неалкогольной жировой болезни печени за счет восстановления структуры кишечной микробиоты и улучшения кишечной эндотоксемии

.

Научный представитель

.

2017

 

март

 

28

;

7

:

45176

. .

Kriss

 

M

,

Hazleton

 

KZ

,

Nusbacher

 

NM

, и др.

Дисбиоз кишечной микробиоты с низким разнообразием: факторы, функциональные последствия и восстановление

.

Curr Opin Microbiol

.

2018

 

Август

;

44

:

34

40

. .

Дерриен

 

M

,

Van Baarlen

 

P

,

Hooiveld

 

G

, и др.

Модуляция иммунного ответа слизистой оболочки, толерантности и пролиферации у мышей, колонизированных аккермансией muciniphila, разрушающей муцин

.

Фронт Микробиол

.

2011

;

2

:

166

. .

Чжан

 

L

,

Цинь

 

Q

,

Лю

 

M

, и др.

Akkermansia muciniphila может уменьшать ущерб от глюко/липотоксичности, окислительного стресса и воспаления, а также нормализовать микробиоту кишечника у крыс с диабетом, вызванным стрептозотоцином

.

Патог Дис

.

2018

 

июнь

 

01

;

76

(

4

).. DOI:

Hansen

CH

,

Крич

L

,

Nielsen

DS

, et al.

Лечение ванкомицином в раннем возрасте способствует размножению Akkermansia muciniphila и снижает заболеваемость диабетом у мышей NOD

.

Диабетология

.

2012

 

Август

;

55

(

8

):

2285

2294

. .

Pedret

 

A

,

Valls

 

RM

,

Calderon-Perez

 

L

, et al.

Последствия ежедневного потребления пробиотика Bifidobacterium animalis subsp. lactis CECT 8145 по антропометрическим биомаркерам ожирения у субъектов с абдоминальным ожирением: рандомизированное контролируемое исследование

.

Int J Obes (Лондон)

.

2018

 

Сентябрь

 

27

. . DOI:

© 2020 Японское общество биологических наук, биотехнологии и агрохимии

Антибиотики для похудения | Livestrong.com

Антибиотики являются одними из наиболее часто назначаемых лекарств во всем мире и обладают многочисленными побочными эффектами, часто включая потерю веса.

Изображение предоставлено Джоном Фоксом/Stockbyte/Getty Images

Антибиотики – это препараты, которые назначаются для устранения патогенных или болезнетворных бактерий из организма. Их можно давать разными способами, но за пределами больницы их почти всегда принимают перорально. Хотя эти лекарства никогда не назначаются для снижения веса, они могут привести к временной потере веса из-за воздействия, которое они оказывают на желудочно-кишечный тракт и другие части тела.

Ряд антибиотиков, включая антибиотики класса «-циллин», но не ограничиваясь ими, могут в процессе искоренения вредоносных микробов нарушать баланс нормальных или «хороших» бактерий в кишечнике и в другом месте.Поскольку эта нормальная флора помогает поддерживать гомеостаз или нормальное, ненарушенное состояние в желудочно-кишечном тракте за счет своего воздействия на кислотно-щелочной баланс и другие микроорганизмы, нарушения в этих колониях могут привести к тошноте, рвоте, диарее и другим эффектам. Поскольку эти симптомы снижают аппетит и приводят к потере воды, люди, которые их испытывают, часто очень быстро теряют вес. Следует отметить тот факт, что сами по себе различные инфекционные заболевания характеризуются обезвоживанием и потерей аппетита в качестве симптомов; это, в сочетании с повышенной скоростью метаболизма, связанной с иммунным ответом организма на вторжение, может привести к потере веса независимо от каких-либо эффектов, вызванных антибиотиками.

Хотя потеря веса является частым краткосрочным побочным эффектом применения антибиотиков, исследования, проведенные еще в середине 20-го века, показывают, что в долгосрочной перспективе может наблюдаться противоположный эффект. Доктор Томас Хейт заявил в январском выпуске «Journal of Nutrition» за 1955 год, что антибиотики, вводимые новобранцам в течение семи недель, привели к статистически значимому увеличению веса. Как сообщалось в выпуске журнала «Time» за 2010 год, некоторые нормальные бактерии в кишечнике играют важную роль в том, как съеденный жир откладывается в организме, и что разрушение этих бактериальных колоний в результате применения антибиотиков может способствовать увеличению накопления жира в организме. люди и, следовательно, увеличение веса с течением времени.

Через каскад физиологических явлений применение антибиотиков может оказывать влияние на гормоны, участвующие в запасании топлива. Гавайский врач Кэролайн Дин, практикующая как традиционную, так и натуропатическую медицину, утверждает, что антибиотики могут вызывать чрезмерный рост нормальных дрожжей; в своих обычных количествах они не вызывают проблем, но когда их количество резко возрастает, они могут просачиваться в ткани, в которых обычно не обнаруживаются, и приводить к увеличению веса как за счет стимуляции аппетита, так и за счет нарушения функции щитовидной железы. Кроме того, в мартовском выпуске «Всемирного журнала гастроэнтерологии» за 2011 г. отмечается, что за счет уменьшения количества бактерий H. pylori, присутствующих в желудке, повышается активность депонирующего гормона грелина, что может привести к увеличению веса.

детей, которые принимают антибиотики, набирают вес быстрее, чем дети, которые этого не делают

Согласно новому исследованию Школы общественного здравоохранения Блумберга при Университете Джона Хопкинса, дети, получавшие антибиотики в детстве, набирали вес значительно быстрее, чем те, кто этого не делал.

Результаты, опубликованные в Интернете 21 октября в International Journal of Obesity , предполагают, что антибиотики могут оказывать усугубляющее влияние на индекс массы тела (ИМТ) в детстве, показатель, часто используемый для определения здорового веса человека. .

«Ваш ИМТ может навсегда измениться из-за антибиотиков, которые вы принимаете в детстве», — говорит руководитель исследования Брайан С. Шварц, доктор медицины, магистр наук, профессор кафедры наук о гигиене окружающей среды в школе Блумберга.«Наши данные показывают, что каждый раз, когда мы даем антибиотик детям, они со временем быстрее набирают вес».

В ходе исследования Шварц и его коллеги проанализировали электронные медицинские карты Geisinger Health System 163 820 детей в возрасте от трех до 18 лет с января 2001 г. по февраль 2012 г. Они изучили массу тела и рост (которые используются для определения ИМТ) и использование антибиотиков. в предыдущем году, а также в любые более ранние годы, за которые у Гейзингера были записи о детях.

В возрасте 15 лет дети, которые принимали антибиотики семь или более раз в детстве, весили примерно на три фунта больше, чем те, кто не получал антибиотики.Приблизительно 21% детей, участвовавших в исследовании, или почти 30 000 детей, в детстве получали семь или более рецептов. Шварц говорит, что прибавка в весе среди тех часто назначаемых антибиотиков, вероятно, занижена, поскольку дети не оставались с Гайзингером в детстве, поэтому их пожизненный анамнез антибиотиков, включая использование антибиотиков вне системы здравоохранения, не был бы зарегистрирован, и потому что эффект некоторых типов антибиотиков было даже сильнее, чем в среднем .

«Хотя величина увеличения веса, связанного с антибиотиками, может быть скромной к концу детства, наш вывод о том, что эффекты являются кумулятивными, повышает вероятность того, что эти эффекты сохраняются и усугубляются во взрослом возрасте», — говорит он.

Ученые, работающие с пенициллином, рано узнали, что его побочные продукты вызывают увеличение веса у животных. Это привело к современным методам промышленного земледелия, включающим небольшие количества антибиотиков в ежедневный корм для животных, чтобы откармливать животных в ускоренные сроки.Таким образом, связь с увеличением веса имеет биологический смысл, говорит Шварц.

В то же время появляется все больше свидетельств того, что антибиотики могут привести к увеличению веса у людей из-за воздействия, которое они оказывают на так называемую микробиоту или микроорганизмы, населяющие организм. Бактериальных клеток в организме человека в 10 раз больше, чем наших собственных клеток. Многие из этих бактерий выполняют свою работу в желудочно-кишечном тракте, помогая организму переваривать пищу и усваивать питательные вещества. Антибиотики убивают не только вредные бактерии, но и жизненно важные для здоровья желудочно-кишечного тракта.Исследования показали, что повторное использование антибиотиков может навсегда изменить микробиоту, изменив то, как она расщепляет пищу, и увеличив количество поглощаемых калорий. Это, в свою очередь, может увеличить прибавку в весе.

Предыдущие исследования предполагали, что использование у самых маленьких детей может вызвать увеличение веса, но это исследование показывает, что использование в любом возрасте в детстве способствует увеличению веса, которое ускоряется с возрастом.

Шварц считает, что врачи стали более осмотрительны в назначении антибиотиков, но это может быть трудной задачей.Часто родители требуют антибиотиков от очевидных вирусов простуды и других заболеваний, от которых они не помогут. Уже давно существуют опасения, что чрезмерное использование антибиотиков приводит к появлению бактериальных штаммов, которые становятся устойчивыми к этим потенциально спасающим жизнь лекарствам. Но это исследование предполагает, что антибиотики могут иметь долгосрочные последствия для отдельных детей, говорит он.

«Следует избегать системных антибиотиков, за исключением случаев, когда это строго показано», — говорит Шварц. «Из всего, что мы узнаем, для врачей как никогда важно быть привратниками и не позволять своим маленьким пациентам получать лекарства, которые не только не помогут им, но могут нанести им вред в долгосрочной перспективе.

«Использование антибиотиков и траектория индекса массы тела в детском возрасте» написана Брайаном С. Шварцем, доктором медицины, магистром медицины; Джонатан Поллак, член парламента; Лиза Бейли-Дэвид, DEd, RD; Аннемари Хирш, доктор философии, магистр здравоохранения; Сара Косгроув, доктор медицины, магистр медицины; Клаудия Нау, доктор философии; Амии М. Кресс, доктор философии, магистр здравоохранения; Томас А. Гласс, доктор философии; и Карен Бандин-Рош, доктор философии.

Исследование было поддержано грантом Национального института детского здоровья и развития Юнис Кеннеди Шрайвер Национального института здравоохранения (U54 HD-070725) и Глобального центра профилактики ожирения Школы общественного здравоохранения Блумберга имени Джона Хопкинса.

# # #

Контакты для СМИ Школы общественного здравоохранения Блумберга Джона Хопкинса: Стефани Десмон, тел. 410-955-7619, или [email protected], и Барбара Бенхэм, тел.

Набрал вес после антибиотиков? Сделайте эти 4 вещи

Приблизительное время прочтения: 6-7 минут.

Джессика набрала 23 фунта за три месяца после курса антибиотиков. Ее врач сказал ей, что антибиотики не имеют ничего общего с ее увеличением веса, и посоветовал ей больше заниматься спортом.Она сделала. Но, несмотря на то, что каждую неделю она проводила часы в тренажерном зале и пробовала все популярные диеты, за следующие четыре года она набрала еще 35 фунтов.

По словам доктора Уита Робертса из Health Utah, история Джессики довольно обычная. «Люди не только иногда набирают вес после приема антибиотиков, как это сделала Джессика, они часто видят начало других проблем со здоровьем, таких как дрожжевые инфекции и многие другие». Он говорит, что часто люди видят депрессию, частые болезни, СРК и множество других тревожных симптомов.

Антибиотики и увеличение веса

Удивительно, но ученые уже более 70 лет знают, что антибиотики вызывают увеличение веса. На самом деле, согласно статье в New York Times, в 1955 году фармацевтическая компания Pfizer спонсировала соревнование среди своих продавцов кормов для животных, чтобы выяснить, кто из них сможет набрать больше веса. После употребления пищи с добавлением антибиотиков эти мужчины встали на весы перед толпой в бальном зале отеля. Точка? Чтобы доказать, что антибиотики могут откармливать мужчин так же, как крупный рогатый скот и свиней.

Доказательства того, что антибиотики вызывают увеличение веса, исходят не только из историй. Сотни исследований показывают одно и то же. Например, исследование, опубликованное в 2018 году, объединило более 12 различных исследований с участием более 500 000 детей, показавших, что дети, принимавшие антибиотики в младенчестве, чаще имели избыточный вес. Более недавнее исследование, опубликованное в Nature Reviews Endocrinology, показывает, что это увеличение веса продолжается и во взрослом возрасте.

Фото: Soleil Nordic/Shutterstock.ком

Почему это происходит?

Существует множество причин, по которым антибиотики вызывают увеличение веса. Следующие два, пожалуй, наиболее понятны. Первая большая проблема заключается в том, что антибиотики изменяют состав и разнообразие бактерий в кишечнике. При этом погибают некоторые бактерии-хищники. Без этих хищников плохие бактерии могут расти без конкуренции, говорится в статье, опубликованной в eLife Sciences.

Робертс сравнивает это с проблемой японского жука в США.Он был импортирован из Японии, где у него есть естественный хищник. Однако в США этого хищника не существует, и жук размножается без конкуренции, что угрожает американским урожаям.

Когда определенные вредные бактерии размножаются в кишечнике без конкуренции, это приводит к увеличению веса, потому что некоторые вредные бактерии превращают больше пищи в сахар, чем полезные бактерии, нарушая хрупкий баланс кишечной экосистемы. Это означает, что два человека могут есть одно и то же, и только тот, у кого плохие бактерии, наберет вес, говорится в статье, опубликованной в Американском журнале клинического питания.

Вторая большая проблема заключается в том, что антибиотики могут повредить центры производства энергии клетки: митохондрии. Пациенты иногда обращаются в Health Utah, думая, что, поскольку они все еще чувствуют себя усталыми и слабыми, они никогда не вылечат инфекцию, которую должны были убить антибиотики.

Робертс объясняет, что эти затянувшиеся симптомы на самом деле могут быть вызваны антибиотиком, а не инфекцией. С меньшим количеством энергии они чувствуют себя более усталыми, подавленными, тревожными и набирают вес.

Фото: Дин Дробот/Shutterstock.com

Вы набрали вес после антибиотиков — что теперь делать?

Обречены ли люди, набравшие вес после приема антибиотиков, оставаться с избыточным весом? «Нет, но путь к похудению может быть немного длиннее и тернистее», — говорит Робертс. «Есть шаги, которые, если их предпринять, могут помочь вам оправиться от повреждений, вызванных антибиотиками.

Имея 27-летний опыт работы в области здравоохранения и снижения веса, Робертс говорит: «Самый важный инструмент, который у нас есть, чтобы положительно повлиять на наш микробиом, — это ешьте правильную пищу. »

К сожалению, фаст-фуд, приготовленные в микроволновке обеды, газированные напитки и другие продукты нашей типичной американской диеты не считаются правильной едой. На самом деле, употребление типичной диеты питает не те бактерии и может привести к ожирению, а также ко многим другим заболеваниям. Другие метаболические заболевания, отмечается в обзоре, опубликованном в Gut Microbes

Сотни исследований и многовековая история человечества побудили Робертса и его команду тренеров по здоровью и снижению веса рекомендовать продукты со значительными противовоспалительными и антиоксидантными свойствами.«Если вы в основном едите эти продукты, — говорит доктор Робертс, — вам не нужно тщательно подсчитывать калории или взвешивать пищу. Когда вы едите правильную пищу, вы оздоравливаете свой кишечник, способствуете развитию полезных бактерий и теряете вес. Проблема решена».

Если за годы произошло слишком много повреждений кишечника и его микробиома, одной пищи может быть недостаточно для быстрого восстановления и снижения веса. Было показано, что в таких случаях очень специфические добавки, включая определенные волокна и сахара, ускоряют рост определенных полезных бактерий.Какие именно добавки вам нужны, определяется специальным тестированием, проводимым в Health Utah перед каждой консультацией с Roberts.

Третьим приоритетом является снижение общего содержания токсинов в организме. Обилие неправильных бактерий может привести к накоплению токсинов в организме, говорится в статье, опубликованной в Integrative Medicine: A Clinician’s Journal.

В литературе очень четко указано, что химическое воздействие и остаточные токсические вещества в организме могут привести к ожирению, согласно статье доктора.Марк Хайман, доктор медицины. В результате третьим инструментом в арсенале Health Utah стала оценка токсической нагрузки организма и его способности эффективно расщеплять токсины. Затем назначить соответствующие методы дезинтоксикации. Они могут включать терапевтические методы, а также добавки для активизации фазы I и фазы II детоксикации печени.

Наконец, всем известно, что упражнения являются важным компонентом любой программы по снижению веса. Чего они могут не знать, так это того, что одним из способов, с помощью которых физические упражнения ускоряют потерю веса, является увеличение разнообразия микробиома или улучшение баланса хороших и плохих бактерий в кишечнике, сообщается в исследовании 2014 года.

Робертс объясняет, что упрямый вес может быть вызван гораздо большим разнообразием условий, выходящих за рамки этой статьи. Они могут включать бессонницу, инфекцию, аллергию, гормональный дисбаланс, кандидозу, эмоциональные проблемы, дисфункцию печени и желчного пузыря и многое другое.

Робертс и его сотрудники выявляют эти основные причины упрямого веса путем тщательного изучения истории болезни пациента и проведения лабораторных анализов. «Тестирование и выслушивание пациента являются ключом к обнаружению потенциальных основных проблем, которые так затрудняют ваши усилия по снижению веса», — говорит Робертс. После выявления назначается индивидуальный протокол похудения.

Консультации Health Utah включают тестирование в тот же день. Позвоните по номеру 801-810-CARE (2273) или посетите Health Utah сегодня, чтобы записаться на консультацию по снижению веса и познакомиться с уникальным методом похудения с Roberts.

Если ваша вторая половинка также хотела бы получить консультацию, упомяните об этой статье, и вы сможете записаться на вторую встречу без дополнительных затрат. Это представляет собой экономию в размере 59 долларов.

×

Другие истории, которые могут вас заинтересовать

Является ли история Эммы доказательством того, что антибиотики могут набрать вес?

С 20 лет визажист Эмма Джонсон нуждалась в повторных курсах антибиотиков, чтобы помочь с рецидивирующими и болезненными инфекциями мочевыводящих путей (ИМП).

Однако, хотя антибиотики, прописанные ее лечащим врачом, были эффективны для борьбы с инфекциями, Эмма считает, что у них был нежелательный побочный эффект: увеличение веса.

Эмма, которой сейчас 38 лет, считает, что антибиотики, которые она принимала в течение семи дней, десять раз в год в течение примерно 18 лет, стали причиной резкого увеличения ее веса с 9-го до 12-го, то есть с 10-го размера в 20 лет до Сегодня 16 размер.

Она говорит, что обычно ела три раза в день, не перекусывая, но когда прошла курс антибиотиков, она обнаружила, что постоянно голодает, с непреодолимым, грызущим голодом, которому ей трудно сопротивляться.

Эмма, которой сейчас 38 лет, считает, что антибиотики, которые она принимала в течение семи дней, десять раз в год в течение примерно 18 лет, стали причиной увеличения ее веса с 9 до 12

«Антибиотики всегда действовали быстро и помогали мне облегчение, но я заметил побочный эффект отчаянного голода. Я не могла перестать есть», — говорит Эмма, мать одного из Дартфорда, Кент.

И этому есть доказательства. Одно исследование на животных, проведенное в 2017 году Институтом Лиггинса при Оклендском университете, Новая Зеландия, показало, что более широкое использование антибиотиков повышает риск ожирения, а также влияет на иммунную систему организма или вызывает рецидивирующую диарею.

Между тем, согласно исследованию, проведенному в журнале Gut в 2018 году, дети младшего возраста, которые регулярно принимают антибиотики, подвергаются более высокому риску ожирения, чем те, кто принимает меньше лекарств.

Семилетнее исследование, в котором приняли участие 333 000 детей, получавших какие-либо антибиотики в первые два года жизни, пришло к выводу, что раннее воздействие антибиотиков изменило микробиом их кишечника — микроорганизмы, живущие в нашем пищеварительном тракте, разрушают вредные бактерии и производят важные питательные вещества — и увеличивают вероятность ожирения.

Более поздние исследования показали, что кишечные бактерии могут играть роль в аппетите (влияя на передачу сигналов от гормонов, которые регулируют аппетит).

Эмма, у которой была первая ИМП в возрасте 20 лет, прежде чем она начала страдать от множественных инфекций в год, говорит, что заметила выраженное изменение аппетита, когда принимала лекарства.

«У меня постоянно урчало в животе, и я постоянно рыскала по шкафам в поисках закусок и требовала дополнительных порций во время еды», — говорит она. ‘Это было всепоглощающим.’

‘Антибиотики всегда действовали быстро и приносили мне облегчение, но я заметил побочный эффект отчаянного голода. Я не могла перестать есть», — говорит Эмма, мать одного из Дартфорда, Кент

. Но как только она прекратила курс лечения, ее чувство голода уменьшилось через день или два. Неудивительно, что она также набирала вес.

«До антибиотиков у меня был размер 10, но после курса я заметила, что моя одежда стала теснее», — говорит она.

«Впоследствии я похудел, так как у меня снизился аппетит, но иногда мои инфекции мочевыводящих путей были близки друг к другу — с интервалом в две или три недели — это означало, что я регулярно возобновлял новый курс антибиотиков и набирал вес». лекарства, и она «всегда чувствовала себя отчаянно голодной».

«Голод был настолько сильным, что его невозможно было игнорировать», — говорит она. «Я даже ел ночью, стоя перед холодильником в 3 часа ночи, ел все, что мог найти.

Когда она упомянула об увеличении веса своему врачу, он не поверил, что это связано с антибиотиками.

И все же возможная связь между увеличением веса и приемом антибиотиков впервые появилась на заре применения этих препаратов. Например, в 1951 году исследователи отметили, что, когда недоношенным детям в Италии давали ежедневную дозу антибиотика хлортетрациклина, через десять дней они были на 8 процентов тяжелее, чем дети, не получавшие лечения.

В 2014 году ведущий микробиолог США доктор Мартин Блазер и его команда изучили данные долгосрочного исследования родителей и детей Avon, продолжающегося британского проекта, начатого в начале 1990-х годов.Они обнаружили, что дети, которым давали антибиотики в течение первых шести месяцев жизни, стали толще, чем те, кто этого не делал.

Такие результаты привели доктора Блейзера и других исследователей к мысли, что быстрый рост ожирения во всем мире может быть частично вызван воздействием антибиотиков. А возможная ссылка? Наши кишечные бактерии или микробиом.

Проблема с антибиотиками в том, что хотя они уничтожают бактерии, вызывающие болезни, они также уничтожают и те, которые поддерживают ваше здоровье. Без баланса микробиом может прийти в беспорядок.

Это может повлиять на уровень «гормона голода» грелина, который секретируется в слизистой оболочке желудка и посылает в мозг сообщения о необходимости поесть. Высокий уровень грелина также способствует накоплению жира.

«В нашем организме повсюду есть бактерии, и они работают на наше благо, переваривая пищу», — говорит Колин Гарнер, профессор фармакологии и токсикологии и генеральный директор Antibiotic Research UK. «Но они также могут быть вредными, например, когда вызывают инфекцию.

«Лечение антибиотиками приводит к потере разнообразия кишечных бактерий, в результате чего в кишечнике вырабатываются сигналы, вызывающие увеличение выработки грелина желудком.

‘Грелин стимулирует аппетит и чувство голода, в результате чего человек ест больше. Уже много лет известно, что когда сельскохозяйственных животных, таких как свиньи, кормят антибиотиками, свиньи прибавляют в весе. Вероятно, то же самое происходит и у людей».

Дети обычно рождаются со здоровым балансом хороших и плохих кишечных бактерий, а также получают дополнительные запасы хороших бактерий благодаря грудному вскармливанию.

Это помогает защитить их от ожирения, диабета и проблем с психическим здоровьем в более позднем возрасте, говорит профессор Гарнер.

Уничтожение хороших бактерий антибиотиками может привести к доминированию плохих бактерий, а хорошие бактерии не смогут восстановиться.

‘Поскольку детский организм быстро развивается, он более восприимчив к изменениям в микробиоме. Это может иметь вредные последствия в более позднем возрасте, такие как ожирение, диабет, проблемы с психическим здоровьем, сердечно-сосудистые заболевания и синдром раздраженного кишечника (СРК)», — добавляет профессор Гарнер.

Даже однократный прием антибиотиков может вызвать выброс гормонов, в частности грелина. Действительно, исследователи обнаружили, что пересадка бактерий от людей с избыточным весом животным приводит к ожирению животных.

Профессор Гарнер говорит: «Нарушение равновесия бактерий из-за убийственного действия антибиотиков повлияет на людей непредсказуемым образом». пациент чувствует такую ​​тошноту, что может похудеть.

Профессор Гарнер говорит, что мы должны сократить использование этих лекарств: «Большинство здоровых людей могут бороться с инфекциями, не прибегая к антибиотикам». Он предлагает тем, кто принимает антибиотики, сосредоточиться на здоровой диете с большим количеством фруктов и овощей, чтобы помочь накормить «хорошие» микроорганизмы.

Питер Уорвелл, консультант-гастроэнтеролог и профессор медицины Манчестерского университета, предполагает, что прием пробиотиков также может помочь после приема антибиотиков.

«В гастроэнтерологии мы видим много проблем, связанных с использованием антибиотиков, а в СРК мы видим огромное количество людей, у которых проблемы возникают в результате использования антибиотиков», — говорит он.

Он добавляет, что проблема заключается не в антибиотиках узкого спектра действия, таких как пенициллин, поскольку они «убивают только пару организмов»; это средства широкого спектра действия, «которые убивают все в поле зрения».

‘Поскольку антибиотики убили все, это дает возможность не самым лучшим организмам иметь внутри вас возможность расти.

Имеет смысл использовать пробиотики для восстановления состояния кишечника, дестабилизированного антибиотиками, утверждает он. Это подтверждается исследованиями.

«Проблема в том, что пробиотики варьируются от продукта к продукту, как с точки зрения организмов, так и с точки зрения концентрации», — говорит профессор Уорвелл.

Эмма пробовала другие средства, чтобы избежать ИМП, такие как клюквенный сок, но ИМП рецидивировали, и у нее не было другого выбора, кроме как продолжать принимать антибиотики.

Она говорит: «Они помогли мне вылечиться от инфекций, но с годами они определенно заставили меня набрать вес».

Наблюдение за часами 

Как использовать силу своих биологических часов. На этой неделе: выключите телефон за 30 минут до сна.

Нам часто говорят, что «синий» свет, излучаемый экранами, не дает нам уснуть, если мы используем его по вечерам, поскольку эта длина волны света нарушает наши биологические часы.

Но хотя синий свет влияет на световые рецепторы в глазу, которые играют ключевую роль в настройке биологических часов, влияние на сон должно быть небольшим, говорит Рассел Фостер, профессор циркадной неврологии в Оксфордском университете.

Исследование, проведенное Гарвардским университетом в 2014 году, в котором сравнивалось, сколько времени людям требуется, чтобы заснуть после прочтения электронной или печатной книги, показало, что разница была всего на десять минут дольше после прочтения электронной книги, что «биологически бессмысленно», говорит профессор Фостер. .

Однако ночное использование телефонов, компьютеров и других экранов поддерживает умственную активность мозга, что может не дать нам заснуть.

Чтобы дать мозгу время успокоиться, профессор Фостер советует выключать все электронные устройства, включая телевизоры и смартфоны, за 30 минут до сна.

 

Как антибиотики делают вас толстыми

Всякий раз, когда я думаю об антибиотиках, я ставлю в тупик своего внутреннего поклонника «Звездных войн» и признаю, что хорошо, что Сила не реальна, а Арт Эйерс на самом деле не сморщенный микробиолог, версия Бена Кеноби. В противном случае он внутренне морщился бы каждые несколько секунд, когда где-то в мире начинается очередной курс антибиотиков, и несколько миллиардов флоры кричат ​​от ужаса и внезапно замолкают, и о них больше никогда не слышно.

Я вроде как шучу, но это правда: каждый раз, когда вы принимаете антибиотики, умирают миллиарды одомашненной кишечной флоры.Как я упоминал на прошлой неделе, антибиотики предназначены не для клеток человека, но этого нельзя сказать о комменсальных бактериях, живущих в нашем кишечнике. Видите ли, большинство антибиотиков не делают различий между «хорошими» и «плохими» бактериями. Они нацелены на бактерии. Они не мы, это иностранные образования, но без них мы не были бы нами. Нам нужно, чтобы они функционировали должным образом. Это немного похоже на привлечение истребителя для уничтожения жуков, наводнивших ваш дом, и в конечном итоге этот парень убивает вашу собаку и заставляет вашу кошку вести себя смешно, а также убивает насекомых.Работа сделана, и технически он сделал то, что вы просили, но теперь вы должны сказать своему ребенку, что Бадди переехал на ферму на севере штата, чтобы стать овчаркой и выяснить, как справиться с тем, что ваша кошка писает на диван и царапает ваши желудок (дырявый кишечник, понимаете?). Не очень весело, и не то, на что вы рассчитывали.

Результаты исследования длительного воздействия антибиотиков на кишечную флору, проведенного в 2010 году, довольно пугающие. В течение 10 месяцев три человека – люди – прошли по два курса ципрофлоксацина, чрезвычайно часто назначаемого антибиотика, часто используемого для лечения инфекций костей и суставов, инфекций дыхательных путей, гастроэнтерита, эндокардита, инфекций мочевыводящих путей, целлюлита, инфекционной диареи. , инфекция сибирской язвы, брюшной тиф и кожные инфекции, и это далеко не все.Другими словами, он считается надежным универсальным антибиотиком, эффективным для всех видов (ветераны часто назначают ципро). Итак, что произошло с популяциями кишечной флоры пациентов после приема ципро?

Через три-четыре дня после начала лечения кишечное разнообразие было утрачено, а состав изменился . Оставшаяся флора стала более гомогенизированной, а различные соотношения более чем 400 видов бактерий, живущих в кишечнике, стали неравномерными. Через неделю после завершения каждого лечения кишечная флора восстанавливалась, но незначительно.Это была тень самого себя. Разнообразие улучшилось, но не до исходного уровня. Состав начал нормализоваться, но не полностью. Вещи были стабильны, и разнообразие/состав были защищены от дальнейших изменений, но состояние охраняемой флоры не было тем же преципро-состоянием.

Авторы признают, что это неизведанные воды. Они не знают и не делают вид, что знают, долгосрочные последствия размещения измененного микробиома. Они не используют слова «хороший» или «плохой» для описания бактерий.Они просто знают, что он изменился, и, насколько нам может сказать десятимесячный испытательный срок, возможно, навсегда.

Не знаю, у меня есть подозрение, что, может быть, только может быть, навсегда изменить нашу кишечную флору — не такая уж и крутая идея. Думаю, исследователи согласятся, но они, конечно, не могут ничего сказать, не зная наверняка. Но мое подозрение не совсем беспочвенно. У нас есть некоторые доказательства того, что измененная кишечная флора связана с увеличением веса . У нас даже есть доказательства того, что антибиотики вызывают увеличение веса.Давайте посмотрим поближе.

Прежде всего, конечно, широкое использование антибиотиков для «увеличения роста» скота. Я использую кавычки, потому что на самом деле они делают скот жирным, нарушая микробиом его кишечника. Одно исследование даже установило, что отказ от рутинного введения антибиотиков скоту с целью увеличения прибавки в весе не повлияет на доступность пищевого белка в развивающихся странах. Мое предположение, почему? Антибиотики увеличивают накопление жира у этих животных, а не просто вызывают явную гипертрофию мышечной ткани — если вы не знаете бодибилдеров, которые циклируют пенициллин и ципро — и в результате увеличение веса происходит больше за счет жира, чем белка.

Другие животные дают больше возможностей для понимания влияния измененной кишечной флоры на ожирение. Как, скажем, мыши:

Группа исследователей пересадила кишечные бактерии мышей с ожирением худым мышам. У худых мышей наблюдалось 60%-ное увеличение жировых отложений и быстрое снижение резистентности к инсулину в течение 14 дней после изменения кишечной флоры.

В более позднем исследовании члены той же группы индуцировали ожирение у мышей с помощью диеты. По мере того, как они откармливались, расцветал специфический вид бактерий Firmicutes — он начинал разрастаться в кишечнике. Трансплантация этого Firmicute худым мышам сделала худых мышей жирными. Тощие мыши, получившие трансплантаты от худых доноров, не толстели.

О, а еще есть интересные доказательства на людях. Те же исследователи, которые показали, что кишечная флора худых мышей отличается от флоры толстого кишечника, и что перенос флоры толстых мышей на худых мышей сделал худых мышей толстыми, изучали, верно ли это для людей. Это. Так же, как и у мышей, кишечник худых людей содержит больше флоры из бактериального типа Bacteroidetes и меньше из типа Firmicutes, тогда как кишечник человека с ожирением содержит флору, в большей степени относящуюся к Firmicutes . Кроме того, как мыши, так и люди с «тучной» кишечной флорой (с высоким содержанием Firmicutes) получают больше энергии из пищи и имеют повышенную способность «собирать энергию».

Хорошо. Таким образом, кажется довольно очевидным, что кишечные бактерии играют роль в ожирении, и есть убедительные доказательства того, что это является причинной ролью. Но исследования до сих пор показали только то, что изменение кишечных бактерий путем добавления флоры тучных животных в кишечник худых животных заставляет их набирать вес. Таким образом, возникает вопрос, может ли изменение кишечной флоры с помощью антибиотиков оказывать аналогичное влияние на вес.

Мартин Блазер, исследователь микробиома из Нью-Йоркского университета, считает, что знает ответ. Ссылаясь на упомянутое ранее исследование 2010 года и другое, автором которого он является сам, , он предполагает, что использование антибиотиков не только необратимо изменяет нашу кишечную флору, но и способствует ожирению . Блазер исследовал влияние антибиотиков на Helicobacter pylori, распространенный представитель биома кишечника человека. Хотя есть доказательства того, что H. pylori увеличивает риск язвы и рака желудка, что делает его популярной мишенью для врачей (даже у бессимптомных пациентов), владеющих молотом из антибиотиков, он также живет в кишечнике человека по крайней мере 58 000 лет.Вы можете себе представить, что небрежное пренебрежение такой обширной совместной историей может иметь некоторые непредвиденные последствия. Вы будете правы.

Компания Blaser использовала ветеранов США, которым была назначена эндоскопия верхних отделов желудочно-кишечного тракта (тщательное обследование верхних отделов желудочно-кишечного тракта). Из 92 ветеринаров у 38 не было H. pylori, 44 дали положительный результат на H. pylori и 10 были неопределенными. 23 человека с положительной реакцией на H. pylori получали антибиотики, и у всех, кроме двоих, H. pylori была полностью ликвидирована. Итак, что случилось с 21 испытуемым, которые изначально были полны H. pylori, но кто уничтожил их с помощью антибиотиков?

Они набрали больше всего веса. Их ИМТ увеличился на 5%, плюс-минус 2%. У других ветеринаров вес не изменился.

Уровень лептина увеличился на 20%.

Постпрандиальный уровень грелина увеличился в шесть раз.

Наиболее интересным эффектом для меня является увеличение грелина. Он делает несколько вещей, главная из которых — усиливать чувство голода. Высокие уровни также увеличивают брюшной жир. Итак, после приема антибиотиков и потери всех своих H.pylori, пациенты не были так удовлетворены после еды, они набирали больше веса, и набранный вес, вероятно, был сконцентрирован в брюшной полости. Плохие вещи вокруг. Я уже писал об опасностях жира на животе; дело не только в LGN.

Чувак, антибиотики как стимуляторы роста в животноводстве действительно имеют смысл, если сложить все вместе. Они дают вам всякие классные вещи:

Более эффективное преобразование корма в энергию. Снижение затрат на питание.

Более высокий уровень грелина способствует большему накоплению висцерального жира.Больше мраморности.

Теперь я немного хочу, чтобы Арт Эйерс действительно был мастером-джедаем и мог использовать Отладку Силы для удаления определенных штаммов бактерий из кишечника (Удушение Силы не сработает, потому что большая часть кишечной флоры является анаэробами и, следовательно, не нуждается в кислороде). ; также у них нет шейки).

На следующей неделе будет больше проблем и несколько решений. Спасибо за прочтение.

об авторе

Марк Сиссон — основатель Mark’s Daily Apple, крестный отец движения Primal food and lifestyle, а также New York Times автор бестселлера The Keto Reset Diet .Его последняя книга — Keto for Life , в которой он обсуждает, как он сочетает кето-диету с первобытным образом жизни для оптимального здоровья и долголетия. Марк также является автором множества других книг, в том числе The Primal Blueprint , которой приписывают ускорение роста движения первобытных/палео в 2009 году.

Можно ли от антибиотиков похудеть: Похудела от антибиотиков

Добавить комментарий

Ваш адрес email не будет опубликован.