Содержание

Гиперплазия эндометрия — лечение народными средствами, диета, можно ли вылечить?

Под гиперплазией принято понимать аномальное разрастание эндометрия. Данный процесс носит доброкачественный характер и заключается в увеличении внутренней оболочки матки.

При этом в некоторых случаях данная патология может вызывать неприятные последствия. Потому появление ее симптомов должно стать основанием для обращения к врачу.

В домашних условиях нередко применяют лечение гиперплазии эндометрия народными средствами.

Суть патологии

Многие люди интересуются, что это такое – гиперплазия эндометрия. Под данным нарушением принято понимать увеличение слизистой оболочки матки, что влечет ее утолщение. Код по МКБ-10 – N85. Другие невоспалительные болезни матки.

Под воздействием эстрогена эндометрий увеличивается ежемесячно. Это требуется для того, чтобы принять оплодотворенную яйцеклетку. Если же зачатие не происходит, этот слой отторгается.

При разрастании слизистой оболочки естественный физиологический процесс нарушается.

Причины возникновения болезни связаны с гормональным дисбалансом, опухолями, хроническими воспалительными процессами.

В большинстве случаев жалобы на гиперплазию появляются у женщин старше 50 лет, однако иногда ее диагностируют и после 40 лет. Также в группу риска входят пациентки с лишним весом, сахарным диабетом, повышенным давлением.

Многие интересуются, можно ли забеременеть при гиперплазии эндометрия. Поскольку данная аномалия является гормональным нарушением, она приводит к отсутствию овуляции. Это становится причиной развития бесплодия.

Однако своевременная терапия позволяет забеременеть спустя несколько месяцев после завершения курса.

Если гиперплазия появляется после зачатия вследствие гормональных колебаний, она не представляет опасности для здоровья. Как правило, беременность в такой ситуации протекает нормально

.

Лечением гиперплазии занимаются уже после рождения ребенка.

Гиперплазия эндометрия

Медикаментозная терапия

Может ли пройти сама данная аномалия? Этот вопрос волнует множество женщин. На самом деле патология не исчезает самостоятельно. Чтобы справиться с недугом, требуется курс гормонального лечения.

Для этого применяют несколько категорий лекарственных средств:

  1. Комбинированные оральные контрацептивы. В данную категорию входят такие средства, как Регулон, Жанин, Ярина, Оргаметрил. Такие препараты обычно выписывают женщинам детородного возраста и пациенткам во время полового созревания. Принимать лекарства нужно минимум полгода. При необходимости в экстренной остановке кровотечения возможно применение большой дозировки.
  2. Гестагены. К ним относят Дюфастон, Утрожестан, Норколут. Их назначают женщинам разного возраста на 3-6 месяцев. Пациенткам детородного возраста может быть назначена внутриматочная спираль Мирена, которая тоже содержит гестагены. В отличие от оральных контрацептивов, Мирена оказывает местное действие.
  3. Аналоги ризлинг-гормонов гипоталамуса. К ним относят Бусерелин, Золадекс. Такие гормональные средства считаются самыми эффективными и назначаются женщинам старше 35 лет на 3-6 месяцев. При этом введение лекарств осуществляется 1 раз в 28 дней.

Лечение гиперплазии эндометрия без выскабливания также подразумевает применение витаминных комплексов – показаны витамины группы В, аскорбиновая кислота. Немаловажное значение имеет прием седативных лекарств.

Если же у пациентки развивается анемия, ей выписывают препараты железа – Ферлатум, Сорбифер.

Народные методы лечения

Чтобы устранить нарушение, можно использовать и народные средства. Однако перед началом лечения непременно следует получить консультацию врача, иначе есть риск развития опасных последствий.

К самым действенным средствам относят следующее:

  1. Льняное масло. Длительное время рекомендуется принимать натощак по 1 столовой ложке данного продукта. Он считается универсальным средством, которое помогает очищать организм и улучшать его работу.
  2. Настойка крапивы. Взять 100 г свежей и сухой травы растения и смешать с 500 мл водки. Оставить на 15 суток настаиваться, время от времени взбалтывая состав. Принимать по 10 мл до еды. Делать это рекомендуется дважды в сутки на протяжении 60-90 дней.
  3. Сок лопуха. В весеннее время нужно сорвать лопух с корнем, помыть и отжать все части. Хранить продукт в холодильнике. Принимать по 10 мл на голодный желудок. Делать это следует на протяжении месяца. Горечи, которые присутствуют в соке, прекрасно очищают организм и сосуды от токсических веществ, а также прекращают развитие аномальных клеток.
  4. Настой калины. Это средство отлично устраняет причины развития гиперплазии – гормональный дисбаланс, гипертоническую болезнь, стрессовые ситуации. Для этого нужно взять ягоды калины, слегка размять вилкой и смешать с кипятком. Оставить на 10 минут настаиваться. Положить сахар или мед. Такое лечение наиболее эффективно проводить во время созревания плодов.
  5. Манжетка и сон-трава. Данные растения нужно взять в равных пропорциях и перемешать. Добавить к 1 десертной ложке сбора 250 мл кипятка. Разделить средство на одинаковые части и выпить за день.
  6. Свекольный и морковный соки. Смесь из этих овощей рекомендуется пить курсами. Соки необходимо брать в равных пропорциях и употреблять на голодный желудок по 100-200 мл в сутки. Чтобы добиться хороших результатов, сок нужно принимать 2 недели, после чего делать перерыв или переходить на другой продукт – к примеру, тыквенный.
  7. Масло персика. Данное вещество нужно пить 2 раза в сутки в течение 20 дней. Это средство имеет выраженные мочегонные, антиоксидантные и слабительные свойства. Благодаря этому удается очистить весь организм.
  8. Настойка пиона. Данный продукт можно купить в аптеке. Пить по 30-40 капель 2-3 раза в сутки. Благодаря этому удастся восстановить работу нервной системы, нормализовать баланс гормонов и снизить давление. Как следствие, гиперплазия постепенно пройдет.
  9. Шрот расторопши. Данный продукт помогает очищать печень от вредных элементов. Именно содержание шлаков в организме зачастую приводит к разрастанию эндометрия. Рекомендуется принимать по 1 небольшой ложке шрота 4 раза в сутки, хорошо запивая водой.
  10. Боровая матка. В аптеке можно приобрести готовую настойку данного растения и принимать по инструкции. Также ее можно сделать самостоятельно. Для этого рекомендуется взять 100 г травы и залить бутылкой водки. Оставить на 15 суток и употреблять по 5 мл в трижды в день. Через 3 месяца терапии рекомендуется выполнить ультразвуковое исследование и сдать цитологический мазок.
  11. Витекс. Чтобы сделать настойку на основе плодов этого растения, нужно взять 100 г сырья и смешать с 200 мл медицинского спирта. Настаивать средство 3 недели. Принимать по 15 капель 2 раза в сутки. Делать это рекомендуется 4 месяца.
  12. Корень диоскореи. Из сухого сырья нужно сделать порошок и залить кипящей водой. На 10 г растения необходимо взять 100 мл жидкости. Состав рекомендуется настаивать полчаса. Принимать по 30 мл средства в день. Лучше всего разделить данное количество на 2 раза. Такое лечение рекомендуется продолжать полгода.
  13. Сбор трав. В равных частях смешать крапиву, корневище аира, спорыш, календулу, пастушью сумку. Заварить сбор, как чай. Принимать каждый день, пока состояние эндометрия не улучшится. После каждого курса применения нужно делать УЗИ на 5-7 день цикла. Чтобы справиться с проблемой, потребуется 3 курса терапии в год.
  14. Болиголов. Данное средство обладает выраженными противоопухолевыми свойствами, потому может стать надежной профилактикой злокачественных процессов. При этом важно учитывать, что растение обладает выраженными токсическими свойствами, потому необходимо соблюдать осторожность.
    Для приготовления настойки следует взять 300 г соцветий и смешать с 500 мл водки. Оставить настаиваться на 1 месяц. Пить средство по 1 капле, постепенно увеличивая объем до 15 капель. Такое количество нужно принимать до улучшения состояния.

Особенности питания

Диета при гиперплазии эндометрия играет важную роль в успешном лечении патологии. Благодаря правильному питанию удается снизить пролиферацию клеток и прекратить развитие болезни.

В рационе обязательно должны присутствовать омега-3-полиненасыщенные жирные кислоты. В большом количестве они содержатся в жирной рыбе – сельди, семге, скумбрии. Такие продукты рекомендуется употреблять как минимум 3 раза в неделю.

Также можно есть семена льна, кунжутное масло, грецкие орехи.

Чтобы контролировать содержание эстрогена в организме, следует есть продукты, которые содержат целлюлозу. К ним относят следующее:

  • морковь;
  • злаки;
  • орехи;
  • кабачки;
  • свекла;
  • брокколи;
  • курага;
  • яблоки;
  • облепиха;
  • клубника.

Справиться с излишками эстрогена помогают такие продукты, как чеснок, сельдерей, капуста и тыква. Также в меню обязательно должны присутствовать нежирные сорта мяса и молочные продукты.

Немаловажное значение имеет потребление витамина С. Данный элемент можно найти в лимонах, шиповнике, калине, болгарском перце. Также он содержится в киви, апельсинах, черной смородине, рябине.

Существует целый ряд продуктов, которые нужно исключить из рациона женщинам с таким диагнозом. К ним относят следующее:

  • сладости;
  • красное мясо;
  • кофе;
  • острые пряности;
  • жареные продукты;
  • выпечка;
  • дрожжи;
  • сливочное масло;
  • яйца.

Принимать пищу стоит маленькими порциями 5 раз в сутки. Важно следить за достаточным потреблением овощей и фруктов. Немаловажное значение имеет соблюдение водного баланса. В день стоит выпивать минимум 2 л воды.

Врачи категорически не рекомендуют переедать, поскольку это провоцирует накопление шлаков в организме и может привести к развитию опухолей. Только здоровая печень в состоянии перерабатывать вредные вещества, что является надежной профилактикой злокачественных процессов.

Прогноз и возможные осложнения

Можно ли вылечить гиперплазию эндометрия? При условии своевременной и адекватной терапии прогноз вполне благоприятен. Заболевание удается устранить в течение 6-12 месяцев после применения лекарственных средств и хирургического вмешательства.

Если же вовремя не начать терапию, есть риск развития осложнений.

Какие последствия провоцирует гиперплазия? К ним относят:

  • нарушения менструального цикла;
  • обильные менструации;
  • полное прекращение месячных;
  • бесплодие;
  • рак матки – это наиболее серьезное осложнение.

Теперь вам известно, чем опасна гиперплазия эндометрия. Если своевременно не приступить к терапии недуга, он может стать причиной серьезных осложнений.

Потому так важно своевременно обратиться к врачу, который выпишет действенные лекарственные препараты и порекомендует подходящие народные рецепты.


Эти материалы будут вам интересны:

Похожие статьи:

  1. Гиперплазия предстательной железы (ДГПЖ) — лечение народными средствами Доброкачественная гиперплазия предстательной железы диагностируется очень часто. Она чаще всего…
  2. Лечение климакса народными средствами Климакс представляет собой особый период в жизни женщины, который сопровождается…
  3. Пониженная кислотность желудка: симптомы и лечение народными средствами Снижение нормального уровня кислотности желудочного сока свидетельствует о каком-либо заболевании….

причины, симптомы, диагностика и методы лечения на сайте «Альфа-Центр Здоровья»

Доброкачественное разрастание внутренней слизистой оболочки матки, сопровождается нарушением менструального цикла, ановуляторными маточными кровотечениями, бесплодием

Признаки гиперплазии эндометрия отмечаются у 5-25% женщин. Этим термином обозначают патологическое увеличение эндометрия – внутреннего слизистого слоя полости матки. В норме он растет каждый месячный цикл. Утолщаясь под влиянием половых гормонов эстрогена и прогестерона, слизистая готовится принять яйцеклетку. Если зачатие не наступает, то снижение уровней гормонов вызывает отторжение ткани. После менструации процесс начинается заново. При гормональном сбое, повышается уровень эстрогенов, что и запускает процесс патологического роста эпителия.

Причины и симптомы гиперплазии эндометрия

Выделяют формы гиперплазии:

  • железистая – утолщается железистая ткань слизистой;
  • железисто-кистозная – образуются доброкачественные кисты;
  • очаговая – появляются железистые и фиброзные полипы;
  • атипичная (аденоматозная) – появляются измененные клетки, опасна перерождением в онкологическую форму (аденокарциному).

Основные причины заболевания гормональные сбои. Вероятность столкнуться с признаками гиперплазии эндометрия в периоде полового созревания и в начале климакса, когда в женском организме происходит гормональная перестройка. Ряд смежных проблем усиливают риски появления патологии:

  • воспаления в мочеполовой системе;
  • аборты, гинекологические операции на матке;
  • наследственность;
  • лишний вес;
  • эндокринные заболевания;
  • заболевания маки и придатков – миома, поликистоз яичников;
  • неблагоприятная экологическая обстановка;
  • гормональная терапия.

Определить патологию только по жалобам пациента сложно. Многие гинекологические заболевания проявляются похожим образом. К основным симптомам гиперплазии эндометрия относятся:

  • нерегулярные, частые (чаще, чем 21 день), длительные менструации, с мажущими выделениями между ними;
  • боли схваткообразного типа в животе;
  • кровянистые выделения в период менопаузы.

Заболевание может протекать бессимптомно, особенно при климаксе.

Как лечить гиперплазию эндометрия

Лечение начинается с постановки точного диагноза. Для этого потребуются:

  • гинекологический осмотр;
  • УЗИ для оценки размеров, толщины, структуры слизистой матки, кист, полипов;
  • гистологическое исследование ткани;
  • гистероскопия – осмотр матки специальным датчиком;
  • лабораторные тесты на гормоны.

Как лечат гиперплазию эндометрия решает врач. При простых формах эффективно гормональное лечение с применением:

  • гестагенов – гормонов яичников и надпочечников;
  • внутриматочной спирали;
  • оральных контрацептивов, которые нормализуют циклический рост и отторжение ткани;
  • гормональную терапию при менопаузе.

Если форма очаговая, то лечить гиперплазию эндометрия придется хирургическим путем, для удаления полипов. При аденоматозной форме – матку удаляют из-за риска появления раковой опухоли.

Лечение гиперплазии эндометрия не эффективно с применением народных методов. Откладывание терапии на «потом» могут привести к необратимым последствиям: бесплодию, анемии, онкологии. При раннем выявлении и соблюдении рекомендаций, шансы на выздоровление высоки.

Лечение гиперплазии эндометрия. Чем и как лечить гиперплазию

Диагностика болезни — первый шаг на пути к выздоровлению независимо от ее характера и стадии. Гиперплазия эндометрия — тоже не исключение.

Это женское заболевание внутреннего слоя матки, которое может привести к бесплодию или онкологическим заболеваниям.

Диагностика гиперплазии эндометрия возможна на приеме у гинеколога, во время прохождения планового УЗИ или по ярко выраженным симптомам. В общих случаях заболевание протекает бессимптомно, поэтому выявить ее самостоятельно практически невозможно.

К основным симптомам заболевания относят:

  • нарушение менструального цикла с обильными выделениями;
  • наличие мажущих кровянистых выделений до или после менструации;
  • периодические задержки менструации;

Как лечить гиперплазию матки? Главное — вовремя ее обнаружить. Чем раньше вы обратитесь за помощью к гинекологу, тем проще устранить негативные последствия заболевания на женский организм.

Медицинский центр «ОН Клиник» дает 5 советов по лечению гиперплазии

  • совет № 1: наиболее безопасным методом лечения является медикаментозная терапия с использованием гормональных препаратов, комбинированных оральных контрацептивов и гестагенов;
  • совет № 2: регуляцию гормонального фона должен проводить только врач-гинеколог с точным соблюдением приема назначенных им препаратов;
  • совет № 3: уменьшить и остановить разрастание слизистой оболочки матки без хирургического вмешательства можно только на ранних стадиях заболевания независимо от возраста пациентки;
  • совет № 4: выскабливание полости матки или другое оперативное вмешательство (лазерная абляция, криодеструкция) может существенно повредить стенки матки. К этим процедурам нужно прибегать только тогда, когда медикаментозное лечение не эффективно.
  • совет № 5: использовать средства народной медицины можно только по рекомендации врача наряду с медикаментозным лечением.

Лечение гиперплазии эндометрия матки требует времени. Восстановление гормонального фона женщины — длительный процесс. Поэтому врач постоянно должен контролировать стадию развития болезни и степень эффективности приема препарата. Нередко «сильные» гормональные препараты чередуют со «слабыми» или наоборот.

В «ОН Клиник» квалифицированные гинекологи знают, чем и как лечить гиперплазию эндометрия без последствий и осложнений. С нами лечение гиперплазии шейки матки будет эффективным!

Рейтинг статьи:

0 из 5 на основе 0 оценка

Автор: Александр Медведев

Лечение гиперплазии эндометрия в постменопаузе

После прекращения менструаций у женщин начинается период постменопаузы, продолжительность которого составляет почти треть жизни. В организме происходят возрастные изменения, уменьшается количество женских гормонов, поэтому могут появиться серьезные патологии, заболевания. Одна из распространенных – гиперплазия эндометрия.

Что такое гиперплазия эндометрия

У болезни нет возрастных ограничений, но чаще она диагностируется во время полового созревания, климакса. В юном возрасте болезнь не столь опасна, потому что при правильном лечении редко приводит к серьезным последствиям, а в период менопаузы и после нее велик развития рака. При гиперплазии происходит избыточное деление, усиленное размножение клеток эндометрия, увеличение толщины слизистой оболочки. Разрастание доброкачественное, но считается потенциально опасным. Если толщина эндометрия при климаксе более 6 мм, необходимо дальнейшее обследование.

В постменопаузе

Основной причиной утолщения, разрастания клеток эндометрия является нарушение гормонального фона. При постменопаузе наблюдается повышенный уровень эстрогенов и дефицит женского гормона прогестерона, в результате такого дисбаланса происходит сбой в работе слизистой оболочки матки. Кроме этого, есть несколько факторов, способствующих появлению патологии:

  1. Генетическая предрасположенность. Если у мамы была выявлено заболевание, велика вероятность его развития у дочери.
  2. Нарушенный обмен веществ, ожирение.
  3. Врожденные дефекты матки.
  4. Инфекции, передающиеся половым путем.
  5. Сбои в иммунитете. При неправильной работе иммунные клетки могут ошибочно атаковать слизистую матки.
  6. Болезни щитовидной железы, надпочечников, сахарный диабет.
  7. Хирургические манипуляции (выскабливание, аборт).
  8. Наличие кистозных образований, миомы.

Эндометриоз при климаксе и постменопаузе часто проходит без явных признаков. При разрастании железистых тканей не наблюдается болевых ощущений из-за слабой чувствительности полости матки. Один из признаков, который может свидетельствовать о заболевании – кровянистые выделения из влагалища, нехарактерные для постменопаузы. Они не связаны с месячными, поэтому могут быть опасны – возможно, понадобится обследование, лечение. Выделения могут быть обильными, скудными – это зависит от соотношения гормонов.

Как лечить гиперплазию эндометрия

Для лечения необходима комплексная терапия. При выборе тактики учитывают возраст пациентки, степень запущенности патологии, причину возникновения, возможность рецидива. В тяжелых случаях, при угрозе жизни, сильных кровотечениях, риске перерождения в злокачественное образование единственным выходом становится оперативное вмешательство. В остальных случаях могут быть использованы консервативные методы: прием гормональных препаратов, лечение народными способами. Последние рекомендованы в качестве дополнительного метода борьбы с очаговыми разрастаниями.

Статьи по теме

Лечение хирургическими методами

Оперативное вмешательство – крайний вариант, используется, когда есть угроза жизни пациентки, а остальные способы не помогают. Также его назначают, если нет возможности постоянно наблюдать за течением заболевания. Для диагностики, лечения гиперплазии эндометрия в постменопаузе часто используется выскабливание полости матки с дальнейшим направлением на гистологическое исследование. Распространены методы оперативного вмешательства: криодеструкция, прижигание. При наличии атипической или рецидивирующей формы гиперплазии проводится удаление матки.

Выскабливание­

Метод, применяемый с диагностической и лечебной целью. Используется для остановки кровотечения, удаления патологических участков эндометрия, гистологического анализа. Процедура простая, занимает около 20 минут, делается под внутривенным наркозом. Для выскабливания используется кюретка. При слепом способе врач сначала расширяет шейку матки, далее вводит хирургический инструмент, выводит обратно, одновременно нажимая на слизистую оболочку. Кюреткой обрабатывает углы матки, переднюю, заднюю стенку.

Криодеструкция

Простой метод, при котором происходит локальное воздействие низкими температурами на очаговые разрастания, гиперплазированные участки эндометрия. После процедуры патологические железистые клетки эпителия погибают, отторгаются и постепенно выходят. Лечение гиперплазии эндометрия в постменопаузе методом криодеструкции проходит без крови. Способ позволяет четко воздействовать на очаг заболевания, минимально повреждая здоровые ткани эндометрия. Он безболезненный, поэтому не требует специального обезболивания.

Прижигание

Лечение гиперплазии проводится и методами электрохимического воздействия, к примеру, лазером. Из-за воздействия высоких температур участки разрастания разрушаются, далее самостоятельно выводятся из матки. Прижигание проводят под наркозом в условиях стационара. Сначала врач вводит пациентке специальный проводник, затем выполняет операцию, нагревая слизистую до высоких температур. Длительность процедуры – не более 20-30 минут.

Удаление матки

Операция проводится, если у женщины сложная атипичная форма гиперплазии. Могут удалить только матку, сохранив шейку, маточные трубы, яичники, могут удалить все перечисленное. Чаще проводится тотальная гистерэктомия, при которой доступ к матке осуществляется через брюшную полость. После удаления органов раны на животе зашиваются, остается большой рубец.

Лечение гиперплазии эндометрия без выскабливания

Чтобы вылечить заболевание, предотвратить дальнейшее увеличение эндометрия, назначается лекарственная терапия. Таблетки призваны отрегулировать гормональный фон, остановить кровотечение, предотвратить разрастание слизистой оболочки в постменопаузе:

  1. Сначала для улучшения физического состояния женщины могут быть прописаны комбинированные гормональные средства, к примеру, Логест, Жанин, Ярина. Их принимают на протяжении 21 дня по одной таблетке по контрацептивной схеме.
  2. На втором этапе назначаются гестагены для подавления склонности эндометрия к утолщению. Лечение длительное, не менее 3-6 месяцев. Известные препараты этой группы: Мирена, Дюфастон, Норколут.
  3. Третий этап предполагает прием аналогов ризлинг-гормонов гипоталамуса. Их действующие вещества предотвращают выработку половых гормонов, вызывают атрофию эндометрия. Вводятся 1 раз в месяц. Препараты аналогов ризлинг-гормонов: Золадекс, Бусерелин.

Народное лечение гиперплазии эндометрия в менопаузе

Если во время менопаузы, постменопаузы гистероскопия подтвердила железистую, аденоматозную или диффузную гиперплазию, выявила очаговые патологические изменения в полости матки, полиповидные или кистозные образования, не следует отчаиваться. Наряду с таблетками можно использовать народные средства, согласовав их с врачом, а еще диету. При гиперплазии эндометрия очень полезна фитотерапия – многие растения богаты аналогами женских гормонов. Ознакомьтесь с некоторыми народными средствами:

  1. Настойка из спирта с крапивой. Растение оказывает благоприятное воздействие, приводит в норму гормональный фон за счет содержания фитогормонов. Чтобы приготовить настойку, следует измельчить 100 г крапивы, размешать с 400 г спирта, оставить на 10 дней в темном месте. Когда пройдет указанное время, принимать по 1 ч. ложке после еды утром, вечером.
  2. Боровая матка. Траву используют для лечения многих гинекологических заболеваний. При гиперплазии эндометрия, кистозных образованиях рекомендуется применять отвар или спиртовой настой. Для приготовления настоя следует размешать около 50 г травы, 500 мл спирта, держать 2 недели, каждый день встряхивая. Пить по 1 ч. ложке трижды в день, запивая водой. Длительность терапии – от 3 месяцев.

Видео

Нашли в тексте ошибку?
Выделите её, нажмите Ctrl + Enter и мы всё исправим!

Внимание! Информация, представленная в статье, носит ознакомительный характер. Материалы статьи не призывают к самостоятельному лечению. Только квалифицированный врач может поставить диагноз и дать рекомендации по лечению, исходя из индивидуальных особенностей конкретного пациента.

лечение боровой маткой Миома матки гиперплазия эндометрия лечение народными средствами

– это доброкачественное разрастание внутренней оболочки матки, приводящее к нарушению её структуры и функций.

Как проявляется болезнь?
Гиперплазия слизистой матки.

Симптомы гиперплазии эндометрия:

  • Ациклические маточные кровотечения.
  • Нарушение менструального цикла.
  • Болезненные, обильные, длительные менструации.
  • Кровянистые выделения из матки, не связанные с менструальным циклом: контактные, при натуживании, спонтанные.
  • Маточные кровотечения в постменопаузе.
Чем опасна гиперплазия эндометрия?

Без лечения на фоне этой патологии могут развиваться:

  • Анемия.
  • Бесплодие.
  • Рак тела матки.
Как обнаружить болезнь?

Диагностика гиперплазии эндометрия:

  • Признаки патологии слизистой матки выявляет УЗИ.
  • Подтверждает или опровергает болезнь .
  • Окончательный диагноз и форму гиперплазии эндометрия устанавливает гистологическое исследование образцов тканей эндометрия.
Почему возникает болезнь?

Важные условия развития гиперплазии эндометрия:

  • Гормональный дисбаланс.
  • Нарушение чувствительности слизистой оболочки матки к действию половых гормонов.
  • Нарушение иммунитета.
  • Генетическая предрасположенность.

Почему развивается гормональный дисбаланс?

«Поломка» гормонального статуса у женщин происходит из-за нейро- и обменно-эндокринных нарушений, влияющих на работу яичников. Причиной развития дисгормональной патологии эндометрия могут быть:

  • Стресс.
  • Болезни центральной нервной системы, гипоталамические нарушения.
  • Гипертония, атеросклероз, другая сосудистая патология.
  • Нарушение обмена веществ, ожирение, диабет, патология печени и желчевыводящих путей.
  • Болезни надпочечников, щитовидной железы.
  • Тяжёлые роды, аборты.
  • Инфекционно-воспалительные заболевания.
  • Возрастные переходные периоды: подростковый, климактерический.
  • Гормон-продуцирующие опухоли: яичников, внегонадные.
Возможно ли лечение эндометрии матки народными средствами?

Фитотерапию и гомеопатию успешно применяют для лечения без атипии.

Полипы тела матки и лечатся оперативно.

Народные методы лечения гиперплазии эндометрия призваны дополнять, но не заменять лечение, назначенное врачом.

При гиперплазии эндометрия народные методы лечения воздействуют на различные звенья патологической цепочки, облегчая состояние и ускоряя выздоровление.

Отвары, настойки и сборы применяются в качестве кровеостанавливающих, обезболивающих, противовоспалительных, антистрессовых, адаптогенных, иммуномодулирующих, витаминных и общеукрепляющих средств.

Для профилактики рецидива гиперплазии эндометрия народные методы лечения особенно актуальны.


Направления фитотерапии при гиперплазии эндометрия

Народные фито-сборы при гиперплазии эндометрия.

Характерными симптомом гиперплазии эндометрия являются: гиперполименорея (обильные, длительные, более 7 дней менструальные кровотечения) и маточные кровотечения с развитием анемии.

Для комплексного лечения этих состояний в акушерско-гинекологической практике успешно используется опыт целителей-травников.

Испытанные веками кровеостанавливающие растительные средства рекомендованы вместе с медикаментозным и хирургическим лечением маточных кровотечений. Фитосборы применяют при нерегулярных, болезненных менструациях (дисменорее), обильных, длительных менструациях (меноррагиях), при ациклических маточных кровотечениях (метроррагиях) и кровомазании у женщин.

Как делать настой из трав:
10 г сырья (1-2 столовые ложки смешанного травяного сбора) заливают 1 стаканом кипятка и нагревают под крышкой на водяной бане 15 минут. Затем охлаждают при комнатной температуре в течение 45 минут, процеживают, отжимают. Объём готового настоя доводят кипячёной водой до 1 стакана.

Как делать отвар из трав:
Технология приготовления отвара аналогична приготовлению настоя, но процедура нагревания на водяной бане увеличивается до 30 минут. Сбор при обильных менструациях:

Кора дуба — 1 столовая ложка
Трава пастушьей сумки – 2 ст.л.
Трава тысячелистника – 2 ст.л.
Корневище лапчатки прямостоячей – 2 ст.л.
Сырьё перемешать. Приготовить отвар (см. выше) Принимать по 1 стакану утром и вечером.

Сбор при болезненных, нерегулярных менструациях (проверенное народное средство при гиперплазии эндометрия в пременопаузе):

Кора крушины – 1 ст.л.
Листья берёзы – 2 ст.л.
Листья мяты перечной – 2 ст.л.
Трава тысячелистника – 1 ст.л.

Сбор при длительных обильных менструациях в климактерическом периоде:

Кора крушины – 2 ст.л.
Кора калины – 2 ст.л.
Сырьё перемешать. Сделать 1 стакан настоя (см. выше). Выпить глотками в течение дня.

Сбор при обильных, длительных менструациях на фоне гипертензии в старшем возрасте:

Трава пастушьей сумки – 3 ст. л.
Трава горца птичьего – 3 ст.л.
Трава омелы белой – 3 ст.л.
Сделать отвар (см. выше). Принимать по 1 стакану утром и вечером.

Народные средства при маточных кровотечениях:


Крапива при маточных кровотечениях 1.Крапива двудомная.

1.1.Лист крапивы двудомной – 2 ст.л.
Сделать настой. Принимать по 1/2-1/4 стакана до еды 3-5 раз в день при маточных кровотечениях.

1.2. Экстракт крапивы жидкий спиртовой (70%):
Принимать по 25-30 капель 3 раза в день до еды при кровомазании, меноррагиях и метроррагиях.

2. Пастушья сумка.

2.1. Трава пастушьей сумки обыкновенной – 2 ст.л.
Сделать настой. Принимать по 1 столовой ложке 4-5 раз в день после еды при маточных кровотечениях.

2.2. Жидкий экстракт пастушьей сумки спиртовой (70%):
Принимать по 20 капель 3 раза в день при кровомазании и маточных кровотечениях.

3.Кровохлёбка лекарственная.

3.1.Корневища и корни кровохлёбки – 2 ст.л.
Сделать отвар. Принимать по 1 столовой ложке 5-6 раз в день после еды при маточных кровотечениях.

3.2.Экстракт кровохлёбки лекарственной жидкий спиртовой (70%):
Принимать по 30-40 капель 3-4 раза в день как кровоостанавливающее средство.

4. Барбарис амурский.

Настойка (экстракт) из листьев барбариса амурского обыкновенного спиртовая (40%):
По 30-40 капель 2-3 раза в день 2-3 недели при кровомазании и маточных кровотечениях.

5.Водяной перец (Горец перечный).
Горец перечный при гиперплазии эндометрия

5.1. Трава водяного перца – 2 ст. л.
Сделать настой. Принимать по 1/3 стакана 3-4 раза в день до еды как кровоостанавливающее и тонизирующее матку средство.

5.2. Экстракт водяного перца жидкий.
Принимать по 30-40 капель 3-4 раза в день при кровомазании, обильных менструациях и маточных кровотечениях.

Витаминные чаи при гиперплазии эндометрия

Витаминный чай принимают в качестве общеукрепляющего, иммуностимулирующего, адаптогенного средства, а также для проведения поддерживающей терапии при анемиях на фоне гиперплазии эндометрия.

Чай из листьев земляники:

2 столовые ложки сухих листьев земляники заваривают в 1 стакане кипятка. Выпивают в течение дня.

Чаи витаминные:

***
Плоды рябины – 2 ст.л.
Плоды шиповника – 2 ст.л.
Заварить в 0,5 л воды в термосе. Принимать по ½ стакана 2-4 раза в день.

***
Плоды шиповника – 2 ст.л.
Ягоды чёрной смородины – 3 ст.л.
Заварить в 0,5 л воды в термосе. Принимать по ½ стакана 3-4 раза в день.

Боровая матка и Красная щётка при гиперплазии эндометрия


Боровая матка и Красная щётка

Недавние исследования показали, что помимо гормонов, аномальный рост эндометрия тесно связан с неполадками иммунитета. Наряду с признанными официальной медициной адаптогенами- иммуномодуляторами: Эхинацеей пурпуровой и Элеутерококком, алтайские травники рекомендуют для комплексного лечения женских недугов эндемичные растения: Ортилию однобокую (Боровую матку) и Радиолу четырёхчленную (Красную щётку). Оба растения обладают иммуностимулирующей и антистрессовой активностью. Препараты на основе этих трав повышают работоспособность, улучшают гормональный фон, выравнивают баланс «эстрогены / прогестерон» и применяются для профилактики пролиферативных опухолевых заболеваний половой сферы.

Как принимать Боровую матку:

1.Трава Ортилии однобокой – 1 чайная ложка. Сырьё залить 1 стаканом кипятка, настоять 20 минут, принимать по 1/2-1/3 стакана 3 раза в день 28-дневными курсами в течение 4-5 месяцев. Перерыв между курсами 7-10 дней.

2.Спиртовая вытяжка Боровой матки (аптечная):
В зависимости от тяжести процесса принимать:
— по 0,5-1 чайной ложки 3 раза в день 28-дневным курсом.
Или
— по 30 капель, разведённых в 100 мл воды 3 раза в сутки за час до еды 28-дневным курсом.

Лечение можно продлевать до 6 месяцев с 7-дневными перерывами между курсами.

Как принимать Красную щётку:

1.Измельчённое сырьё Родиолы четырёхчленной – 1 столовая ложка.
Залить 1 стаканом кипятка, нагревать на водяной бане 15 минут, настоять 45 минут. Процедить. Выпивать равными порциями до еды с чайной ложкой мёда. Курс лечения от 28 дней до 3-6 месяцев с 7-дневными перерывами.

2. Готовая (аптечная) спиртовая настойка Родиолы четырёхчленной:
Принимать по 30-40 капель 2-3 раза в день в течение 30 дней. Курс лечения можно повторить через 10-15 дней.

Препараты Красной щётки и Боровой матки могут повышать давление. При гипертонии их принимают с осторожностью, дозы подбирают индивидуально, начиная с малых. Лечение этими травами противопоказано при беременности и кормлении грудью.

Лечение гиперплазии эндометрия пиявками или гирудотерапия – это один из эффективных методов, который известен еще с давних времен. Лечение пиявками – это лекарственный метод, который относится к народному лечению, но не запрещен официальной медициной. Суть данного метода состоит в лечебных свойствах пиявок. В ротовой полости пиявки находятся маленькие хитиновые зубчики, которые прокусывают кожу на глубину 1,5 мм и насасывают 5-15 мл крови. Длительность одного сеанса терапии пиявками от 20 до 50 минут. Из-за укуса, после терапии из ранки сочится лимфа и капиллярная кровь. Длительность лечения составляет от 8 до 12 сеансов.

Лечение пиявками гиперплазии эндометрия состоит из трех основных факторов

  1. Рефлекторный фактор – пиявка прокусывает кожу в биологически активных точках, которые являются нервно-сосудистым клубком. То есть эффект от лечения пиявками, схож с рефлексотерапией.
  2. Механический фактор – в процессе процедуры происходит разгрузка регионального кровотока. Истечение лимфы способствует раздражению лимфатических узлов и выработки ими защитных клеток – лимфоцитов. Благодаря этому повышается общий и местный иммунитет. Так, за 12 курсов гирудотерапии, в организме полностью обновляется лимфа.
  3. Биологический фактор – в слюне одной пиявке содержится около 150 биологически активных веществ, которые благотворно влияют на человеческий организм.

Медицинская пиявка обладает тромболитическими, дренирующими, противоотечными, бактериостатическими, рефлекторными, иммуностимулирующими и анальгезирующими свойствами. Лечение пиявками имеет преимущества перед медикаментозным лечением и хирургическим вмешательством. Это объясняется тем, что гирудотерапия оказывает комплексное действие на весь организм, корректируя работу всех органов и систем. Такое лечение применяется не только в гинекологии, но и в акушерстве и урологии. Схему лечения составляет гирудолог на основании рекомендаций и заключения андролога или гинеколога.

Гиперплазия эндометрия – это одно из многих заболеваний, которые поддаются лечению пиявками. С помощью гирудотерапии можно вылечить аденомиоз, миомы, фибромы, нарушения менструального цикла, эрозии шейки матки, воспалительные и функциональные кисты яичников, бартолинит, климактерический и предменструальный синдром, воспалительные заболевания органов малого таза и другие патологии. При гиперплазии эндометрия, пиявки нормализуют гормональные функции и работу иммунной системы. Длительность подобного лечения зависит от выраженности патологических очагов и формы заболевания.

Лечение травами гиперплазии эндометрия

Лечение травами гиперплазии эндометрия – относится к методам народной медицины. Очень часто, врачи прописывают женщинам спринцевания с лекарственными травами, настойки или отвары. То есть лечебные свойства трав, признаны официальной медициной. Для лечения гиперплазии эндометрия используют травяные сборы. Восстановить нормальную работу организма можно с помощью сбора из травы пустырника, корня аира, листьев крапивы и других лекарственных растений.

Из трав готовят отвары и настои. Длительность такого лечения может быть от одного до трех месяцев. Давайте рассмотрим самые популярные и эффективные рецепты лечения травами гиперплазии эндометрия.

  • Настой из травы пульсатиллы и манжетки помогает восстановить гормональные функции организма. Ингредиенты берутся в пропорции 1:1, тщательно измельчаются и заливаются кипятком. Отвар необходимо настоять до полного остывания, а затем процедить. Стакан отвара необходимо разделить на три приема и пить в течение дня. Длительность лечения – один месяц.
  • Золотой ус и лопух – это еще одно растительное средство, обладающее лечебными свойствами в отношении гиперплазии эндометрия. Для приготовления лекарства вам понадобится свежий корень лопуха (из корня выжимают сок). Подобную процедуру проводят и с золотым усом. Сок каждого растения необходимо принимать два раза в день, перед каждым приемом пищи, по одной ложке. Длительность лечения – шесть месяцев.
  • Отлично помогают в лечении гиперплазии эндометрия и травяные сборы. Сборы трав можно приготовить самостоятельно или купить в аптеке. Самым эффективным считается травяной сбор из корня аира, корня змеевика, травы спорыша, крапивы, пастушьей сумки и лапчатки. Ложку сбора заливают стаканом кипятка, настаивают, процеживают и принимают по 100 мл раз в день. Длительность лечения – один месяц, после этого делают перерыв на 10 дней и снова продолжают принимать отвар.
  • Лечение с помощью лопуха

В народной медицине широко применяются спиртовые настойки из корня лопуха, так как они обладают лечебной силой. Для приготовления настойки, растение необходимо засушить, растолочь и поместить в банку, залив 500 мл спирта, водки или коньяка. Будущее лекарство настаивают 14 дней, ежедневно встряхивая банку. Принимают настой 2-3 раза в день, по одной чайной ложке, запивая водой. Длительность такого лечения составляет 90 дней, то есть три месяца.

  • Терапия соками и чистотелом

Лечение гиперплазии эндометрия должно проходить комплексно. Это подразумевает под собой, одновременный прием нескольких лекарственных средств. Итак, рассмотрим лечение соками. Прежде всего, стоит отметить, что длительность такого лечения составляет 4 месяца. На протяжении первого месяца нужно пить свежевыжатый морковный и свекольный сок, по 50-100 мл в день. Перед каждым приемом пищи необходимо употреблять ложку льняного масла, запивая холодной водой. Помимо соков, два раза в месяц, женщина должна проводить спринцевания настоем чистотела. Кроме вышеописанных соков, рекомендуется принимать настой из сока алоэ, кагора и цветочного меда (ингредиенты берутся в пропорции 1:2:1 и настаиваются 14 дней в темном месте).

Настойку из кагора, алоэ и меда нужно принимать в течение второго месяца. На третий месяц прекращаются спринцевания чистотелом. В начале четвертого месяца необходимо сделать недельный перерыв в лечении, а после этого продолжить употреблять льняное масло.

  • Лечение с помощью крапивы

Крапива – это лекарственное растение, которое зарекомендовало себя во всех сферах медицины. Для лечения гиперплазии эндометрия, необходимо приготовить спиртовую настойку. 200 г крапивы залить 500 мл водки и настаивать в течение двух недель. Полученный настой употребляют утром и перед сном, по одной ложке. Такое лечение восстанавливает иммунную систему, что способствует восстановлению функциональных способностей матки.

Из крапивы можно приготовить лекарственный отвар. Для этого растение нужно тщательно измельчить и две ложки крапивы залить 250 мл кипятка. Будущий отвар проварить на водяной бане 15 минут, охладить, процедить и принимать 5-6 раз в день, небольшими глотками.

  • Терапия пионом и подорожником

Экстракт пиона – это эффективное средство в лечении гиперплазии эндометрия. Экстракт разбавляют водой 1:2 и принимают по чайной ложке, три раза в день. Лекарство способствует восстановлению гормонального фона и предотвращает дальнейшее развитие гиперплазии эндометрия.

Настой из подорожника также обладает лекарственными свойствами, которые помогают в лечении женских заболеваний. Измельченные листья растения залить стаканом кипятка и настоять до охлаждения. Отвар нужно процедить и принимать перед приемами пищи, в течение всего дня.

Лечение гиперплазии эндометрия боровой маткой

Лечение гиперплазии эндометрия боровой маткой – это самый успешный и популярный народный метод лечения данной патологии. Из травы можно приготовить спиртовой настой или отвар. Для приготовления спиртового настоя, траву необходимо засушить и поместить в банку из темного стекла. Боровую матку заливают 500 мл спирта или водки и настаивают две недели. При этом каждый день банку с настоем необходимо встряхивать.

Принимают спиртовой настой боровой матки по чайной ложке три раза в день, в течение двух недель. Лекарство необходимо запивать большим количеством воды, а длительность терапии составляет – три месяца.

Кроме настойки, для лечения гиперплазии эндометрия боровой маткой, можно приготовить отвар. Ложку травы заливают 500 мл кипятка и настаивают 15-20 минут. Полученный отвар необходимо выпить за час до приема пищи. Длительность лечения – три месяца.

Лечение гиперплазии эндометрия гомеопатией

Лечение гиперплазии эндометрия гомеопатией – считается весьма эффективным методом, который дает хорошие результаты. Но классические гомеопатические препараты не подходят для лечения гиперплазии эндометрия, так как эффективность такого лечения будет весьма низкой. Для того чтобы вылечить заболевание, необходимо обратиться к врачу-гомеопату, который подберет лекарственные средства, ориентируясь на индивидуальные особенности организма женщины. Чаще всего, в гомеопатии для лечения гиперплазии эндометрия используют такие препараты, как: Геникохеель, Мастометрин, Калиум карбоникум и другие.

Особенность гомеопатического лечения в том, что в первую очередь устраняют причину заболевания, что приводит к исчезновению болезненной симптоматики. Гомеопатия эффективная в лечении практически всех форм данной патологии. Так, к примеру, если у женщины полипы, то перед назначением препаратов проводится диагностика организма. Гомеопаты используют электропунктуру и метод ВРТ, то есть вегето-резонансный тест. Диагностические методы дают полную картину о нарушениях на клеточном уровне и общем состоянии организма.

Лечение гиперплазии эндометрия гомеопатией – это реальная помощь организму для восстановления. Препараты помогают организму самостоятельно начать работать так, как ему и положено. Гомеопатические средства восстанавливают гормональный баланс, благодаря чему исчезает фактор, который провоцирует развитие гиперплазии. У женщин восстанавливается регулярный менструальный цикл и улучшается общее самочувствие. После лечения гомеопатией, заболевание не рецидивирует, препараты не вызывают аллергических реакций и других побочных действий. Многие пациентки отмечают эффективность лечения уже в первый месяц применения гомеопатических средств.

На сегодняшний день, к сожалению, огромное количество представительниц прекрасного пола страдают различными заболеваниями половых органов. Самое страшное — это то, что подавляющее большинство таких больных относятся к недугам довольно безответственно. На самом деле эти заболевания требуют немедленного обращения в женскую консультацию к хорошему гинекологу, так как последствия запущенной болезни могут быть самые непредсказуемые. Осложнять положение может также и тот факт, что не все женские заболевания имеют четко выраженные симптомы. Например, изменение структуры слизистой оболочки матки, а также ее состава вызывает такая болезнь, как гиперплазия эндометрия. Лечение данного недуга должно быть незамедлительным во избежание серьезных последствий, но этому мешает то, что гиперплазия обычно себя совершенно никак не проявляет.

Это не что иное, как увеличение слизистого слоя стенок матки сверх нормы. Обычно у вполне здоровых представительниц слабого пола происходит увеличение эндометрия во время менструального цикла. Это необходимо для того, чтобы при зачатии оплодотворенная яйцеклетка без проблем была принята подготовленной маткой. Если зачатия не было, то увеличенная слизистая отделяется от стенок и выводится из организма вместе с кровью и неоплодотворенной яйцеклеткой. Если происходят сбои в нормальной работе этой системы, то эндометрий может увеличиться намного больше нормы, что и говорит о серьезных нарушениях.

Любое заболевание половых органов у женщин может привести к такому серьезному осложнению, как бесплодие. Особенно часто к этому приводит гиперплазия этой патологии зависит в первую очередь от его вида. Различают железистую, кистозную, атипическую и очаговую гиперплазии. По сути, любая из этих разновидностей представляет собой опухоль, только если первые два вида состоят из доброкачественных клеток, то последние два — из злокачественных. Они как раз и создают огромную угрозу здоровью и подлежат оперативному вмешательству.

Многим женщинам, имеющим различные «женские» заболевания, известна трава с интересным названием С ее помощью также лечится и гиперплазия эндометрия. Лечение народными средствами вообще сейчас стало довольно распространенным и, мало того, эффективным. Использовать боровую матку в лекарственных целях рекомендуется в виде настойки, а не отвара. Для этого на 100 грамм сухой травы берется пол-литра спирта. Его можно заменить водкой либо коньяком. Далее полученная смесь должна хорошо настояться. Сделать это также следует правильно. На свету оставлять настойку нельзя, следует поместить емкость в темном помещении и периодически перемешивать содержимое. Через два-три месяца можно употреблять настойку не менее трех раз в день по одной чайной ложечке. Используя подобные рецепты, можно избавиться от многих недугов. В их числе и гиперплазия эндометрия.

Лечение травами, конечно же, не самый быстрый процесс избавления от болезни. Гораздо быстрее с ней справятся хирурги. Как правило, они прибегают к методу выскабливания поврежденных участков эндометрия. Обычно в ходе подобных операций пациентка теряет довольно большое количество крови, что может значительно ослабить весь организм. Поэтому первым, о чем следует подумать женщине после операции, это восстановление нормального уровня гемоглобина. Помочь в этом может настойка крапивы, которая оказывает мощное воздействие на организм и позволяет восстановиться в течение короткого времени. В любом случае проводить самолечение не стоит. Лучше всего хотя бы посоветоваться с опытным гинекологом.

Гиперплазией эндометрия называют доброкачественное разрастание внутреннего слоя эндометрия, которое приводит к его утолщению и увеличению объема. Лечение гиперплазии эндометрия травами применяется давно и часто успешно.

Лечение гиперплазии эндометрия боровой маткой

Одними из наиболее успешных и популярных среди народных методов лечения гиперплазии эндометрия являются спиртовые настойки . Чтобы приготовить спиртовой настой из этой травы, необходимо предварительно ее засушить. Затем поместить засушенную заготовку в бутылку из темного стекла. Заливают это половиной литра спирта (обязательно сорокаградусного), можно использовать водку или коньяк. Каждый день содержимое аккуратно помешивают и снова убирают в сухое темное место. Спиртовая настойка будет готова через две недели.

Теперь несколько слов, как лечить гиперплазию эндометрия при помощи приготовленного спиртового настоя. Когда пройдет две недели, начинайте принимать средство по одной чайной ложке трижды в день. После приема необходимо запить небольшим количеством воды. Курс длится три месяца.

Народное лечение гиперплазии эндометрия проводят и другим способом. Вместо настойки можно приготовить отвар. Для этого одну столовую ложку травы заливают половиной литра кипятка. Затем ставят кастрюльку на очень медленный огонь, лучше на водяную баню, и выпаривают в течении 15 минут. Полученное количество отвара необходимо выпить за час до еды в три приема.

Красная щетка при гиперплазии эндометрия

Если вы собираетесь применять травы при гиперплазии эндометрия, всегда предварительно проконсультируйтесь со специалистом. К примеру, у красной щетки есть ряд противопоказаний: беременность, прием гормональных препаратов, гипертония и повышенная нервная возбудимость.

В народной медицине при данное средство применяют в виде настоя. Для приготовления необходимо 50гр измельченного корня залить половиной литра хорошей водки. Все это помещают в стеклянную посуду и хранят в темной прохладном месте в течении 30 дней. В процессе настаивания необходимо периодически взбалтывать содержимое. По истечению времени настойку процеживают.

Как лечить гиперплазию эндометрия: по 30-40 капель трижды в день принимать за полчаса до еды. Курс лечения длится 30 дней. Между курсами делают перерыв 10-15 дней и повторяют в случае необходимости.

Лечение гиперплазии эндометрия другими травами

Для лечения гиперплазии эндометрия народными средствами часто применяют целые сборы. Укорить выздоровление поможет сбор из корней змеевика, травы пастушьей сумки, корня аира, спорыша и листьев крапивы.

Для приготовления отвара смешивают все компоненты в соотношении 1:1:2:2:2:2. Затем смесь измельчают и заваривают две столовые ложки в половине литра кипятка. Все это на очень медленном огне кипятят в течении 15 минут. Переливают в термос или накрывают кастрюльку крышкой и укутывают полотенцем. Ставят отвар на полчаса настаиваться.

Лечение гиперплазии эндометрия народными средствами проводят по следующей схеме. За один прием необходимо выпить 100мл средства. Курс лечения составляет одни месяц. Затем следует перерыв в 10 дней и повторение курса при необходимости.

Эффективно применение настоя из травы манжетки и пульсатиллы. Оба ингредиента необходимо взять в равных количествах, измельчить и заварить одну чайную ложку сбора в стакане кипятка. Дать немного настояться и остыть, затем процедить. В день выпивают настой в три приема. Курс такой же, как и в предыдущем рецепте.

Гиперплазия эндометрия — процесс неконтролируемого роста тканей, напоминающих по своим свойствам эндометрий вне матки. Эндометрий — это совокупность клеток, выстилающих внутренний слой матки и выходящих во время менструации. Лечение эндометриоза, которое предлагают врачи, включает в себя прием гормональных препаратов и хирургическое вмешательство. Однако чаще всего людям с таким диагнозом лечение стандартными медикаментозными способами не помогает.

Почему именно боровая матка

У больных, как правило, снижается уровень прогестерона в организме, поэтому рекомендуется гормональное лечение. Необходимые для увеличения содержания гормонов натуральные микроэлементы и фитогормоны содержатся в ортилии однобокой. Она может оказать лечебное воздействие на организм, при этом не разрушая внутренние органы, как это происходит при приеме синтетических гормональных препаратов.

Боровая матка или ортилия

Ортилия однобокая или, как ее называют в народе, боровая матка — довольно распространенное лекарственное растительное сырье, которое применяется при лечении болезней мочеполовой системы. В лечебных целях применяют стебли, листья и цветы этого растения. В состав боровой матки входят следующие вещества: арбутин, гликозиды, дубильные вещества, гидрохинон, флавоноиды, метиларбутин, ренифолин, кумарины, витамин С, смолы, химафилин, органические кислоты. Она также содержит особые фитогормоны, которые помогают восстановить гормональный фон.

Применение

Для лечения гиперплазии эндометрия чаще всего применяют спиртовые настойки ортилии однобокой. Для ее приготовления берут высушенное сырье и кладут в емкость из темного стекла, затем туда наливают пол-литра спирта не более пятидесяти процентного, коньяка или водки. Эту смесь оставляют на две недели в месте без доступа солнечных лучей и помешивают каждый день в течение этого срока. Приготовленное средство принимают три раза в день по одной чайной ложке, запивая его водой. Курс лечения продолжают в течение трех месяцев. Это растение также можно приготовить как отвар. На одну столовую ложку травы необходимо взять пол-литра кипятка и кипятить на водяной бане в течение 15 минут. Полученное лекарственное средство нужно пить три раза в день за час до приема пищи.

Что такое гиперплазия эндометрия, симптомы заболевания, методы лечения

Симптомы и лечение гиперплазии эндометрия матки в зависимости от вида

Чрезмерное разрастание эндометрия матки классифицируется в гинекологии как гиперплазия. Патология может диагностироваться в любом возрасте, но чаще это происходит в период серьезных гормональных перестроек, во время предменопаузы, климакса. Лечение гиперплазии эндометрия матки зависит от того, какой конкретно вид заболевания диагностируется гинекологом.

Как проявляется заболевание

Основной признак рассматриваемой патологии – межменструальные кровотечения разного характера. В подростковом возрасте они мажущие, слегка коричневые и вязкие, в более старшем – практически всегда обильные, что может привести к большой кровопотере и анемии.

Симптомы железистой гиперплазии эндометрия: боль, возникающая сразу после полового акта, обильные желтовато-коричневые слизистые выделения, чувство присутствия инородного тела («шарика») внизу живота, отсутствие кровянистых выделений.

Чаще всего гинекологи диагностируют заболевание «случайно», в ходе диспансеризации или обычных профилактических осмотров.

Методы диагностирования гиперплазии эндометрия

«Несанкционированные» кровянистые выделения не всегда являются признаком рассматриваемой патологии. Для уточнения диагноза гинеколог проведет ряд обследований.

Кровь и мазок из влагалища и цервикального канала в данном случае неинформативны. А признаки сложной гиперплазии эндометрия не являются веским доводом для постановки заключительного диагноза. Единственное, что имеет целесообразность, – инструментальные исследования пациентки: ультразвуковое, лапароскопическое, диагностическое выскабливание при гиперплазии эндометрия для последующего гистологического исследования.

Как лечат патологию

Даже если заболевание никак себя не проявляет и женщина не предъявляет жалоб, а сама патология была диагностирована «случайно», обязательно нужно проводить лечение. Многие женщины считают, что если гиперплазия эндометрия развилась в менопаузе, то ее можно не лечить, поскольку «репродуктивная функция уже исчерпана, беременность не планируется». Но гинекологи не раз отмечали перерождение этой патологии в онкологию. Причины атипической гиперплазии эндометрия до сих пор до конца не выяснены. Своевременно проведенное лечение предотвратит развитие злокачественного заболевания.

Терапевтическое (медикаментозное) лечение

Оно применяется в отношении каждой пациентки, у которой была диагностирована патология, независимо от возраста. Выбор падает, в первую очередь, на оральные контрацептивы гормонального ряда – Жанин или Ярина. Эти препараты назначаются для лечения гиперплазии эндометрия у девушек и женщин детородного возраста. Курс терапии – не менее 6 месяцев.

Гестагенные препараты назначаются пациенткам любого возраста. Если заболевание диагностировано у молодых женщин, то им по назначению врача может быть поставлена гестагенная внутриматочная спираль. Такой вид лечения называется локальным, поскольку воздействие оказывается непосредственно на патологически измененные участки эндометрия.

Простая гиперплазия эндометрия в постменопаузе может лечиться обычными гормональными препаратами. Так как этот возраст не подразумевает деторождения, женщина находится под постоянным наблюдением врача с обязательным проведением лабораторных исследований биологического материала с целью своевременной диагностики перерождения здоровых клеток в онкологию.

В качестве дополнительной терапии назначаются витамины, а также некоторые физиопроцедуры – например, эффективным будет электрофорез.

Хирургическое лечение

Как лечить гиперплазию эндометрия в постменопаузе, если прием гормональных препаратов не дает положительных результатов и патология прогрессирует? Врачи в таком случае рекомендуют провести хирургическое вмешательство щадящего типа – выскабливание патологически измененного эндометриального слоя. После операции женщина выписывается на амбулаторное лечение. В послеоперационный период ее могут беспокоить незначительные кровянистые выделения и тянущие боли внизу живота.

В случае выявления атипичных клеток эндометрия рекомендуется провести полное иссечение эндометриального слоя. Такая манипуляция проводится лазером, после чего удаленный слой никогда не восстанавливается.

Консультацию по поводу рассматриваемого заболевания, а также ответ на вопрос, что такое железисто-кистозная гиперплазия эндометрия, можно получить у практикующих гинекологов. Записаться к ним на консультацию можно на нашем сайте Добробут.ком.

Связанные услуги:
Гинекологический Check-up
Кольпоскопия

Гиперплазия эндометрия — симптомы и лечение у взрослых. МЦ «Здоровье» в Москве ЮАО (Варшавская и Аннино), ЦАО (Краснопресненская и Рижская).

Гиперплазия эндометрия представляет собой чрезмерное разрастание слизистой матки.

Причинами этого могут быть

  • Аборты, выскабливания
  • Эндокринные патологии
  • Воспалительные заболевания урогенитальной системы
  • Заболевания, передающиеся половым путем (ЗППП)
  • Наследственная предрасположенность

Кто чаще заболевает гиперплазией эндометрия?

  • Девочки-подростки: гормональный скачок нередко вызывает развитие гиперплазии эндометрия
  • Женщины во время менопаузы: гормональная перестройка также может вызвать гиперплазию
  • Женщины различного возраста с патологиями эндокринной системы
  • Женщины различного возраста, проживающие в неблагоприятных экологических условиях

Чем опасна гиперплазия эндометрия?

Нередко это заболевание перерастает в онкологическую патологию. Тем опаснее, что гиперплазия развивается исподволь, бессимптомно. Поэтому можно пропустить начальные стадии рака, когда это опасное для жизни состояние еще можно излечить.

Как проявляется гиперплазия эндометрия?

Одним из главных признаков этой патологии считаются нециклические кровотечения, нередко сопровождающиеся задержками месячных. Выделения от умеренных до мажущих, что не вызывает тревоги у пациентки. При гиперплазии не возникает дискомфорта ни в повседневной жизни, ни во время интимной близости. Именно поэтому распознать гиперплазию может только гинеколог во время осмотра.

Как и где лечить гиперплазию эндометрия?

Лечение данной патологии должен назначить специалист, чаще всего оно заключается в приеме гормональной терапии, очень редко с применением оперативного вмешательства. Особо хочется отметить, что никакими народными средствами гиперплазия не лечится! Обратитесь в клинику «Здоровье», не затягивайте! Наши специалисты обязательно помогут вам.

>

Традиционная китайская медицина для лечения гиперплазии эндометрия путем регуляции оси ГПО у крыс

Дисфункциональные маточные кровотечения, сопровождающиеся гиперплазией эндометрия (ГЭ), являются распространенным гинекологическим заболеванием, серьезно влияющим на физическое и психическое здоровье женщин. Некоторые лекарства были предложены для лечения болезни, но большинство лекарств имеют определенные побочные эффекты и ограничения. В настоящем исследовании мы продемонстрировали неиспользованный препарат традиционной китайской медицины, комбинацию Saururus chinensis , Celosia cristata и Spatholobus suberectus (SCS), которые можно использовать для лечения ЭГ и связанных с ней осложнений у крыс.Мы идентифицировали активные компоненты трех китайских трав с помощью методов тонкослойной хроматографии и высокоэффективной жидкостной хроматографии. Кроме того, биохимические показатели сыворотки и результаты гистологических срезов показали, что острое введение высоких доз ГКС не оказывало неблагоприятного воздействия на крыс. Затем мы показали, что SCS сокращал время коагуляции () и степень отека () у крыс через 30 минут по сравнению с контрольным контролем. Дальнейшие исследования показали, что восстановление толщины эндометрия связано с модуляцией четырех гормонов (фолликулостимулирующего гормона, лютеинизирующего гормона, эстрогена и прогестерона).В частности, содержание фолликулостимулирующего гормона и прогестерона постепенно увеличивалось со временем, а эстрогена снижалось, в то время как содержание лютеинизирующего гормона возвращалось к норме после кратковременного повышения (12). Кроме того, SCS повышал уровень экспрессии мРНК матриксной металлопротеиназы-1 (1) и тканевого ингибитора матриксной металлопротеиназы-1 (3) в эндометрии матки, способствуя восстановлению пролиферирующего эндометрия у крыс. В совокупности наше исследование показывает, что SCS оказывает глубокое лечебное воздействие на лечение EH и относительных осложнений и раскрывает механизм на молекулярном и генном уровне экспрессии.

1.
Введение

Дисфункциональные маточные кровотечения (ДМК), сопровождающиеся пролиферацией эндометрия, характеризующиеся чрезмерно обильными, длительными и частыми кровотечениями маточного генеза, являются частым заболеванием отделения неотложной помощи и гинекологии [1]. Наиболее ранняя гиперплазия эндометрия (ГЭ), характеризующаяся скоплением желез с простой тубулярной структурой, выстланной клетками, напоминающими пролиферативный эндометрий, и грибовидным выступом мембраны (пиноподом), является критическим показателем рецептивности эндометрия [2, 3].Основной причиной ГЭ и ДМК является дисфункция системы ГПО (гипоталамус-гипофиз-яичник) [4], что связано с экспрессией женских гормонов, в том числе фолликулостимулирующего гормона (ФСГ), лютеинизирующего гормона (ЛГ), прогестерон и эстроген [5, 6]. Внезапное снижение уровня эстрогенов у пациенток с пролиферирующим эндометрием вызывает апоптоз эпителиальных клеток эндометриальных желез, что приводит к неравномерному отторжению эндометрия [1]. Кроме того, внеклеточный матрикс эндометрия содержит множество макромолекул, таких как коллаген, гликопротеин и протеогликан, которые регулируются двумя ключевыми ферментами, матриксной металлопротеиназой (ММП) и тканевым ингибитором матриксной металлопротеиназы (ТИМП) [7].Исследования лечения ТКМ показали многообещающие результаты в отношении задержки менструального цикла для лечения ДМК и пролиферирующего эндометрия [8]. Кроме того, в большинстве стандартных методов лечения приоритет отдается пероральным препаратам половых гормонов и инъекциям, таким как нестероидные противовоспалительные препараты, транексамовая кислота, простагландины и эстрогены [9, 10]. Однако большинство препаратов имеют определенные побочные эффекты, которые сопровождаются тошнотой, рвотой и головными болями [11–13]. Следовательно, необходимо способствовать разработке новых эффективных препаратов для лечения больных ЭГ и ДМК.

Хорошо задокументировано, что традиционная китайская медицина (ТКМ) играет роль в защите и лечении заболеваний, связанных с бесплодием. Тем не менее, необходимо научное доказательство эффективности ТКМ, таких как основные активные компоненты и умеренная токсичность высоких доз. В частности, стандарты ТКМ по факторам фертильности, таким как частота овуляции, женский гормон и соответствующая толщина слизистой оболочки эндометрия, являются важными биомаркерами для оценки ТКМ заболеваний, связанных с фертильностью.Было продемонстрировано, что несколько лекарств и экстрактов играют ключевую роль в усилении свертывания крови, уменьшении воспаления и уменьшении маточных кровотечений у пациентов. Saururus chinensis , многолетнее растение, широко распространенное в северо-восточной Азии, способно бороться с воспалением, окислительным стрессом и пролиферацией, что позволяет лечить гиперплазию [14–17]. Аналогичным образом Celosia cristata применяется для лечения болезненных менструаций, болей в животе и кровохарканья [18–20].Кроме того, данные показали, что Spatholobus suberectus проявляет различные функции против окисления, вирусов, бактерий, рака и тромбоцитов [21-23]. Здесь мы определили, что комбинация Saururus chinensis , Celosia cristata и Spatholobus suberectus (SCS) оказывает положительное влияние на лечение ЭГ и относительных осложнений. Вкратце, мы обнаружили, что SCS сокращает время коагуляции и облегчает пролиферацию эндометрия за счет регуляции четырех гормонов и двух ключевых генов, участвующих в оси HPO.

2. Материалы и методы
2.1. Препараты Препараты

S. chinensis , C. cristata и S. suberectus кусочки отвара были приобретены на рынке Hunan Gaoqiao Market (Чанша, Китай), а стандартные контрольные кусочки отвара были получены от Китайского института инспекции. лекарственных средств и биопрепаратов для идентификации компонентов отваров ГКС. Каждый лекарственный материал превращали в грубый порошок с помощью обычного измельчителя, а затем измельчали ​​с помощью сверхтонкого измельчителя после сушки в печи (60°C, 12 часов).Полученные лекарственные ультратонкие кусочки хранили в проветриваемом и сухом месте для последующего использования.

2.2. Идентификация активных компонентов методом ТСХ

Тестовый раствор S. chinensis (10  мкл л) включает корни, стебли, листья и стандартный контрольный лекарственный раствор (10  мкл л), которые, соответственно, добавляли в силикагель. гелевую пластину, а затем помещают в хроматографический цилиндр, содержащий 10 мл петролейного эфира (60~90°C) и ацетона. Наконец, высушенные образцы опрыскивали красящим раствором 10% серной кислоты в этаноле и нагревали при 105°C до появления четких пятен.

Тестовый раствор C. cristata (10  µ л) и стандартный контрольный лекарственный раствор (10  µ л) добавляли в пластину с силикагелем и затем помещали в хроматографический цилиндр, содержащий 10 мл циклогексана-ацетона (5 : 1) отдельно. Два образца окрашивали 5%-ным раствором ванилин-серной кислоты и нагревали при 105°С до появления четких пятен.

Тестовый раствор S. suberectus (10  µ л) и стандартный контрольный лекарственный раствор (10  µ л) соответственно добавляли в пластину с силикагелем и затем помещали в хроматографический цилиндр, содержащий 10 мл хлороформа. метанол (20 : 1).Высушенные образцы наблюдали при длине волны 254 нм в системе формирования изображения ультрафиолетового геля и фотографировали.

2.3. Количественное определение активных компонентов методом ВЭЖХ

Для оценки концентрации полученных кусочков отвара мы использовали метод ВЭЖХ для проверки качества S. chinensis и S. suberectus согласно Китайской фармакопее 2010 [24]. (стандартный образец для C. cristata не регистрировался). Всего 0,5 г S.chinensis добавляли в 25 мл метанола на 30 мин, а затем обрабатывали ультразвуком (500 Вт, 25 кГц) в течение 40 мин. Был взят стандартный образец саухинона и превращен в раствор 40 мкг/мл с метанолом. Затем два типа образцов были обнаружены с помощью ВЭЖХ (YOUDAO2000). Предыдущая обработка S. suberectus соответствовала S. chinensis . Стандартный контрольный образец формононетина добавляли в раствор с концентрацией 40 мкг/мл в метаноле. Опять же, два типа образцов (формононетин и S. suberectus ) были обнаружены с помощью ВЭЖХ.

2.4. Животные и лечение

В соответствии с конверсионной реакцией на основе Китайской фармакопеи [24], три травы в нормальных дозах весили 0,875 г (т.е. S. chinensis весили 0,375 г, C. cristata весили 0,25 г , и S. suberectus массой 0,25 г) добавляли в 1 л 100% этанола и кипятили в течение 30 мин. Точно так же группа из 20 доз весила в общей сложности 17,5 г трав. После охлаждения остаток отфильтровывали и добавляли 1 л дистиллированной воды, кипячая в течение 30 мин, и остаток снова фильтровали.Полученный спиртовой экстракт концентрировали в порошок в вакуумной сублимационной сушилке и хранили для последующего использования. Перед внутрижелудочным введением полученный экстракт растворяли в соответствующем количестве физиологического раствора и хранили при 4°С.

Самки крыс SD, приобретенные у Hunan SJA Laboratory Animal Co., Ltd. (Чанша, Китай), использовались во всех экспериментах. Крысы SD содержались в специфических свободных от патогенов условиях в центре экспериментов на животных Хунаньского педагогического университета. Рацион крыс ежедневно обеспечивали племенным скотом класса B, и крысы имели свободный доступ к пище и воде во время исследования.Все протоколы этого исследования были одобрены Комитетом по этике Хунаньского педагогического университета. Процедуры этого исследования проводились в соответствии с рекомендациями Европейского сообщества (директива 2010/63/ЕС) по уходу и использованию экспериментальных животных.

2.5. Оценка токсичности острого высокодозового SCS

В общей сложности 12 здоровых самок крыс SD весом 130 ± 20 г выращивали по привычке в течение одной недели и случайным образом разделяли на следующие три группы: пустая контрольная группа (CK, внутрижелудочно вводили равный объем физиологического раствора), группа введения ГКС в обычной дозе (0.875 г/кг/день, ГКС) и группа введения 20 доз ГКС (17,5 г/кг/день, ГКС 20×). Нормальную дозу и 20-дозовый раствор ГКС получали, как описано ранее в разделе 2. 4, и использовали для введения соответственно. Четырем самкам крыс SD в группе внутрижелудочно вводили соответствующую концентрацию раствора в фиксированное время в течение семи дней подряд и кормили 25 мкг/день племенных крыс класса B. В конце лечения крыс забивали под легким эфирным наркозом и отбирали образцы плазмы для расчета висцеральных коэффициентов и биохимических показателей крови.

Кроме того, чтобы оценить безопасность SCS для крыс, мы взяли два органа (печень и почки) у крыс и изобразили гистологические срезы на основе образцов. Образцы чистых органов погружали в нейтральный формалин на одну неделю, а затем обезвоживали градиентом этанола. Раствор ксилола использовали для прозрачной обработки, затем образцы заливали парафином. Парафиновые срезы были нарезаны толщиной 5  мкм мкм и помещены на предметные стекла superfrost plus.Каждый десятый срез окрашивали гематоксилином и эозином и исследовали с помощью световой микроскопии.

2.6. Определение эффектов гемостаза и коагуляции

Здоровые самки крыс SD весом 200 ± 20 г были адаптивно выращены в течение одной недели и случайным образом разделены на следующие три группы (каждая группа состояла из четырех крыс): CK (внутрижелудочно вводили физиологический раствор), нормальный группа положительного контроля дозы Gongxuening (сертифицированное китайское патентованное лекарство с лечебным действием на DUB, 0,13   г / кг / день, GXN) [25] и группа SCS с нормальной дозой (SCS). Четырем самкам крыс на клетку вводили внутрижелудочно в фиксированное время каждый день в течение 30 дней. Через тридцать минут после окончания введения через желудочный зонд 30 th  d у крысы отрезали хвост на расстоянии 0,5 см от кончика и отсчитывали время от спонтанного истечения крови до остановки кровотечения. Между тем, мы использовали чистую булавку каждые 15 с, чтобы поднять нижнюю часть капли крови, пока не появились нити фибрина, а затем записали время свертывания крови. Кроме того, в правую ногу каждой крысы вводили 0.1 мл 10% солевого раствора яичного белка. Объем стопы крыс регистрировали через 10 мин, 20 мин и 30 мин после инъекции, а данные об объеме отека стопы получали для расчета степени детумесценции крыс.

2.7. Эндометриальная гиперплазия крыс Учреждение

Здоровые самки крыс SD весом 200 ± 20 г были адаптивно выращены в течение одной недели и случайным образом разделены на пустой контроль (СК, n  = 8) и модельную группу ( n  = 24). Крысам в модельной группе внутримышечно вводили бензоат эстрадиола 1 мг/кг через день, чтобы получить модельных крыс EH, как описано ранее с небольшими модификациями [26].После 60-дневных инъекций крысы модели ЭГ были случайным образом разделены на три группы: группа модели ЭГ (ЭГ, введение через желудочный зонд равного объема физиологического раствора), группа GXN с нормальной дозой (GXN, 0,13   г/кг/сут) и группа SCS ( СКС, 0,875 г/кг/сутки). Контрольной группе давали такое же количество носителя (диметилсульфоксид). Два разных препарата (GXN и SCS) были приготовлены с физиологическим раствором для приготовления суспензии, а группе CK внутримышечно вводили 0,9% раствор хлорида натрия. На 0-й, 3-й и 7-й день введения из каждой группы случайным образом отобрали по четыре крысы для проверки толщины эндометрия и активности серозных гормонов.

2.8. Сканирующая электронная микроскопия

Гистологические изменения в эндометрии были обнаружены с помощью сканирующей электронной микроскопии (СЭМ). После анестезии в нижней части живота крыс делали разрез (3  см), а затем из разреза отделяли рог матки (1  см). Эндометрий отделяли пинцетом и фиксировали 2% пентандиолом и 1% осмиевой кислотой с последующей дегидратацией градиентом этанола. Затем образцы заливали, и с помощью микротома получали полутонкие и ультратонкие срезы.Изображения были сфотографированы в РЭМ (модель Carl Zeiss-EVO-40) с ускоренным напряжением 10 кВ при увеличении ×2000.

2.9. Определение четырех ключевых ферментов и экспрессии генов MMP-1 и TIMP-1

Как упоминалось ранее [4], четыре важнейших гормона, регулируемые осью HPO, связаны с гиперплазией эндометрия. Следовательно, концентрации прогестерона, эстрогена, ФСГ и ЛГ в крови крыс SD (propstrum) определяли в соответствии с принципами и процедурами наборов ELISA (иммуноферментный анализ) (Shanghai Jianglai Biological Co., ООО). Оптическая величина каждого образца была измерена при 450 нм с использованием считывателя ELISA (Synergy HTX, BioTek).

Яичники и матку брали сразу после вскрытия крыс и определяли уровни экспрессии мРНК матриксной металлопротеиназы-1 (ММР-1) и тканевого ингибитора матриксной металлопротеиназы-1 (ТИМП-1) с помощью технологии RT-qPCR. Ace qPCRSYBR Green Master Mix (Vazyme, Нанкин, Китай) использовали для расшифровки очищенной РНК из образцов крыс. Дизайн флуоресцентного праймера выполняли с использованием Primer 6.0, а подробные последовательности смысловых праймеров представляли собой «ACTCCCTTGGACTCACTCATT» и «ACCAGCGTTATGAGATCAAGATGA», а последовательности антисмысловых праймеров представляли собой «GTGTTGTTGCACCTGTTGG» и «TGCCCAGGGAACCAGGAA» для MMP-1 и TIMP-1 соответственно. Ген Actin- β использовали в качестве внутреннего стандарта для последовательности праймера RT-qPCR. Процесс амплификации представлял собой один цикл при 95°C (5 мин), 40 циклов при 95°C (15 с), 55°C (30 с) и 72°C (30 с) с последующим испытанием кривой плавления с использованием температурный диапазон от 60°С до 95°С. В системе RT-qPCR проводили три биологических повтора. Метод 2 -ΔΔCT был принят для анализа относительных уровней экспрессии генов.

2.10. Анализ данных

Статистический анализ, связанный с концентрацией органного коэффициента, биохимическим индексом сыворотки, уровнями экспрессии ферментов и генов, выполнялся с использованием однофакторного дисперсионного анализа с последующим апостериорным тестом или двухфакторного дисперсионного анализа с повторными измерениями (GraphPad Prism, V.5.02, GraphPad Software, Inc.). Для обработки рисунков использовались Adobe Photoshop CS6 и Adobe Illustrator CC.Значения были представлены как среднее ± стандартная ошибка.

3. Результаты
3.1. Обнаружение первичных функциональных компонентов лекарственных материалов

В настоящем исследовании были идентифицированы активные компоненты из трех частей отвара ( S. chinensis , C. cristata и S. suberectus ) с относительными стандартными препаратами. Как показано на рисунке 1, ТСХ листьев, корней и стеблей S. chinensis показала, что препарат S. chinensis имеет те же цветовые пятна, что и стандартный контрольный препарат.Между тем, как C. cristata , так и S. suberectus давали сходные пятна на соответствующих позициях стандартной контрольной хроматографии. Кроме того, результаты ВЭЖХ показали, что S. chinensis и S. suberectus демонстрируют тот же паттерн экспрессии на основных функциональных пиках, что и соответствующие контрольные препараты саухинона ( y  = 2,3904 x  + 0,435, R 2  = 0,9999) и формононетин ( y  = 1.6514 x  + 0,411, R 2  = 0,9997) (рис. 2), демонстрируя, что саухинон и формононетин являются двумя активными веществами в препарате СКС.

3.2. Высокие дозы ГКС не оказывали значительного токсического воздействия на крыс

После ежедневного введения крыс внимательно наблюдали за крысами, и результаты показали, что в трех сравнениях не было обнаружено каких-либо заметных изменений массы тела (рис. 3(а)). Примечательно, что значения органного коэффициента селезенки, почек и яичников не изменились (), но показатель печени значительно увеличился () у крыс, получавших высокие дозы СКС (рис. 3(б)), тогда как нормальная доза Препарат ГКС не показал изменений печеночного коэффициента по сравнению с группой КК () (рис. 3(б)).По результатам биохимических показателей крови острое лечение высокодозированными препаратами ГКС не вызывало побочных эффектов у крыс. Чтобы быть более точным, концентрация общего белка, альбумина, мочевины, общего холестерина, лактатдегидрогеназы и щелочной фосфатазы, а также соотношение аланинаминотрансферазы/аспартатаминотрансферазы (АЛТ/АСТ) не показали существенных биологических различий между острым высокодозным ГКС и контрольные крысы (рис. 3(c)~3(i)). Кроме того, содержание общего белка плазмы было снижено у нормальных крыс, получавших СКС (), но значение было в пределах нормы.

Впоследствии мы продемонстрировали безопасность ГКС на основании изображений гистологических срезов печени и почек. Патологический срез почки крысы показал, что количество клубочков и канальцев в группе с нормальной и высокой дозой СКС было немного выше, чем у контрольных крыс, но без других значительных изменений (рис. 3(j)). Результаты патологических срезов печени показали, что щелевые контакты между гепатоцитами в группах СХП (как с нормальной, так и с высокой дозой) и в контрольной группе существенно не изменились на 3-й и 7-й день (рис. 3(k)), что указывает на то, что СХП не оказывает значительных побочных эффектов на почки или печень.

3.3. Препарат SCS продемонстрировал гемостатический, противовоспалительный и детумесцентный эффекты

Обычные препараты для лечения ЭГ обладают функциями гемостаза, противовоспалительного действия и детумесценции. Поэтому в этом исследовании дополнительно сравнивалось влияние SCS и GXN на гемостаз, противовоспалительное действие и детумесценцию у крыс. По сравнению с группами CK и GXN, SCS обладал эффектом ускоренного свертывания крови у крыс с переломом хвоста () (рис. 4 (а)), и аналогичные изменения во времени гемостаза также наблюдались у крыс (рис. 4 (b)).Однако, хотя и SCS, и GXN обладали определенными гемостатическими функциями, существенной разницы между двумя препаратами не было. По сравнению с нормальными крысами время гемостаза как SCS (), так и GXN () было немного уменьшено. Кроме того, после инъекции солевого раствора яичного белка относительный отек пальца ноги у крыс SCS резко уменьшился через 20 () и 30 () мин по сравнению с 10 мин, и препарат показал отчетливый эффект детумесценции по сравнению с CK () и GXN () через 30 мин. мин (рис. 4(в)). Примечательно, что результаты гематической фазы показали, что содержание эритроцитов (), гемоглобина () и гематокрита () были снижены после лечения ГКС, что указывает на то, что препарат ГКС может облегчить воспаление и отек, связанные с застоем крови (таблица 1).

+

Тестовые предметы CK GXN ГКС

Лейкоцитов (109 / л) 24,70 ± 1,68 23,23 ± 2,42 14,27 ± 3. 84
Лимфоциты (%) 57.30 ± 0,17 89.61 ± 2.23 63,60197 63,60 ± 6.51
Monocyte (%) 5.43 ± 0.58 4.42 ± 1,29 5,40 ± 0,85
Нейтрофильная (%) 37,27 ± 0,44 23,32 ± 2,31 40,00 ± 7,01
эритроцита (1012 / л) 8,16 ± 0,67 4,24 ± 2.13 3,67 ± 0,99
Гемоглобин (г / л) 174,67 ± 16,70 140,09 ± 21,03 77,67 ± 20,34
Гематокрит (%) 45,43 ± 4,17 26,89 ± 2,83 20.23 ± 5,32
MCV (фл) 55,63 ± 0,47 48,78 ± 2,78 56,20 ± 1,01
МСН (пг) 21,30 ± 0,35 19,27 ± 1,49 21,23 ± 0,96
МСНС (г / л) 384,00 ± 4,36 392,11 ± 3,42 383,33 ± 9,60
RDW (%) 10,27 ± 0,18 9,78 ± 1,21 12,57 ± 2,47
Тромбоциты (109/л) 153. 00 ± 23,30 222,31 ± 43,97 200,00 ± 68,60
MPV (фл) 6,13 ± 0,18 6,12 ± 0,78 6,80 ± 0,38
PDW (%) 17,23 ± 0,24 13,90 ± 2,11 18,50 ± 0,21
РСТ (%) 0,26 ± 0,17 0,19 ± 0,08 0,14 ± 0,05

MCV: средний объем эритроцитов; MCH: средний корпускулярный гемоглобин; MCHC: средняя концентрация корпускулярного гемоглобина; RDW: ширина распределения эритроцитов; MPV: средний объем тромбоцитов; PDW: ширина распределения тромбоцитов; ПКТ: тромбоцитокрит.Данные в таблице были средним значением  ± SE, а звездочка () указывала на наличие значительной разницы () между группой CK и SCS/GXN.
3.4. Препарат SCS восстановил пролиферирующий эндометрий

В настоящей работе мы получили крыс EH для изучения SCS при лечении пролиферирующего эндометрия путем введения крысам бензоата эстрадиола в течение 60 дней подряд (рис. 5(b)). По результатам сканирующей электронной микроскопии мы обнаружили, что большая часть пиноподов (морфологический биомаркер эпителиальных клеток эндометрия) в ЭГ (рис. 5(в) и 5(е)) и GXN (рис. 5(г) и 5( g)) группы были атрофическими, полыми и разреженными после 3 и 7 дней введения.Напротив, пиноподы в клетках SCS постепенно восстанавливались до округлых через 7 дней после введения (рис. 5(h)). После 3-го дня введения толщина эндометрия у крыс SCS была резко уменьшена, и она сильно отличалась от крыс других экспериментальных групп на 7-й день (рис. 6). Важно отметить, что толщина эндометрия постепенно восстанавливалась до состояния CK, что указывает на то, что SCS можно использовать для лечения пролиферирующего эндометрия.



3.5. SCS изменил гормон, связанный с осью HPO, и экспрессию генов

Чтобы изучить молекулярный механизм SCS при лечении пролиферирующего эндометрия, мы затем обнаружили четыре элементарных гормона, участвующих в оси HPO. Результаты показали, что содержание ФСГ у крыс SCS постепенно увеличивалось со временем введения через желудочный зонд и было значительно выше, чем в группах CK (), EH () и GXN () на 7-й день (рис. 7 (a)). Интересно, что обе концентрации ЛГ у крыс GXN и SCS возвращались к норме после кратковременного повышения (рис. 7(b)).В сочетании с этим наблюдается снижение уровня эстрогена (рис. 7(с)) и повышение уровня прогестерона (рис. 7(d)). Кроме того, SCS значительно увеличивал экспрессию гена MMP-1, и его значимость была выше, чем у групп CK (), EH () и GXN () на 7-й день (рис. 8 (а)). Точно так же наблюдалась повышенная экспрессия гена TIMP-1 у крыс SCS, и уровень экспрессии был значительно выше, чем у групп CK (), EH () и GXN () на 7-й день (рис. 8 (b). ). Два типа активированных генов, MMPs и TIMPs, предполагают, что SCS может способствовать деградации гиперплазии эндометрия, регулируя изменения гормонов, связанных с осью HPO.

4. Обсуждение

Принимая во внимание характеристики ТКМ с низкой токсичностью и сложностью измерения летальной дозы [27], необходимо тщательно изучить вопросы безопасности, такие как продолжительность лечения, долговременная токсичность и дозозависимая токсичность. использование ТКМ. Например, многие виды Aristolochia в ТКМ использовались для лечения таких симптомов, как острый артрит и отек, но было обнаружено, что аристолоховая кислота, извлеченная из травы, способствует почечной недостаточности [28, 29].Следовательно, прежде чем препарат будет официально использоваться, необходимо провести острые эксперименты с высокими дозами для выявления токсичности SCS на крысах. Результаты неотложного лечения высокими дозами показали, что 20 доз ГКС не оказывали токсического воздействия на физиологические параметры, такие как масса тела, у крыс. Кроме того, как АЛТ, так и АСТ являются важными биомаркерами функционального тестирования печени [30]. Тем не менее значимость течения и прогноза заболевания можно определить только при изменении соотношения АЛТ/АСТ [31].Интересно, что гистологические срезы печени показали слегка увеличенные щелевые контакты между гепатоцитами у крыс SCS, что указывает на то, что препарат может повышать метаболическую активность печени у крыс. Таким образом, результаты биохимических показателей крови и гистологических срезов показали, что высокие дозы ГКС не оказывали явного влияния на печень крыс. Также у крыс СХС снижался общий белок, но удельный показатель был в пределах нормы [32]. Кроме того, ключевой компонент общего белка (т.э., альбумин) не показали изменений по сравнению с контрольной группой [33, 34]. Тем не менее, нельзя не отметить, что ГКС может вызывать легкую гепатотоксичность, особенно с учетом используемых доз и продолжительности лечения, и для оценки этого вопроса следует провести дальнейшую долгосрочную оценку. Также мы обнаружили, что СКС не оказывает существенного влияния на показатели других органов (почек, селезенки и половых органов). Таким образом, мы предположили, что СКС не оказывает явного токсического действия на крыс SD и может быть использован в последующих тестах.Нормальная доза SCS также может быть использована для клинического лечения ГЭ и относительных осложнений, но будущие клинические испытания обещают нам более убедительное использование лекарств.

ДМБ и пролиферирующий эндометрий могут вызывать ряд симптомов кровотечения, особенно постоянные и неконтролируемые маточные кровотечения. Поэтому необходимо выявить кровоостанавливающее, прокоагулянтное и противовоспалительное действие препарата. Симптомы гипервязкости характеризуются увеличением гематокрита и количества эритроцитов [35].Наши результаты показали, что значение эритроцитов, гемоглобина и гематокрита заметно снизилось, что указывает на то, что SCS регулирует содержание веществ в крови и снижает вязкость крови у крыс, тем самым уменьшая возникновение застоя крови. Этот вывод согласуется с предыдущими исследованиями, показывающими, что ротанг S. suberectus способен активировать кровообращение и устранять застой [36]. Кроме того, SCS также сокращал время коагуляции и устранял относительный отек пальцев стопы у крыс. Интересно, что это наблюдение согласуется с предыдущими исследованиями, в которых сообщалось о S.chinensis и C. cristata обладает эффективным прокоагулянтным и гемостатическим действием [37, 38]. Таким образом, наши результаты показали, что ГКС могут служить эффективным лекарственным средством при осложнениях, вызванных ЭГ, таких как кровотечение, застой и воспаление.

Нормальные маточные кровотечения вызываются периодическими изменениями в эндометрии, регулируемыми осью ГПО. Морфологические изменения функционального слоя эндометрия можно разделить на три фазы: пролиферативную, секреторную и менструальную [39].Во время менструального периода уровни эстрогена и прогестерона снижаются, что впоследствии вызывает снижение кровотока в эндометрии, что приводит к некрозу эндометрия из-за ишемии. Площадь поврежденной и ишемически некротизированной ткани постепенно расширялась, повышалась проницаемость стенки кровеносного сосуда, что в конечном итоге приводило к отслоению ткани [40, 41]. Ановуляторный ДМК возникает в результате продолжительной экспрессии эстрогена и ограниченной прогестиновой экспрессии, что может резко спровоцировать рост эндометрия и вызвать прорывное эстрогенное кровотечение у женщин [42, 43]. Важно отметить, что наши результаты показали, что пиноподы у крыс с ЭГ постепенно возвращались к функциональной морфологии после введения СКС, показывая, что препарат оказывает ингибирующее действие на ЭГ и является более значительным, чем контрастирующий препарат GXN. Аналогичное исследование также показало, что саухинон, активное вещество S. chinensis , способен ингибировать дифференцировку многоядерных клеток, специфичных для кости, путем регуляции пути митоген-активируемых протеинкиназ [44]. Следовательно, мы считаем, что ГКС может предотвратить возникновение ЭГ, тем самым уменьшая кровотечение, вызванное отторжением эндометрия.

Гонадотропин-рилизинг-гормон, секретируемый гипоталамусом, может индуцировать синтез ФСГ и ЛГ, тем самым способствуя развитию фолликулов и увеличивая секрецию эстрогенов [45–47]. ЛГ увеличивает секрецию прогестерона и приводит к овуляции. С увеличением уровней эстрогена и прогестерона изменения гормонов будут вызывать торможение с отрицательной обратной связью в гипоталамусе и гипофизе, тем самым снижая уровни ФСГ и ЛГ, что приводит к лютеиновой деградации [48-50]. Менструация возникает, когда эндометрий теряет поддержку этих двух гормонов, отслаивается и кровоточит. Дисбаланс секреции ФСГ и ЛГ влияет на продукцию эстрогенов и прогестерона, а затем индуцирует двустороннюю обратную регуляцию половых гормонов, что вызывает функциональные маточные кровотечения у женщин [51, 52]. Эстроген может регулировать развитие матки и стимулировать гиперплазию и утолщение эндометрия, тогда как прогестерон может стимулировать пролиферацию эндометрия при стимуляции эстрогеном.Уровень экспрессии обоих повышается одновременно, что может вызвать утолщение эндометрия и функциональные маточные кровотечения. Следовательно, мы предположили, что заторможенная гиперплазия эндометрия была вызвана СКС, регулирующим уровни экспрессии родственных гормонов у крыс. Результаты испытаний совпали с нашим мнением: после введения ГКС у самок крыс повысился уровень ФСГ и прогестерона, сначала повысился, а затем снизился ЛГ, снизился уровень эстрогенов. Повышение уровня ФСГ и ЛГ может способствовать нормальному развитию фолликулов и менструации. Важно отметить, что пониженное содержание эстрогена может ингибировать дисфункцию эндометрия, а сбалансированный уровень эстрогена и прогестерона вызывает нормальную менструацию. Этот вывод согласуется с другими исследованиями, в которых сообщается, что растительные формулы, такие как B401 (сертифицированный препарат на Тайване), могут уменьшать толщину эндометрия из-за повышенного содержания эстрадиола-17 β и снижения экспрессии рецептора эстрогена [53]. Следовательно, наши результаты показали механизм отрицательной обратной связи HPO, и содержание эстрогена и прогестерона не повышалось синергетически, тем самым предотвращая возникновение ЭГ.

ММП представляют собой группу протеаз, которые разрушают внеклеточный матрикс (ВКМ), и ТИМП могут специфически связываться с ММП, подавляя их активность и предотвращая дальнейшую деградацию ВКМ [7, 54]. Исследования показали, что MMPs и TIMPs отчетливо изменились у пациенток с эктопическим эндометрием [55]. Дисбаланс между MMPs и TIMPs способствует деградации ECM и увеличивает инвазивность эктопированного эндометрия [56]. ЭГ возникает в результате длительной стимуляции эндометрия непротиворечивым эстрогеном, и многие исследования показали, что ММР имеют значительную дифференциальную экспрессию при миомах матки, включая высокую экспрессию ММР-1, ММР-2 и ММР-9 и низкую экспрессию МТ1-ММР. , ТИМП-1, -2 и -3 [57–60].Таким образом, документально подтверждено, что повышенные уровни ММП и ТИМП уравновешивают дифференцировку миоматозных клеток, что согласуется с нашими выводами. В настоящем исследовании уровни экспрессии MMP-1 и TIMP-1 были резко повышены и были самыми высокими среди всех групп, что указывает на то, что SCS может сбалансировать экспрессию MMP TIMP и генов, тем самым способствуя деградации ECM и уменьшая EH. В совокупности для дальнейшего подтверждения этого потенциального механизма регуляции с помощью MMP, TIMP и женских гормонов необходимо сравнить изменения генов или промежуточных продуктов (например,g., белки, метаболиты, факторы транскрипции и микроРНК) как выше, так и ниже пути, связанного с ЭГ, и выявляют предполагаемые регулирующие факторы. Такое исследование поможет оценить и охарактеризовать модуляторный механизм и специфическую функцию ГКС для лечения ЭГ.

5. Заключение

В заключение, настоящее исследование подтверждает наличие активных компонентов трех традиционных китайских трав методами ТСХ и ВЭЖХ. Острая проба с высокими дозами определяет безопасность ГКС при лечении ЭГ и ДМК.Эта работа предоставляет доказательства того, что изменения гормонов и мРНК, вызванные введением SCS через зонд, могут улучшить ЭГ крыс. Кроме того, этот препарат способен уменьшать застой крови, усиливать коагуляционный и противовоспалительный эффекты, что может быть использовано для лечения осложнений ГБ. В совокупности этот интегрированный анализ создает перспективную стратегию лечения ЭГ и ДМК и играет большую роль в продвижении китайской медицины.

сокращения
TCM: TCM: Традиционная китайская медицина
SCS: Saururus Chinensis , Celosia Cristata , Spatholobus Suberectus
TLC: Тонкослойная хроматография
ВЭЖХ: Высокоэффективная жидкостная хроматография
HPO: Гипоталамус-гипофиз-яичники
DUB: дисфункциональное маточное кровотечение
ФСГ: Фолликулостимулирующий гормон
LH: лютеинизирующего гормона
GXN: Gongxuening капсула
CK: Бланк контрольной группы
EH: гиперплазия эндометрия
СЭМ: сканирующей электронной микроскопии
ММП -1: Матрица металлопротеиназы-1
ТИМП-1: ингибитор тканевого матрицы металлопротеиназы-1
ТР: Общий белок
ALT: аланинаминотрансферазы
АСТ: Аспартатаминотрансфераза.
Доступность данных

Данные, использованные для поддержки результатов этого исследования, можно получить у соответствующего автора по запросу.

Этическое одобрение

Все процедуры проводились в соответствии с рекомендациями комитета по этике Хунаньского педагогического университета.

Раскрытие информации

Рукопись отправлена ​​в препринт для быстрого доступа.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

Ли-цзюнь Чен и Чжи Ван внесли свой вклад в концептуализацию и методологию. Bo Lv курировал данные и писал первоначальный проект. Юань-де Пэн осуществил написание первоначального проекта, визуализацию и подготовку материала. Вэнь-хуэй Фу и Вэнь-цзин Ли провели исследование и подготовку материала.

Благодарности

Эта работа была поддержана Управлением по контролю и исследованиям тропических болезней Министерства образования Китая (2018kfkt03), Научно-исследовательским проектом Департамента образования провинции Хунань (16C0778) и Ключевым проектом Департамента образования провинции Хунань (18A024) .

(PDF) Традиционная китайская медицина для лечения гиперплазии эндометрия путем регулирования оси HPO у крыс

[26] AO Olowofolahan, «Метилпальмитат реверсировал эстрадиол

бензоат-индуцированную гиперплазию эндометрия у самок крыс»,

Токсикология Механизмы и методы, том. 31, стр. 43–52, 2021.

[27] С. Х. Лю, «Наблюдение за безопасностью традиционной китайской медицины:

настоящее и будущее», Безопасность лекарств, том. 38, стр. 117–128, 2015.

[28] CH Chen, «Аристолоховая кислота, индуцированная уротелиальной карциномой верхних мочевых путей

на Тайване: клинические характеристики и результаты»,

International Journal of Cancer, vol. 133, стр. 14–20, 2013.

[29] LJ Vanherweghem, «Неправильное использование растительных лекарственных средств: случай

вспышки терминальной почечной недостаточности в Бельгии (китайская нефропатия

трав)», Journal of Alternative & Дополнительная-

Медицина, том. 4, стр. 9–13, 1998.

[30] Ю. Лю, «Соотношение АСТ и АЛТ и жесткость артерий в нежировой печени

населения Японии: вторичный анализ, основанный на поперечном исследовании

», «Липиды в здоровье и болезни», том. 17,

с. 275, 2018.

[31] Х. Хаттаб, «Связь уровней АЛТ и АСТ с гистопатологическими изменениями в биоптатах печени пациентов с хроническим

гепатитом С генотипа 4», Arab J Gastroenterol, vol. 16,

, стр. 50–53, 2015.

[32] L. Lin, «l-теанин регулирует метаболизм глюкозы, липидов и белков через сигнальные пути инсулина и AMP-активируемой протеинкиназы

», Food & Function, vol. 11, pp. 1798–1809,

2020.

. Анналы онкологии, том. 26,

, стр. 443-444, 2015.

[34] HW Guo, «Прогностическое значение соотношения альбумин/

глобулина перед лечением при раке пищеварительной системы: метаанализ»,

PLoS One, vol.13, Article ID e0189839, 2018.

[35] M.A. Gertz, «Острая гипервязкость: синдромы и лечение», Blood, vol. 132, стр. 1379–1385, 2018.

[36] F. Peng, «Новые изофлаваны из Spatholobus suberectus и

их цитотоксичность в отношении клеточных линий рака молочной железы человека»,

Molecules, vol. 24, с. 3218, 2019.

[37] Б. Х. Бао, «Охлаждение крови и гемостатический механизм

Celosia Cristatae Flos в крысиной модели синдрома жара крови и кровоизлияния

», Китайский фармакологический бюллетень, том.29,

, стр. 1457–1461, 2013.

[38] WJ Tsai, «Лигнаны из надземных частей Saururus chi-

nensis: изоляция, структурная характеристика и их влияние

на агрегацию тромбоцитов», Журнал натуральных продуктов, том. 77,

, стр. 125–131, 2014.

[39] В. Танос, «Морфологические характеристики и функциональные возможности эндометрия соединительной зоны

: обзор литературы»,

Гинекологическое и акушерское исследование, том.2020, ID статьи

1720316, 11 страниц, 2020.

[40] J. Jarrell, «Значение и эволюция менструации»,

Best Practice & Research Clinical Obstetrics & Gynaecology,

vol. 50, стр. 18–26, 2018.

[41] E. M. Lichten, «Менструальная мигрень и варианты лечения: обзор

», Headache, vol. 58, стр. 145-146, 2018.

[42] К. Джонс и С. Сунг, Ановуляторное кровотечение, StatPearls,

Остров сокровищ, Флорида, США, 2020.

[43] Е. Урбанска, «Связан ли синдром поликистозных яичников и резистентность к инсулину с аномальными маточными кровотечениями у подростков?» Ginekologia Polska, vol. 90, стр. 262–269, 2019.

[44] К. Ю. Хан, «Ингибирование дифференцировки остеокластов и резорбции кости

саухиноном», Биохимическая фармакология,

, том. 74, стр. 911–923, 2007.

[45] Н. Дас и Т. Р. Кумар, «Молекулярная регуляция фолликулостимулирующего синтеза, секреции и действия гормонов», Журнал

молекулярной эндокринологии, том.60, pp. R131–R155, 2018.

[46] Филатов М., Храмова Ю., Паршина Е., Багаева Т., Семенова

М. Влияние гонадотропинов на рост и развитие фолликулов яичников

in vivo и in vitro», Zygote, vol. 25,

, стр. 235–243, 2017.

[47] J. Smitz, «Фолликулостимулирующий гормон: обзор формы и функции

при лечении бесплодия», Reproductive Sciences,

vol. 23, стр. 706–716, 2016.

[48] Г.К.Di Renzo, I. Giardina, G. Clerici, E. Brillo и S. Gerli,

«Прогестерон при нормальной и патологической беременности», Hor-

mone Molecular Biology and Clinical Investigation, vol. 27,

, стр. 35–48, 2016.

[49] WH Utian, «Биосинтез и физиологические эффекты эстрогена

и патофизиологические эффекты дефицита эстрогена: обзор»,

, Американский журнал акушерства и гинекологии. . 161,

стр. 1828–1831, 1989.

[50] Х.Ye, «Интимные отношения рецептора эстрогена-альфа/лиганд

сигнализируют о биологической активности», Toxicology, vol. 408, pp. 80–87,

2018.

[51] Н.Г. Абдоллахи, М. Миргафурв и С. Моллазаде, «

влияние фенхеля на менструальные кровотечения: систематический обзор

и метаанализ». », Journal of Complementary and Integrative

Medicine, vol. 15, 2018.

[52] I. Chuah, A. McRae, K. Matthews, AM Maguire и

K. Steinbeck, «Управление менструальным циклом у девочек-подростков с задержкой развития

», Австралия и Новая Зеландия

Журнал акушерства и гинекологии, том.57, pp. 346–350,

2017.

[53] CH Wu, «Репродуктивная регуляция и окислительный стресс, al-

левиация терапии китайскими травами при овариэктомии

модели мышей», Evid Based Complement Alternat

Мед., том. 2019, ID статьи 5346518, 13 страниц, 2019.

[54] В. Арпино, М. Брок и С. Е. Гилл, «Роль ТИМП в

регуляции протеолиза внеклеточного матрикса», Matrix Biology,

vol. . 44–46, стр. 247–254, 2015 г.

[55] C. Uzan, «Эутопический эндометрий и перитонеальная, яичниковая и

эндометриоидная ткани кишечника экспрессируют различные профили

матриксных металлопротеиназ-2, -3 и -11, а также тканевых ингибиторов

металлопротеиназ- 1 и -2», Архив Вирхова,

vol. 445, pp. 603–609, 2004.

[56] T. Collette, C. Bellehumeur, R. Kats et al., «Доказательства

повышенного высвобождения протеолитической активности эутопической эндометриальной тканью». у женщин с эндометриозом и при участии матриксной металлопротеиназы-9, Human

Reproduction, vol.19, pp. 1257–1264, 2004.

[57] М. Юрларо, «Степень ангиогенеза и экспрессия матричных

металлопротеиназ-2 и -9 коррелируют с модернизацией и инвазией

миометрия при эндометриальной карциноме», European

Журнал клинических исследований, том. 29, pp. 793–801, 1999.

[58] J. D. Knox, «Экспрессия матрилизина в раке простаты человека

нома», Molecular Carcinogenesis, vol. 15, pp. 57–63, 1996.

[59] М. Маатта, «Локализация матричной РНК MT1-MMP, TIMP-1, TIMP-2,

и TIMP-3 в нормальных, гиперпластических и

неопластический эндометрий.Повышенная экспрессия

пробных аденокарцином эндометрия связана с низкой дифференцировкой»,

American Journal of Clinical Pathology, vol. 114, pp. 402–411,

2000.

[60] S. McDonnell, «Экспрессия и локализация матрикса

металлопротеиназной помпы-1 (MMP-7) в карциномах желудка и

толстой кишки человека», Молекулярная Канцерогенез, том. 4,

, стр. 527–533, 1991.

Доказательная дополнительная и альтернативная медицина 13

Мегестрол в лечении пациентов с неоплазией эндометрия или гиперплазией эндометрия — Полный текст

Лос-Анджелес, Калифорния, США,

Олив Вью — Медицинский центр Калифорнийского университета в Лос-Анджелесе
Силмар, Калифорния, США,
Хартфордская больница
Хартфорд, Коннектикут, США, 06102
Больница и медицинский центр Святого Франциска
Хартфорд, Коннектикут, США, 06105
Больница Центрального Коннектикута
Новая Британия, Коннектикут, США, 06050
Медицинский центр Мемориального университета
Саванна, Джорджия, США, 31404
Health Saint Anthony
Алтон, Иллинойс, США, 62002
Медицинский центр Раш — Копли
Аврора, Иллинойс, США, 60504
Северо-западный университет
Чикаго, Иллинойс, США, 60611
Joliet Oncology-Hematology Associates Limited
Джолиет, Иллинойс, США, 60435
Региональный центр здравоохранения «Добрый самаритянин»
Маунт-Вернон, Иллинойс, США, 62864
Carle Clinic-Urbana Main
Урбана, Иллинойс, США, 61801
Клиника Элкхарт
Элкхарт, Индиана, США, 46514-2098
Мичиана Гематология Онкология PC-Elkhart
Элкхарт, Индиана, США, 46514
Больница общего профиля Элкхарт
Элкхарт, Индиана, США, 46515
Университет Индианы/Онкологический центр Мелвина и Брена Саймона
Индианаполис, Индиана, США, 46202
Community Howard Regional Health
Кокомо, Индиана, США, 46904
Больница IU Health La Porte
Ла-Порт, Индиана, США, 46350
Францисканец Saint Anthony Health-Michigan City
Мичиган-Сити, Индиана, США, 46360
Мичиана Онкогематология PC-Mishawaka
Мишавака, Индиана, США, 46545
Региональный медицинский центр Святого Иосифа, Мишавака
Мишавака, Индиана, США, 46545
Мичиана Онкология Онкология PC-Plymouth
Плимут, Индиана, США, 46563
Мемориальный госпиталь Саут-Бенд
Саут-Бенд, Индиана, США, 46601
Онкологический центр штата Мичиана, штат Индиана,
Саут-Бенд, Индиана, США, 46601
Клиника Саут-Бенд
Саут-Бенд, Индиана, США, 46617
Консорциум исследований рака Северной Индианы CCOP
Саут-Бенд, Индиана, США, 46628
Мичиана Онкология гематологии-PC Westville
Вествилл, Индиана, США, 46391
Gynecologic Oncology of West Michigan PLLC
Гранд-Рапидс, Мичиган, США, 49546
Мичиана Онкогематология PC-Niles
Найлс, Мичиган, США, 49120
Лейклендская больница
Сент-Джозеф, Мичиган, США, 49085
Онкологический центр Мари Йегер
Сент-Джозеф, Мичиган, США, 49085
Больница Юго-Восточного Миссури
Кейп-Жирардо, Миссури, США, 63701
Медицинский центр Святого Франциска
Кейп-Жирардо, Миссури, США, 63703
Институт рака и молочной железы Сент-Луиса, Южный город
Сент-Луис, Миссури, США, 63109
Медицинский центр Сент-Джонс Милосердие
Сент-Луис, Миссури, США, 63141
Сент-Луис-Кейп-Жирардо CCOP
Сент-Луис, Миссури, США, 63141
Госпиталь Милосердия Спрингфилд
Спрингфилд, штат Миссури, США, 65804
ООО «Озарк Хелс Венчурс» — Исследование рака для Озарк Спрингфилд
Спрингфилд, Миссури, США, 65804
Женский онкологический центр штата Невада
Лас-Вегас, Невада, США, 89169
Медицинский центр Монтефиоре – кампус Эйнштейна
Бронкс, Нью-Йорк, США, 10461
Государственный университет штата Нью-Йорк Медицинский центр Даунстейт
Бруклин, Нью-Йорк, США, 11203
Медицинский центр Университета Дьюка
Дарем, Северная Каролина, США, 27710
FirstHealth of the Carolinas-Moore Regional Hosiptal
Пайнхерст, Северная Каролина, США, 28374
Медицинский центр Mount Carmel West
Колумбус, Огайо, США, 43222
Центр медицинских наук Университета Оклахомы
Оклахома-Сити, Оклахома, США, 73104
Cancer Care Associates-Midtown
Талса, Оклахома, США, 74104
Онкологический институт Талсы
Талса, Оклахома, США, 74146
Университет Содружества Вирджинии/Онкологический центр Мэсси
Ричмонд, Вирджиния, США, 23298
Колумбийская больница Святой Марии — Озоки
Меквон, Висконсин, США, 53097
Водонапорная башня Колумбии Святой Марии Medical Commons
Милуоки, Висконсин, США, 53211

Рак эндометрия | Медицина Джона Хопкинса

Рак эндометрия является наиболее часто диагностируемым гинекологическим раком. Каждый год около 50 000 американских женщин диагностируют это заболевание. Рак эндометрия также является наиболее распространенной формой рака матки, поэтому его часто называют раком матки.

Что такое рак эндометрия?

Слизистая оболочка матки называется эндометрием. Рак эндометрия является наиболее распространенным раком женских половых органов.

Рак эндометрия отличается от рака соединительной ткани или мышц матки, который называется саркомой матки.Около 80 процентов всех видов рака эндометрия являются аденокарциномами. Это означает, что рак возникает в клетках, которые развивают железы в эндометрии. Рак эндометрия хорошо излечим, если обнаружен на ранней стадии.

Карциносаркома матки — очень редкий тип рака матки, сочетающий признаки как рака эндометрия, так и саркомы матки. Она также известна как злокачественная смешанная мезодермальная опухоль.

Типы рака эндометрия

Рак эндометрия обычно относят к одной из четырех категорий:

  • Мутация p53

  • ПОЛЮСНАЯ мутация

  • Старший номер копии

  • Младший номер копии

Клинические испытания используются для оценки методов лечения рака, обнаруженного в каждой из этих групп, включая новые испытания иммунотерапии.

Профилактика рака эндометрия

Точная причина рака эндометрия неизвестна. Тем не менее, врачи считают, что избегание известных факторов риска, когда это возможно, использование оральных контрацептивов или других форм гормональной контрацепции, борьба с ожирением и диабетом — это лучшие способы снизить риск развития рака эндометрия.

Причины рака эндометрия и факторы риска

Следующие факторы могут увеличить риск развития рака эндометрия у женщин:

  • Ожирение

  • Диета с высоким содержанием животных жиров

  • Семейный анамнез рака эндометрия, яичников и/или толстой кишки (наследственный неполипозный колоректальный рак)

  • Начало месячных в возрасте до 12 лет

  • Поздняя менопауза

  • Бесплодие (неспособность забеременеть)

  • Никогда не иметь детей

  • Лечение тамоксифеном от рака молочной железы

  • Гормональный дисбаланс — в организме слишком много эстрогена и недостаточно прогестерона

  • Заместительная терапия эстрогенами для лечения последствий менопаузы

  • Диабет

  • В личном анамнезе рак молочной железы

  • В личном анамнезе рак яичников

  • Предшествующая лучевая терапия рака малого таза

  • В личном анамнезе синдром поликистозных яичников или атипическая гиперплазия эндометрия

Риск рака эндометрия увеличивается с возрастом у женщин, и чаще всего он встречается у белых женщин.

Симптомы рака эндометрия

Обратитесь к врачу, если вы испытываете какие-либо/все из следующих симптомов:

  • Кровотечение или выделения, не связанные с вашими менструациями (менструация) — более 90 процентов женщин с диагнозом рак эндометрия имеют аномальные вагинальные кровотечения

  • Постменопаузальное кровотечение

  • Затрудненное или болезненное мочеиспускание

  • Боль во время полового акта

  • Боль и/или образование в области таза

Диагностика рака эндометрия

Диагностика рака эндометрия включает изучение истории болезни и общий медицинский осмотр.Он также может включать одно или несколько из следующих действий.

  • Внутренний гинекологический осмотр : Это делается для выявления уплотнений или изменений формы матки.

  • Пап-тест (также называемый мазком Папаниколау) : Этот тест включает микроскопическое исследование клеток, взятых из шейки матки, используемое для выявления изменений, которые могут быть раком или могут привести к раку, а также для выявления нераковых состояний, таких как инфекция или воспаление. .Однако мазок Папаниколау не выявляет рак эндометрия.

  • Биопсия эндометрия : В этой процедуре используется небольшая гибкая трубка, которая вводится в матку для сбора образца ткани эндометрия. Образец исследуют под микроскопом, чтобы увидеть, присутствуют ли раковые или другие аномальные клетки. Процедура биопсии эндометрия часто проводится в кабинете врача.

  • Дилатация и кюретаж (также называемая D&C) : Ваш врач может порекомендовать D&C, если биопсия эндометрия невозможна или если требуется дополнительная диагностическая информация.Это небольшая операция, при которой шейка матки расширяется (открывается) таким образом, чтобы цервикальный канал и слизистую оболочку матки можно было соскоблить кюреткой (инструментом в форме ложки). Патолог исследует ткань на наличие раковых клеток.

  • Трансвагинальное УЗИ (также называемое ультрасонографией) : В этом ультразвуковом исследовании используется небольшой инструмент, называемый датчиком, который помещается во влагалище. Врач может сделать биопсию, если эндометрий выглядит слишком толстым.

Лечение рака эндометрия

Конкретное лечение рака эндометрия будет определено вашим врачом (врачами) на основании:

  • Ваше общее состояние здоровья и история болезни

  • Степень болезни

  • Ваша переносимость определенных лекарств, процедур или методов лечения

  • Ожидания относительно течения болезни

  • Ваше мнение или предпочтение

Выбор лечения зависит от стадии рака — только в эндометрии или если он распространился на другие части матки или тела.Большинству людей сначала будет назначено хирургическое лечение. Некоторым может потребоваться дополнительная терапия. Как правило, лечение людей с раком эндометрия включает одно или несколько из следующих действий.

  • Хирургия:

    • Гистерэктомия — хирургическое удаление матки

    • Сальпингоофорэктомия — операция по удалению маточных труб и яичников

    • Диссекция тазовых лимфатических узлов — удаление некоторых лимфатических узлов из таза

    • Парааортальная лимфаденэктомия — удаление лимфатических узлов, окружающих аорту, главную артерию сердца

    • Лапароскопический забор лимфатических узлов — удаление лимфатических узлов через узкую смотровую трубку, называемую лапароскопом, которая вводится через небольшой разрез (надрез) в брюшной полости (животе)

    • Картирование сторожевых лимфатических узлов — использование флуоресцентной визуализации для выявления потенциально раковых лимфатических узлов, которые иначе остались бы незамеченными

  • Лучевая терапия: использование рентгеновских лучей, гамма-лучей и заряженных частиц для борьбы с раком. Брахитерапия и внешнее лучевое облучение являются наиболее распространенными методами лучевой терапии, используемыми для лечения рака эндометрия. Новые методы брахитерапии на основе изображений с контролем направленного магнитного резонанса (МР) обеспечивают лучшие результаты лечения пациентов и меньше побочных эффектов.

  • Химиотерапия: использование противоопухолевых препаратов для лечения раковых клеток

  • Иммунотерапия: процесс активации естественной способности иммунной системы бороться с раком

  • Гормональная терапия: медикаментозное лечение или хирургические процедуры, влияющие на активность гормонов

Гиперплазия эндометрия согласно китайской медицине

В китайской медицине гиперплазия эндометрия может быть связана с двумя так называемыми «паттернами дисгармонии».Китайская медицина рассматривает тело как систему, а не как сумму отдельных частей. «Паттерн» — это нарушение гармонии системы. Это не эквивалентно западному понятию «болезнь», ведь здесь гиперплазия эндометрия может быть вызвана двумя разными закономерностями.

Чтобы понять, может ли чья-то гиперплазия эндометрия быть вызвана данным паттерном, необходимо искать признаки и симптомы, связанные с паттерном, помимо тех, которые обычно возникают при одной только гиперплазии эндометрия.Например, когда гиперплазия эндометрия вызвана паттерном «Полный холод в направляющих и проникающих сосудах», пациенты также испытывают такие симптомы, как болезненные менструации, холод внизу живота, бесплодие и поздние менструации. Точно так же у пациентов с полным холодом в направляющих и проникающих сосудах обычно наблюдается глубокий (чэнь), медленный (ци) или напряженный (цзинь) пульс, а также синевато-фиолетовый бледный язык.

Мы перечислили ниже описание двух паттернов, связанных с гиперплазией эндометрия, чтобы вы могли начать понимать различные возможности в соответствии с китайской медициной.

После выявления закономерности часто лечат травяными формулами. Питье травяных настоев является наиболее распространенным средством в китайской медицине, наряду с иглоукалыванием. Ниже мы подробно описываем Вэнь Цзин Тан, формулу, которая может помочь в лечении паттернов «Полный холод в направляющих и проникающих сосудах» и «Влажность и мокрота в матке».

Два «паттерна дисгармонии», связанные с гиперплазией эндометрия

Полный холод в направляющих и проникающих сосудах

Сырость и мокрота в матке

Wen Jing Tang, растительная формула, которая может помочь при гиперплазии эндометрия

Вэнь Цзин Тан

Дата источника: 220 г. н.э.

Количество ингредиентов: 12 трав

Основные действия: Согревает матку и сосуды.Питает кровь. Рассеивает Холод. Рассеивает застой крови.

Почему Wen Jing Tang может помочь при гиперплазии эндометрия?

Потому что эту формулу часто рекомендуют для помощи при паттернах «Полная простуда в направляющих и проникающих сосудах» и «Влажность и мокрота в матке», которые иногда связаны с гиперплазией эндометрия. Если какой-либо из этих паттернов похож на то, от чего вы можете страдать, эта формула может помочь (хотя, пожалуйста, заранее обратитесь за подтверждением к профессиональному практикующему врачу).

Узнайте больше о Wen Jing Tang здесь

Факторы риска рака эндометрия у пациенток с гиперплазией эндометрия: значение для клинического лечения | BMC Women’s Health

  • Доэрти М.Т., Санни О.Б., Коулман Х.Г., Кардвелл К.Р., Макклаггедж В.Г., Куинн Д., Уайли Дж., Макменамин UC. Сопутствующий и будущий риск рака эндометрия у женщин с гиперплазией эндометрия: систематический обзор и метаанализ. ПЛОС ОДИН. 2020;15(4):e0232231.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Jordan SJ, Na R, Weiderpass E, Adami HO, Anderson KE, van den Brandt PA, Brinton LA, Chen C, Cook LS, Doherty JA, et al.Исходы беременности и риск рака эндометрия: объединенный анализ данных отдельных участников Консорциума по эпидемиологии рака эндометрия. Инт Джей Рак. 2021;148(9):2068–78.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Clarke MA, Long BJ, Sherman ME, Lemens MA, Podratz KC, Hopkins MR, Ahlberg LJ, Mc Guire LJ, Laughlin-Tommaso SK, Bakkum-Gamez JN, et al. Оценка риска рака эндометрия и внутриэпителиальной неоплазии эндометрия у женщин с аномальным кровотечением и значение для алгоритмов клинического ведения.Am J Obstet Gynecol. 2020;223(4):549.e541–549.e513.

    Артикул Google ученый

  • Падилья-Изерте П., Лаго В., Таусте С., Диас-Фейхоо Б., Хиль-Морено А., Оливер Р., Коронадо П., Мартин-Саламанка М.Б., Пантоха-Гарридо М., Маркос-Санмартин Дж. и др. Влияние маточного манипулятора на онкологический исход хирургии рака эндометрия. Am J Obstet Gynecol. 2021;224(1):65.e61–65.e11.

    Артикул Google ученый

  • Салех М., Вираркар М., Бхосале П., Эль-Шериф С., Джавади С., Фариа СК. Рак эндометрия, текущая система стадирования Международной федерации гинекологии и акушерства и роль визуализации. J Comput Assist Томогр. 2020;44(5):714–29.

    ПабМед Статья ПабМед Центральный Google ученый

  • Jeon J, Kim SE, Lee DY, Choi D. Факторы, связанные с патологией эндометрия во время терапии тамоксифеном у женщин с раком молочной железы: ретроспективный анализ 821 биопсии. Лечение рака молочной железы. 2020;179(1):125–30.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Коктс-Пориетис Р.Л., Макнейл Дж., Нельсон Г., Курниа К.С., Кук Л.С., Фриденрайх К.М. Проспективное когортное исследование метаболического синдрома и выживаемости при раке эндометрия.Гинекол Онкол. 2020;158(3):727–33.

    ПабМед Статья ПабМед Центральный Google ученый

  • Reinholdt K, Kjaer SK, Guleria S, Frederiksen K, Mellemkjaer L, Munk C, Jensen A. Риск рака эндометрия у женщин с доброкачественными опухолями яичников — датское общенациональное когортное исследование. Гинекол Онкол. 2020;157(2):549–54.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Хуан Л., Цзинхэ Л., Лина Г., Цяочжи Л.Гинекологическая онкология. Пекин: Народное медицинское издательство; 2016.

    Google ученый

  • Ассоциация ФРДГоПБоЦМ. Патологические критерии диагностики рака эндометрия. Чин Джей Патол. 2020;49(3):214–9.

    Google ученый

  • Shen L, Wu Y, Li A, Li L, Shen L, Jiang Q, Li Q, Wu Z, Yu L, Zhang X. LncRNA TTNAS1 способствует развитию рака эндометрия путем губчатой ​​миР376a3p.Oncol Rep. 2020;44(4):1343–54.

    КАС пабмед ПабМед Центральный Google ученый

  • Giannella L, Delli Carpini G, Sopracordevole F, Papiccio M, Serri M, Giorda G, Tsiroglou D, Del Fabro A, Ciavattini A. Атипичная гиперплазия эндометрия и неожиданный рак при окончательной гистологии: исследование методов взятия образцов эндометрия и факторы риска. Диагностика (Базель). 2020;10(7):474.

    Артикул Google ученый

  • Мацуо К., Рамзан А.А., Гуалтьери М.Р., Мхавеч-Фаучелья П., Мачида Х., Моейни А., Данч К.Е., Уэда Ю., Роман Л.Д.Прогнозирование сопутствующей карциномы эндометрия у женщин с гиперплазией эндометрия. Гинекол Онкол. 2015;139(2):261–7.

    ПабМед ПабМед Центральный Статья Google ученый

  • Rakha E, Wong SC, Soomro I, Chaudry Z, Sharma A, Deen S, Chan S, Abu J, Nunns D, Williamson K, et al. Клинический исход атипичной гиперплазии эндометрия, диагностированной при биопсии эндометрия: институциональный опыт и обзор литературы.Ам Дж. Сург Патол. 2012;36(11):1683–90.

    ПабМед Статья Google ученый

  • Мацуо К., Мандельбаум Р.С., Чикконе М., Хощерех М., Пурсувани Х., Марокко Э.Б., Мацузаки С., Данц К.Э., Озель Б., Полсон Р.Дж. и др.Специфическая для маршрута связь терапии прогестином и одновременного применения метформина у женщин с ожирением и сложной атипической гиперплазией. Int J Gynecol Рак. 2020;30(9):1331–139.

    ПабМед ПабМед Центральный Google ученый

  • Хатт С., Тейлор А., Эллис П., Майкл А., Батлер-Мануэль С., Чаттерджи Дж. Роль биомаркеров в развитии рака и гиперплазии эндометрия: обзор литературы. Акта Онкол. 2019;58(3):342–52.

    ПабМед Статья ПабМед Центральный Google ученый

  • Travaglino A, Raffone A, Saccone G, Mollo A, De Placido G, Insabato L, Zullo F. Гиперплазия эндометрия и риск сопутствующего рака: ВОЗ в сравнении с критериями EIN. Гистопатология. 2019;74(5):676–87.

    ПабМед Статья ПабМед Центральный Google ученый

  • Пал Н., Броддус Р.Р., Урбауэр Д.Л., Балакришнан Н., Милбурн А., Шмелер К.М., Мейер Л.А., Солиман П.Т., Лу К.Х., Рамирес П.Т. и др.Лечение рака эндометрия низкого риска и сложной атипической гиперплазии с помощью внутриматочной спирали, высвобождающей левоноргестрел. Акушерство Гинекол. 2018;131(1):109–16.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Розен М.В., Тассет Дж., Коберник Э.К., Смит Ю.Р., Джонстон С., Квинт Э.Х. Факторы риска рака или гиперплазии эндометрия у подростков и женщин в возрасте 25 лет и моложе. J Pediatr Adolesc Gynecol. 2019;32(5):546–9.

    ПабМед Статья ПабМед Центральный Google ученый

  • Trimble CL, Kauderer J, Zaino R, Silverberg S, Lim PC, Burke JJ 2nd, Alberts D, Curtin J.Сопутствующая карцинома эндометрия у женщин с диагнозом атипичной гиперплазии эндометрия при биопсии: исследование группы гинекологической онкологии. Рак. 2006;106(4):812–9.

    ПабМед Статья ПабМед Центральный Google ученый

  • Mutter GL, Kauderer J, Baak JP, Alberts D, Gynecologic Oncology G. Гистоморфометрия биопсии предсказывает миоинвазию матки карциномой эндометрия: исследование группы гинекологической онкологии. Хум Патол. 2008;39(6):866–74.

    ПабМед ПабМед Центральный Статья Google ученый

  • Ying Z, Fengzhi F, Ying J. Анализ факторов высокого риска и прогноза гиперплазии эндометрия, осложненной раком эндометрия. J Pract Obstet Gynecol. 2016;32(11):826–9.

    Google ученый

  • Travaglino A, Raffone A, Saccone G, Insabato L, Mollo A, De Placido G, Zullo F. Иммуногистохимические прогностические маркеры ответа на консервативное лечение гиперплазии эндометрия и раннего рака эндометрия: систематический обзор. Acta Obstet Gynecol Scand. 2019;98(9):1086–99.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Harrison RF, He W, Fu S, Zhao H, Sun CC, Suidan RS, Woodard TL, Rauh-Hain JA, Westin SN, Giordano SH, et al. Национальные модели ухода и исходы фертильности у женщин репродуктивного возраста с раком эндометрия или атипичной гиперплазией. Am J Obstet Gynecol. 2019;221(5):474.e471–474.e411.

    Артикул КАС Google ученый

  • Вымпел М.Е., Мехта Р., Муди П., Хакетт Г., Прентис А., Шарп С.Дж., Лакшман Р.Пременопаузальные аномальные маточные кровотечения и риск рака эндометрия. БЖОГ. 2017;124(3):404–11.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Ян Б., Сюй Ю., Чжу Ц., Се Л., Шань В., Нин С., Се Б., Ши Ю., Луо Х. , Чжан Х. и др. Эффективность комплексной гистероскопической оценки и резекции очагов поражения в сочетании с терапией гестагенами у молодых женщин с атипической гиперплазией эндометрия и раком эндометрия.Гинекол Онкол. 2019;153(1):55–62.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Джейлан Ю., Акпинар Г., Догер Э., Касап М., Гузель Н., Караосманоглу К., Копук С.Ю., Ючесой И. Протеомный анализ в тканях рака эндометрия и гиперплазии эндометрия методом 2D-DIGE. J Gynecol Obstet Hum Reprod. 2020;49(2):101652.

    ПабМед Статья ПабМед Центральный Google ученый

  • Травальино А., Раффоне А., Сакконе Г., Молло А., Де Пласидо Г., Масколо М., Инсабато Л., Зулло Ф.Сложность железистой архитектуры следует пересмотреть при классификации и лечении гиперплазии эндометрия. АПМИС. 2019;127(6):427–34.

    ПабМед Статья Google ученый

  • Man GCW, Wang J, Song Y, Wong JH, Zhao Y, Lau TS, Leung KT, Chan TH, Wang H, Kwong J и др.Терапевтический потенциал нового пролекарства экстракта зеленого чая в индукции апоптоза посредством сигнального пути ERK/JNK и Akt при раке эндометрия человека. БМК Рак. 2020;20(1):964.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Zhang G, Chen H, Liu Y, Niu L, Jin L, Li D, Song L, Shang L, Lin X, Wang F и др. Является ли диссекция лимфатических узлов обязательной у больных раком эндометрия на ранней стадии? Ретроспективное исследование. Женское здоровье BMC. 2020;20(1):258.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Raffone A, Travaglino A, Saccone G, D’Alessandro P, Arduino B, Mascolo M, De Placido G, Insabato L, Zullo F. Сахарный диабет связан со скрытым раком при гиперплазии эндометрия. Патол Онкол Рез. 2020;26(3):1377–84.

    ПабМед Статья ПабМед Центральный Google ученый

  • Травальино А., Раффоне А., Сакконе Г., Д’Алессандро П., Ардуино Б., де Пласидо Г., Масколо М., Инсабато Л., Зулло Ф.Значительный риск скрытого рака при сложной неатипической гиперплазии эндометрия. Arch Gynecol Obstet. 2019;300(5):1147–54.

    ПабМед Статья ПабМед Центральный Google ученый

  • Raffone A, Travaglino A, Saccone G, Di Maio A, Mollo A, Mascolo M, De Rosa R, De Placido G, Insabato L, Zullo F. Сахарный диабет и реакция гиперплазии эндометрия и раннего рака эндометрия на консервативное лечение лечение. Гинекол Эндокринол.2019;35(11):932–937.

    ПабМед Статья ПабМед Центральный Google ученый

  • Garzon S, Uccella S, Zorzato PC, Bosco M, Franchi MP, Student V, Mariani A. Лечение рака эндометрия с сохранением фертильности: обзор литературы. Минерва Мед. 2021;112(1):55–69.

    ПабМед Статья ПабМед Центральный Google ученый

  • Dashti SG, English DR, Simpson JA, Karahalios A, Moreno-Betancur M, Biessy C, Rinaldi S, Ferrari P, Tjonneland A, Halkjaer J, et al.Риск ожирения и рака эндометрия у женщин в постменопаузе: последовательный анализ причинно-следственных связей. Рак Эпидемиол Биомарк Пред. 2021;30(1):104–13.

    КАС Статья Google ученый

  • Кордейро Митчелл К.Н., Ханклер К.Ф., Махер Дж.Ю., Гарбоз Р.А., Горнет М.Е., Уайтинг-Коллинз Л.Дж., Кристиансон М.С. Консервативно леченная интраэпителиальная неоплазия/рак эндометрия: риск внутриматочных синехий. J Gynecol Obstet Hum Reprod. 2021;50(5):101930.

    ПабМед Статья ПабМед Центральный Google ученый

  • Раффоне А., Травальино А., Сакконе Г., Сиери М., Масколо М., Молло А., Инсабато Л., Зулло Ф.Диагностическое и прогностическое значение ARID1A при гиперплазии эндометрия: новый маркер скрытого рака. АПМИС. 2019;127(9):597–606.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Raffone A, Travaglino A, Saccone G, Viggiani M, Giampaolino P, Insabato L, Mollo A, De Placido G, Zullo F. Экспрессия PTEN при гиперплазии эндометрия и риск развития рака: систематический обзор и метаанализ. Arch Gynecol Obstet.2019;299(6):1511–24.

    КАС пабмед Статья ПабМед Центральный Google ученый

  • Гулерия С., Дженсен А., Альбьери В., Нор Б., Фредериксен К., Кьяер С.К. Риск рака эндометрия после лечения бесплодия: популяционное когортное исследование. Рак вызывает контроль. 2021;32(2):181–8.

    ПабМед Статья ПабМед Центральный Google ученый

  • Эндометриальная интраэпителиальная неоплазия | ACOG

    ВЫДЕРЖКА: Гиперплазия эндометрия имеет клиническое значение, поскольку часто является предвестником аденокарциномы эндометрия. Проведение различия между гиперплазией и истинными предраковыми поражениями или истинной неоплазией имеет значительный клинический эффект, поскольку их различные риски рака должны быть сопоставлены с соответствующим вмешательством, чтобы избежать недостаточного или избыточного лечения. Патологоанатомический диагноз предраковых поражений должен использовать критерии и терминологию, которые четко различают клинико-патологические состояния, которые лечатся по-разному. В настоящее время схема эндометриальной интраэпителиальной неоплазии наиболее точно адаптирована к этой цели, включая модифицированные патологические критерии, основанные на доказательствах, которые стали доступны после создания в 1994 г. более широко используемой четырехклассовой схемы Всемирной организации здравоохранения (в которой атипичная гиперплазия приравнивается к с предраковым поведением).Точность дилатации и выскабливания по сравнению с отсасыванием эндометрия в диагностике предрака и исключении сопутствующей карциномы неясна. Гистероскопия с прицельной биопсией более чувствительна, чем дилатация и выскабливание в диагностике поражений матки. Когда это клинически целесообразно, тотальная гистерэктомия по поводу внутриэпителиальной неоплазии эндометрия обеспечивает окончательную оценку возможной сопутствующей карциномы и эффективно лечит предраковые поражения. Системная или местная терапия прогестинами является недоказанной, но широко используемой альтернативой гистерэктомии, которая может быть подходящей для женщин, которые не являются кандидатами на хирургическое вмешательство или желают сохранить фертильность.

    Выводы и рекомендации

    Чувствительная и точная диагностика истинных предраковых поражений эндометрия может снизить вероятность развития инвазивного рака эндометрия. Основываясь на имеющихся данных и мнениях экспертов, Американский колледж акушеров и гинекологов и Общество гинекологической онкологии сделали следующие согласованные рекомендации:

    • . ВОЗ94). Патологоанатомический диагноз предраковых поражений должен использовать критерии и терминологию, которые четко различают клинико-патологические состояния, которые лечатся по-разному. В настоящее время схема эндометриальной интраэпителиальной неоплазии наиболее точно адаптирована к этой цели, включая модифицированные патологические критерии, основанные на доказательствах, которые стали доступны после создания более широко используемой схемы ВОЗ94 (в которой атипичная гиперплазия приравнивается к предраковому поведению). Предпочтительной терминологией является «эндометриальная интраэпителиальная неоплазия» (а не «атипичная гиперплазия эндометрия»).

    • Что касается забора ткани, гистероскопия, хотя и не является обязательной, рекомендуется с направленной дилатацией и кюретажем (D&C) для выявления любых отдельных поражений, а также фонового эндометрия. Это обеспечит наилучшую возможность подтвердить диагноз истинного предракового поражения эндометрия и исключить ассоциированную карциному эндометрия. Когда это клинически целесообразно, тотальная гистерэктомия по поводу внутриэпителиальной неоплазии эндометрия обеспечивает окончательную оценку возможной сопутствующей карциномы и эффективно лечит предраковые поражения.

    • Супрацервикальная гистерэктомия, морцелляция и абляция эндометрия неприемлемы для лечения внутриэпителиальной неоплазии эндометрия.

    • Системная или местная терапия прогестинами является недоказанной, но широко используемой альтернативой гистерэктомии, которая может быть подходящей для женщин, которые не являются кандидатами на операцию или желают сохранить фертильность.

    • Наблюдение за постгормональной терапией после нехирургического лечения эндометриальной интраэпителиальной неоплазии может включать серийный забор эндометрия каждые 3-6 месяцев, но соответствующая частота еще не определена.

    Предыстория

    Гиперплазия эндометрия имеет клиническое значение, поскольку часто является предшествующим поражением аденокарциномы эндометрия 1 2. Предшествующим поражением эндометриоидной аденокарциномы I типа является эндометриальная интраэпителиальная неоплазия. Эстрогенная стимуляция эндометрия, не противостоящая прогестинам, вызывает пролиферативные изменения железистого эпителия. Это открытие из-за длительного воздействия гормонов биологически отличается от истинных предраковых поражений и истинной неоплазии.Проведение различия между гиперплазией и истинными предраковыми поражениями или истинной неоплазией имеет значительный клинический эффект, поскольку их различные риски рака должны быть сопоставлены с соответствующим вмешательством, чтобы избежать недостаточного или избыточного лечения. В центре внимания этого мнения Комитета находится классификация гиперплазии эндометрия и варианты лечения. Гинекологи должны знать о двух номенклатурных схемах и о том, что схема внутриэпителиальной неоплазии эндометрия предпочтительнее схемы ВОЗ94.Патологоанатомический диагноз предраковых поражений должен использовать критерии и терминологию, которые четко различают клинико-патологические состояния, которые лечатся по-разному. В настоящее время схема эндометриальной интраэпителиальной неоплазии наиболее точно адаптирована к этой цели, включая модифицированные патологические критерии, основанные на доказательствах, которые стали доступны после создания более широко используемой схемы ВОЗ94 (в которой атипичная гиперплазия приравнивается к предраковому поведению). «Эндометриальная интраэпителиальная неоплазия» (а не «атипичная гиперплазия эндометрия») является предпочтительной терминологией, которая будет использоваться в этом документе.

    Системы классификации гиперплазии эндометрия

    В настоящее время широко используются две системы номенклатуры предраковых заболеваний эндометрия: 1) схема ВОЗ94 и 2) схема диагностики интраэпителиальной неоплазии эндометрия, разработанная Международной совместной группой эндометрия 2. Схема ВОЗ94 классифицирует гистологию на основе на железистую сложность и ядерную атипию и состоит из четырех категорий классификации риска: 1) простая гиперплазия, 2) сложная гиперплазия, 3) простая гиперплазия с атипией и 4) сложная гиперплазия с атипией. Эти категории носят описательный характер, и интерпретация субъективна; соответственно, исследования указывают на плохую воспроизводимость классификации отдельных случаев 3–4. Более того, отдельные категории не предполагают конкретных алгоритмов ведения. Эта старая схема наиболее часто используется патологоанатомами, но переход к номенклатуре эндометриальной интраэпителиальной неоплазии принес бы больше пользы для клинического ведения.

    В схеме эндометриальной интраэпителиальной неоплазии предрак эндометрия называется «эндометриальной интраэпителиальной неоплазией» 5 6.Патологические критерии были использованы для разработки трех категорий заболеваний: 1) доброкачественные (доброкачественная гиперплазия эндометрия), 2) предраковые (эндометриальная интраэпителиальная неоплазия) и 3) злокачественные (аденокарцинома эндометрия, эндометриоидный тип, хорошо дифференцированные) Таблица 1 и Таблица 2. схемы эндометриальной интраэпителиальной неоплазии для рутинно получаемых тканей эндометрия, патологоанатомы представляют клиницисту классификацию по конкретному заболеванию, которая информирует о решениях о лечении. Диагноз с использованием схемы эндометриальной интраэпителиальной неоплазии был подтвержден как прогностический в нескольких ретроспективных исследованиях и одном проспективном исследовании 7, 8, 9.Два из этих исследований также предполагают, что воспроизводимость между исследователями с использованием схемы эндометриальной интраэпителиальной неоплазии может быть выше, чем со схемой ВОЗ94 7, 9, поэтому гинекологи-онкологи предпочитают схему эндометриальной интраэпителиальной неоплазии.

    Диагностика предрака: забор и визуализация эндометрия

    Чувствительное и специфическое выявление предрака эндометрия и исключение сосуществующей карциномы являются предпосылками для ведения пациенток с предраковыми поражениями эндометрия.Исключение сопутствующей карциномы с помощью отсасывающей кюретки эндометрия является особенно проблематичным: примерно 40% пациенток, у которых диагностируют предраковую внутриэпителиальную неоплазию эндометрия с помощью отсасывающей кюретки эндометрия, ставят диагноз карциномы с использованием гистерэктомического образца 8 10.

    Точность D&C по сравнению с отсасыванием эндометрия curette в диагностике предрака и исключении сопутствующей карциномы неясна. Оба имеют ограничения по выборке: примерно 60% образцов D&C берут менее половины полости матки 11.Метод взятия образцов менее важен, если лечение включает радикальное лечение с гистерэктомией, что устраняет риск невозможности диагностировать рак эндометрия. Сообщалось, что устройства для дилатации и кюретажа и аспирационной кюретки для взятия проб эндометрия дают одинаковые показатели выявления рака у пациенток с аномальными маточными кровотечениями. была очевидна при последующей гистерэктомии), чем при использовании кюретки для отсасывания эндометрия (27% по сравнению с 46% соответственно) 13.Объемные образования, воздействующие на полость матки, могут отклонять гибкие устройства для отсасывания эндометрия, что препятствует адекватной оценке полости эндометрия. Гистероскопия с направленной биопсией более чувствительна, чем D&C, в диагностике поражений матки 14. Что касается взятия образцов ткани, гистероскопия, хотя и не является обязательной, рекомендуется с направленной D&C для включения любых отдельных поражений, а также фонового эндометрия. Это обеспечит наилучшую возможность подтвердить диагноз истинного предракового поражения эндометрия и исключить ассоциированную карциному эндометрия.Небольшой объем ткани, полученный с помощью доступных в настоящее время технологий взятия образцов эндометрия, может ограничивать точную оценку риска развития рака. Текущая диагностическая схема должна включать оценку адекватности образца, как это рекомендуется для оценки образцов цервикального цитологического исследования 15.

    Диагностика рака эндометрия у женщин с кровотечением в постменопаузе

    Трансвагинальное ультразвуковое исследование имеет превосходную отрицательную прогностическую ценность для рака эндометрия у женщин с кровотечением в постменопаузе .Когда трансвагинальное УЗИ проводится пациенткам с кровотечением в постменопаузе и обнаруживается толщина эндометрия 4 мм или менее, забор эндометрия не требуется из-за очень низкого риска малигнизации матки у этих пациенток. 16. Толщина эндометрия более 4 мм в пациенткам с постменопаузальным кровотечением следует инициировать альтернативное обследование (например, соногистерографию, офисную гистероскопию или биопсию эндометрия), а также невозможность адекватно визуализировать толщину эндометрия.Значимость толщины эндометрия более 4 мм у бессимптомных пациенток в постменопаузе не установлена, и этот факт не обязательно должен вызывать рутинную оценку 16. Полезность ультразвукового изображения толщины эндометрия для исключения злокачественных новообразований ограничивается пациентками в постменопаузе, у которых имеет кровотечение.

    Лечение эндометриальной интраэпителиальной неоплазии

    Основными задачами у пациенток, у которых впервые диагностирована эндометриальная интраэпителиальная неоплазия, являются следующие: исключение сопутствующей аденокарциномы, разработка плана лечения, учитывающего отсроченное выявление скрытой карциномы, прогрессирование рака эндометрия.Тотальная гистерэктомия является эффективным средством лечения биопсийного диагноза интраэпителиальной неоплазии эндометрия; параметры, определяющие нехирургическое лечение, не так четко определены.

    Хирургическая оценка и варианты лечения

    В случае клинической необходимости тотальная гистерэктомия по поводу эндометриальной интраэпителиальной неоплазии обеспечивает окончательную оценку возможной сопутствующей карциномы и эффективно лечит предраковые поражения 10. Текущие хирургические варианты включают абдоминальные, вагинальные и минимально инвазивные процедуры.Эти методы допустимы для выполнения гистерэктомии с двусторонней сальпингоовариэктомией или без нее у пациенток с диагнозом эндометриальной интраэпителиальной неоплазии по данным биопсии.

    Супрацервикальная гистерэктомия, морцелляция и абляция эндометрия неприемлемы для лечения внутриэпителиальной неоплазии эндометрия. Из-за опасений по поводу основного рака не следует выполнять надшейную гистерэктомию 17. Удаление шейки матки и нижнего сегмента матки вместе с телом матки позволяет определить стадию любого случайно обнаруженного рака и снижает риск остаточной болезни.Морцелляция матки противопоказана пациенткам с подозрением или подтвержденным злокачественным новообразованием матки. Несмотря на это, при таком хирургическом подходе пациенты должны быть четко проинформированы о возможности проведения дополнительной операции для завершения хирургического стадирования в случае выявления карциномы.

    Объем операции может быть изменен на основании интраоперационной оценки и патологоанатомического анализа. Оценка может включать вскрытие образца для оценки грубых признаков опухоли или миоинвазии.Если подозревается инвазивный рак, патологоанатом должен принять решение о том, показан ли анализ замороженных срезов, и хирург должен знать, что существует небольшой риск несоответствия между замороженными и окончательными патологическими интерпретациями.

    Замороженный срез может помочь принять решение о необходимости всестороннего хирургического стадирования. Корреляция между замороженным срезом и окончательной патологией для гистологии, степени и глубины инвазии миометрия составляет примерно 97.5%, 88% и 98,2% соответственно 18. Кроме того, заболевание с высоким риском более эффективно выявляется на замороженных срезах по сравнению с заболеванием с низким риском оценка состояния матки для лучшего отбора пациенток, которым было бы полезно комплексное хирургическое стадирование.

    Комплексное хирургическое стадирование с диссекцией тазовых и парааортальных лимфатических узлов во время гистерэктомии по поводу эндометриальной интраэпителиальной неоплазии может привести к избыточному лечению и увеличению хирургического риска для подавляющего большинства пациенток.Риск сопутствующей карциномы матки высокого риска (высокая степень, глубокая инвазия) у женщин с диагнозом эндометриальной интраэпителиальной неоплазии, полученным при биопсии, составляет примерно 10% 10 20. Диссекция тазовых и парааортальных лимфатических узлов как рутинная часть лечения эндометриоза интраэпителиальная неоплазия привела бы к тому, что подавляющее большинство пациентов подвергались бы неоправданным рискам, связанным с комплексным хирургическим стадированием. Тотальная гистерэктомия, с овариэктомией или без нее, наряду с промыванием брюшины, может быть наиболее подходящим хирургическим лечением эндометриальной интраэпителиальной неоплазии с дополнительным стадированием с привлечением гинеколога-онколога.

    Одним из потенциальных недостатков вагинальной гистерэктомии является техническая сложность удаления яичников в некоторых случаях. Полное хирургическое стадирование, если оно показано, невозможно при вагинальном доступе. Двусторонняя сальпингоофорэктомия не является абсолютно необходимой, особенно у женщин в пременопаузе, и фактически удаление обоих яичников у женщин в пременопаузе или перименопаузе без подтвержденного гинекологического злокачественного новообразования может привести к увеличению общей заболеваемости и смертности 21. Следует взвесить риски хирургической менопаузы. против риска основной карциномы, которая потребует последующей операции по удалению яичников.

    Варианты нехирургического лечения

    Нехирургическое лечение приемлемо для пациентов, желающих иметь потомство в будущем, или пациентов с достаточным количеством сопутствующих заболеваний, препятствующих хирургическому лечению. Терапевтические цели для пациенток, желающих иметь потомство в будущем, включают полное излечение от заболевания, возвращение к нормальной функции эндометрия и предотвращение инвазивной аденокарциномы. Терапевтические цели для пациентов, которые плохо подходят для хирургического лечения, включают стабилизацию заболевания, снижение риска развития рака эндометрия и переход к хроническому медикаментозному лечению.Текущие варианты нехирургического лечения ограничены гормональной терапией.

    В нескольких исследованиях оценивалось использование гормональной терапии для индукции регрессии гиперплазии. Использование прогестинов представляет большой интерес и имеет приемлемый профиль токсичности. Лечение прогестинами может быть вариантом для любого пациента, который хочет сохранить фертильность; любая пациентка с гиперпластическим или предраковым поражением, желающая сохранить матку; и большинство пожилых пациентов с сопутствующими заболеваниями, у которых диагностирована эндометриальная интраэпителиальная неоплазия, злокачественное новообразование низкой степени злокачественности или и то, и другое.

    Прогестерон уравновешивает митогенные эффекты эстрогенов и индуцирует секреторную дифференцировку 22. На сегодняшний день ни доза, ни схема применения прогестиновых препаратов не были хорошо стандартизированы в опубликованных исследованиях, но несколько исследований показали клиническую эффективность прогестинов для лечения эндометриоза. гиперплазия 23 24 25 26 27 28 29 30.

    Медроксипрогестерона ацетат и мегестрола ацетат, с различными дозами и схемами, являются наиболее распространенными прогестиновыми препаратами, используемыми в клинических условиях. Таблица 3.Регресс гиперплазии (простой, сложной и атипичной) наблюдался у 80–90% женщин, получавших медроксипрогестерона ацетат (10 мг в день в течение 12–14 дней в месяц) или микронизированный прогестерон в виде вагинального крема (100 мг в течение 12–14 дней). в месяц) при лечении в течение 3 месяцев 31 32 33 34. Однако при наличии эндометриальной интраэпителиальной неоплазии выше частота неэффективности медикаментозного лечения и последующего развития рака 33.

    Системная или местная терапия прогестинами является недоказанной, но широко используемая альтернатива гистерэктомии, которая может быть подходящей для женщин, которые не являются кандидатами на хирургическое вмешательство или желают сохранить фертильность. В дополнение к системному введению гормональных препаратов в некоторых исследованиях изучалось использование внутриматочных спиралей (ВМС) для доставки прогестинов. Внутриматочная система, высвобождающая левоноргестрел (левоноргестрел ВМС), рассчитанная на 5 лет, представляет собой потенциальную альтернативу пероральному прогестагену. Прогестерон местного действия оказывает на эндометрий в несколько раз более сильное действие, чем системные препараты, и обладает меньшим системным эффектом. Большинство исследований имеют относительно небольшой размер выборки, но в исследовании 105 женщин с простой, сложной или атипичной гиперплазией регрессия гиперплазии при использовании левоноргестреловой ВМС составила до 90%, хотя только приблизительно 67% при наличии атипии. 28.Систематический обзор и метаанализ выявили общую скорость регрессии 69% (95% доверительный интервал, 58–83) в 14 исследованиях (n = 189) женщин с атипичной гиперплазией, получавших пероральные прогестины. Объединение семи исследований (n=36) женщин с атипической гиперплазией, получавших левоноргестреловую ВМС, выявило скорость регрессии 90% (95% доверительный интервал, 62–100) 35.

    Есть еще несколько нерешенных вопросов, касающихся гормональной терапии эндометриальная интраэпителиальная неоплазия. Оптимальная доза и продолжительность лечения не определены, а также не определено, должно ли лечение быть циклическим или непрерывным.Соответствующая продолжительность наблюдения после лечения также не была четко определена. Соответствующие показатели клинического и гистологического ответа на лечение прогестагенами также отсутствуют. Полное обследование эндометрия необходимо для измерения регрессии, сохранения или прогрессирования эндометриальной интраэпителиальной неоплазии. Обследование всей матки после гистерэктомии считается идеальным, но не вариантом для пациенток, получающих консервативное лечение. Наблюдение за постгормональным лечением после нехирургического лечения эндометриальной интраэпителиальной неоплазии может включать серийный забор эндометрия каждые 3-6 месяцев, но соответствующая частота еще не определена.

    Нет единого мнения о предпочтительном нехирургическом лечении эндометриальной интраэпителиальной неоплазии; поэтому трудно рекомендовать стандартный режим. Несколько предлагаемых стратегий лечения показаны в Таблице 3. Лечение пероральным прогестином или 5-летней ВМС с левоноргестрелом является разумным первым вариантом и, исходя из клинической ситуации пациентки (например, отсутствие желания иметь фертильность, завершение деторождения или хирургический кандидат с приемлемым риском) следует продолжать в течение 12 месяцев или более, если не будет выявлено прогрессирование.У многих женщин основная гормональная причина интраэпителиальной неоплазии эндометрия остается после завершения терапии. За отторжением целевого очага может последовать рецидив, если лечение не будет продолжаться бесконечно. Ожирение связано с повышенной заболеваемостью раком эндометрия. Поскольку эндометриальная интраэпителиальная неоплазия часто предшествует раку эндометрия, клиницисты могут рекомендовать пациентам снижение веса или бариатрическую операцию, чтобы снизить риск рецидива. Длительное системное медикаментозное лечение для предотвращения повторного появления эндометриальной интраэпителиальной неоплазии требует осведомленности о возможных побочных эффектах.

    Гиперплазия эндометрия лечение народными средствами: 404, Страница не найдена!

    Добавить комментарий

    Ваш адрес email не будет опубликован.